Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Read fastq files"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 199.53128051757812,
23 "top": 207.51737213134766
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "None",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "Nora Virus Genomes"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset collection",
52 "outputs": [],
53 "position": {
54 "left": 661.5451812744141,
55 "top": 554.5312805175781
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}",
60 "tool_version": null,
61 "type": "data_collection_input",
62 "uuid": "None",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
74 "id": 2,
75 "input_connections": {
76 "input": {
77 "id": 0,
78 "output_name": "output"
79 }
80 },
81 "inputs": [],
82 "label": null,
83 "name": "Clip adapter",
84 "outputs": [
85 {
86 "name": "output",
87 "type": "fasta"
88 }
89 ],
90 "position": {
91 "left": 387.51739501953125,
92 "top": 324.53126525878906
93 },
94 "post_job_actions": {
95 "HideDatasetActionoutput": {
96 "action_arguments": {},
97 "action_type": "HideDatasetAction",
98 "output_name": "output"
99 }
100 },
101 "tool_errors": null,
102 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
103 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}",
104 "tool_version": "1.3.6",
105 "type": "tool",
106 "uuid": "None",
107 "workflow_outputs": []
108 },
109 "3": {
110 "annotation": "",
111 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
112 "id": 3,
113 "input_connections": {
114 "input": {
115 "id": 1,
116 "output_name": "output"
117 }
118 },
119 "inputs": [],
120 "label": null,
121 "name": "Concatenate multiple datasets",
122 "outputs": [
123 {
124 "name": "out_file1",
125 "type": "input"
126 }
127 ],
128 "position": {
129 "left": 955.729248046875,
130 "top": 691.7187805175781
131 },
132 "post_job_actions": {
133 "ChangeDatatypeActionout_file1": {
134 "action_arguments": {
135 "newtype": "fasta"
136 },
137 "action_type": "ChangeDatatypeAction",
138 "output_name": "out_file1"
139 },
140 "HideDatasetActionout_file1": {
141 "action_arguments": {},
142 "action_type": "HideDatasetAction",
143 "output_name": "out_file1"
144 }
145 },
146 "tool_errors": null,
147 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
148 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
149 "tool_version": "0.2",
150 "type": "tool",
151 "uuid": "None",
152 "workflow_outputs": []
153 },
154 "4": {
155 "annotation": "",
156 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
157 "id": 4,
158 "input_connections": {
159 "input": {
160 "id": 2,
161 "output_name": "output"
162 }
163 },
164 "inputs": [],
165 "label": null,
166 "name": "Concatenate multiple datasets",
167 "outputs": [
168 {
169 "name": "out_file1",
170 "type": "input"
171 }
172 ],
173 "position": {
174 "left": 552.5173950195312,
175 "top": 226.54515075683594
176 },
177 "post_job_actions": {
178 "ChangeDatatypeActionout_file1": {
179 "action_arguments": {
180 "newtype": "fasta"
181 },
182 "action_type": "ChangeDatatypeAction",
183 "output_name": "out_file1"
184 },
185 "HideDatasetActionout_file1": {
186 "action_arguments": {},
187 "action_type": "HideDatasetAction",
188 "output_name": "out_file1"
189 },
190 "RenameDatasetActionout_file1": {
191 "action_arguments": {
192 "newname": "clipped Reads"
193 },
194 "action_type": "RenameDatasetAction",
195 "output_name": "out_file1"
196 }
197 },
198 "tool_errors": null,
199 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
200 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
201 "tool_version": "0.2",
202 "type": "tool",
203 "uuid": "None",
204 "workflow_outputs": []
205 },
206 "5": {
207 "annotation": "",
208 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
209 "id": 5,
210 "input_connections": {
211 "input": {
212 "id": 4,
213 "output_name": "out_file1"
214 },
215 "refGenomeSource|ownFile": {
216 "id": 1,
217 "output_name": "output"
218 }
219 },
220 "inputs": [],
221 "label": null,
222 "name": "sRbowtie",
223 "outputs": [
224 {
225 "name": "output",
226 "type": "tabular"
227 },
228 {
229 "name": "aligned",
230 "type": "fasta"
231 },
232 {
233 "name": "unaligned",
234 "type": "fasta"
235 }
236 ],
237 "position": {
238 "left": 846.5451965332031,
239 "top": 264.53126525878906
240 },
241 "post_job_actions": {
242 "HideDatasetActionaligned": {
243 "action_arguments": {},
244 "action_type": "HideDatasetAction",
245 "output_name": "aligned"
246 },
247 "HideDatasetActionoutput": {
248 "action_arguments": {},
249 "action_type": "HideDatasetAction",
