Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for remapping in Use Cases 2-1,2",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Small Read fastq files"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 199.53128051757812,
23 "top": 207.51737785339355
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Small Read fastq files\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "None",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "bb3f50ae-6b7e-413f-bc2f-e86b8df2296b"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "AnCV genome"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 639.982666015625,
55 "top": 510.98963737487793
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"AnCV genome\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "5551b3da-5866-4474-8bc2-0f8dfea29902",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "b0f79ec9-f874-48d0-b665-2867dfbf76ac"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
74 "id": 2,
75 "input_connections": {
76 "input": {
77 "id": 0,
78 "output_name": "output"
79 }
80 },
81 "inputs": [],
82 "label": null,
83 "name": "Clip adapter",
84 "outputs": [
85 {
86 "name": "output",
87 "type": "fasta"
88 }
89 ],
90 "position": {
91 "left": 387.51739501953125,
92 "top": 324.53126335144043
93 },
94 "post_job_actions": {
95 "HideDatasetActionoutput": {
96 "action_arguments": {},
97 "action_type": "HideDatasetAction",
98 "output_name": "output"
99 }
100 },
101 "tool_errors": null,
102 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
103 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}",
104 "tool_version": "1.3.6",
105 "type": "tool",
106 "uuid": "None",
107 "workflow_outputs": []
108 },
109 "3": {
110 "annotation": "",
111 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
112 "id": 3,
113 "input_connections": {
114 "input": {
115 "id": 2,
116 "output_name": "output"
117 }
118 },
119 "inputs": [],
120 "label": null,
121 "name": "Concatenate multiple datasets",
122 "outputs": [
123 {
124 "name": "out_file1",
125 "type": "input"
126 }
127 ],
128 "position": {
129 "left": 552.5173950195312,
130 "top": 226.5451488494873
131 },
132 "post_job_actions": {
133 "ChangeDatatypeActionout_file1": {
134 "action_arguments": {
135 "newtype": "fasta"
136 },
137 "action_type": "ChangeDatatypeAction",
138 "output_name": "out_file1"
139 },
140 "HideDatasetActionout_file1": {
141 "action_arguments": {},
142 "action_type": "HideDatasetAction",
143 "output_name": "out_file1"
144 },
145 "RenameDatasetActionout_file1": {
146 "action_arguments": {
147 "newname": "clipped Reads"
148 },
149 "action_type": "RenameDatasetAction",
150 "output_name": "out_file1"
151 }
152 },
153 "tool_errors": null,
154 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
155 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
156 "tool_version": "0.2",
157 "type": "tool",
158 "uuid": "None",
159 "workflow_outputs": []
160 },
161 "4": {
162 "annotation": "",
163 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
164 "id": 4,
165 "input_connections": {
166 "input": {
167 "id": 3,
168 "output_name": "out_file1"
169 },
170 "refGenomeSource|ownFile": {
171 "id": 1,
172 "output_name": "output"
173 }
174 },
175 "inputs": [],
176 "label": null,
177 "name": "sRbowtie",
178 "outputs": [
179 {
180 "name": "output",
181 "type": "tabular"
182 },
183 {
184 "name": "aligned",
185 "type": "fasta"
186 },
187 {
188 "name": "unaligned",
189 "type": "fasta"
190 }
191 ],
192 "position": {
193 "left": 846.545166015625,
194 "top": 264.53126335144043
195 },
196 "post_job_actions": {
197 "HideDatasetActionaligned": {
198 "action_arguments": {},
199 "action_type": "HideDatasetAction",
200 "output_name": "aligned"
201 },
202 "HideDatasetActionoutput": {
203 "action_arguments": {},
204 "action_type": "HideDatasetAction",
205 "output_name": "output"
206 },
207 "HideDatasetActionunaligned": {
208 "action_arguments": {},
209 "action_type": "HideDatasetAction",
210 "output_name": "unaligned"
211 }
212 },
213 "tool_errors": null,
214 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
215 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}",
216 "tool_version": "1.1.2",
217 "type": "tool",
218 "uuid": "None",
219 "workflow_outputs": []
220 },
221 "5": {
222 "annotation": "",
223 "content_id": "wc_gnu",
224 "id": 5,
225 "input_connections": {
226 "input1": {
227 "id": 4,
228 "output_name": "output"
229 }
230 },
231 "inputs": [],
232 "label": null,
233 "name": "Line/Word/Character count",
234 "outputs": [
235 {
236 "name": "out_file1",
237 "type": "tabular"
238 }
239 ],
240 "position": {
241 "left": 1215.5208740234375,
242 "top": 298.52430534362793
243 },
244 "post_job_actions": {
245 "RenameDatasetActionout_file1": {
246 "action_arguments": {
247 "newname": "nbre of remapped reads"
248 },
249 "action_type": "RenameDatasetAction",
250 "output_name": "out_file1"
251 }
252 },
253 "tool_errors": null,
254 "tool_id": "wc_gnu",
255 "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}",
256 "tool_version": "1.0.0",
257 "type": "tool",
258 "uuid": "None",
259 "workflow_outputs": [
260 {
261 "label": null,
262 "output_name": "out_file1",
263 "uuid": "7545c393-0ac1-4c52-b1ba-b34c2ed5462f"
264 }
265 ]
266 },
267 "6": {
268 "annotation": "",
269 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5",
270 "id": 6,
271 "input_connections": {
272 "refGenomeSource|ownFile": {
273 "id": 1,
274 "output_name": "output"
275 },
276 "refGenomeSource|series_0|input": {
277 "id": 4,
278 "output_name": "output"
279 }
280 },
281 "inputs": [],
282 "label": null,
283 "name": "Generate readmap and histograms from alignment files",
284 "outputs": [
285 {
286 "name": "readmap_dataframe",
287 "type": "tabular"
288 },
289 {
290 "name": "size_distribution_dataframe",
291 "type": "tabular"
292 },
293 {
294 "name": "readmap_PDF",
295 "type": "pdf"
296 },
297 {
298 "name": "size_PDF",
299 "type": "pdf"
300 },
301 {
302 "name": "combi_PDF",
303 "type": "pdf"
304 }
305 ],
306 "position": {
307 "left": 1204.49658203125,
308 "top": 412.98612785339355
309 },
310 "post_job_actions": {
311 "HideDatasetActionreadmap_dataframe": {
312 "action_arguments": {},
313 "action_type": "HideDatasetAction",
314 "output_name": "readmap_dataframe"
315 },
316 "HideDatasetActionsize_distribution_dataframe": {
317 "action_arguments": {},
318 "action_type": "HideDatasetAction",
319 "output_name": "size_distribution_dataframe"
320 }
321 },
322 "tool_errors": null,
323 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5",
324 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}",
325 "tool_version": "1.1.5",
326 "type": "tool",
327 "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9",
328 "workflow_outputs": [
329 {
330 "label": null,
331 "output_name": "size_PDF",
332 "uuid": "28a51c7e-58d9-4728-8ac0-04d252cd5943"
333 },
334 {
335 "label": null,
336 "output_name": "combi_PDF",
337 "uuid": "f9aaace3-8bdb-4b83-a40b-d6d9a26fd345"
338 },
339 {
340 "label": null,
341 "output_name": "readmap_PDF",
342 "uuid": "ad51fc18-9cdf-4068-bbee-269801cdbde3"
343 }
344 ]
345 }
346 },
347 "uuid": "e670f707-78ad-4128-8549-8a210c7dcbf1"
348 }