250 "output_name": "output"
251 },
252 "HideDatasetActionunaligned": {
253 "action_arguments": {},
254 "action_type": "HideDatasetAction",
255 "output_name": "unaligned"
256 }
257 },
258 "tool_errors": null,
259 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
260 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}",
261 "tool_version": "1.1.2",
262 "type": "tool",
263 "uuid": "None",
264 "workflow_outputs": []
265 },
266 "6": {
267 "annotation": "",
268 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
269 "id": 6,
270 "input_connections": {
271 "input": {
272 "id": 5,
273 "output_name": "output"
274 }
275 },
276 "inputs": [],
277 "label": null,
278 "name": "Concatenate multiple datasets",
279 "outputs": [
280 {
281 "name": "out_file1",
282 "type": "input"
283 }
284 ],
285 "position": {
286 "left": 1188.7500610351562,
287 "top": 518.7500305175781
288 },
289 "post_job_actions": {
290 "ChangeDatatypeActionout_file1": {
291 "action_arguments": {
292 "newtype": "tabular"
293 },
294 "action_type": "ChangeDatatypeAction",
295 "output_name": "out_file1"
296 },
297 "HideDatasetActionout_file1": {
298 "action_arguments": {},
299 "action_type": "HideDatasetAction",
300 "output_name": "out_file1"
301 },
302 "RenameDatasetActionout_file1": {
303 "action_arguments": {
304 "newname": "Read Re-mapping"
305 },
306 "action_type": "RenameDatasetAction",
307 "output_name": "out_file1"
308 }
309 },
310 "tool_errors": null,
311 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
312 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
313 "tool_version": "0.2",
314 "type": "tool",
315 "uuid": "None",
316 "workflow_outputs": []
317 },
318 "7": {
319 "annotation": "",
320 "content_id": "wc_gnu",
321 "id": 7,
322 "input_connections": {
323 "input1": {
324 "id": 5,
325 "output_name": "output"
326 }
327 },
328 "inputs": [],
329 "label": null,
330 "name": "Line/Word/Character count",
331 "outputs": [
332 {
333 "name": "out_file1",
334 "type": "tabular"
335 }
336 ],
337 "position": {
338 "left": 1352.5174560546875,
339 "top": 307.5173797607422
340 },
341 "post_job_actions": {
342 "RenameDatasetActionout_file1": {
343 "action_arguments": {
344 "newname": "nbre of remapped reads"
345 },
346 "action_type": "RenameDatasetAction",
347 "output_name": "out_file1"
348 }
349 },
350 "tool_errors": null,
351 "tool_id": "wc_gnu",
352 "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}",
353 "tool_version": "1.0.0",
354 "type": "tool",
355 "uuid": "None",
356 "workflow_outputs": [
357 {
358 "label": null,
359 "output_name": "out_file1",
360 "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b"
361 }
362 ]
363 },
364 "8": {
365 "annotation": "",
366 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5",
367 "id": 8,
368 "input_connections": {
369 "refGenomeSource|ownFile": {
370 "id": 3,
371 "output_name": "out_file1"
372 },
373 "refGenomeSource|series_0|input": {
374 "id": 6,
375 "output_name": "out_file1"
376 }
377 },
378 "inputs": [],
379 "label": null,
380 "name": "Generate readmap and histograms from alignment files",
381 "outputs": [
382 {
383 "name": "readmap_dataframe",
384 "type": "tabular"
385 },
386 {
387 "name": "size_distribution_dataframe",
388 "type": "tabular"
389 },
390 {
391 "name": "readmap_PDF",
392 "type": "pdf"
393 },
394 {
395 "name": "size_PDF",
396 "type": "pdf"
397 },
398 {
399 "name": "combi_PDF",
400 "type": "pdf"
401 }
402 ],
403 "position": {
404 "left": 1562.4827270507812,
405 "top": 554.982666015625
406 },
407 "post_job_actions": {
408 "HideDatasetActionreadmap_dataframe": {
409 "action_arguments": {},
410 "action_type": "HideDatasetAction",
411 "output_name": "readmap_dataframe"
412 },
413 "HideDatasetActionsize_distribution_dataframe": {
414 "action_arguments": {},
415 "action_type": "HideDatasetAction",
416 "output_name": "size_distribution_dataframe"
417 }
418 },
419 "tool_errors": null,
420 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5",
421 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}",
422 "tool_version": "1.1.5",
423 "type": "tool",
424 "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9",
425 "workflow_outputs": [
426 {
427 "label": null,
428 "output_name": "size_PDF",
429 "uuid": "51ecda12-a282-4c56-8bd9-66f22742b301"
430 },
431 {
432 "label": null,
433 "output_name": "combi_PDF",
434 "uuid": "f9345f64-7f9b-440a-b12a-6d123a46800f"
435 },
436 {
437 "label": null,
438 "output_name": "readmap_PDF",
439 "uuid": "eb151acd-9d6d-4c30-8bc5-9124a9a3d815"
440 }
441 ]
442 }
443 },
444 "uuid": "35f7ef15-bb91-4eca-b8a7-345dc5cb3136"
445 }