Mercurial > repos > drosofff > metavisitor_workflows
comparison Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga @ 0:4a47903bb4df draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author | drosofff |
---|---|
date | Tue, 05 Apr 2016 06:42:47 -0400 |
parents | |
children | 48b020a0d2f7 |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:4a47903bb4df |
---|---|
1 { | |
2 "a_galaxy_workflow": "true", | |
3 "annotation": "", | |
4 "format-version": "0.1", | |
5 "name": "Metavisitor: Workflow for remapping in Use Cases 2-1,2", | |
6 "steps": { | |
7 "0": { | |
8 "annotation": "", | |
9 "content_id": null, | |
10 "id": 0, | |
11 "input_connections": {}, | |
12 "inputs": [ | |
13 { | |
14 "description": "", | |
15 "name": "Small Read fastq files" | |
16 } | |
17 ], | |
18 "label": null, | |
19 "name": "Input dataset collection", | |
20 "outputs": [], | |
21 "position": { | |
22 "left": 199.53128051757812, | |
23 "top": 207.51737785339355 | |
24 }, | |
25 "tool_errors": null, | |
26 "tool_id": null, | |
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Small Read fastq files\"}", | |
28 "tool_version": null, | |
29 "type": "data_collection_input", | |
30 "uuid": "None", | |
31 "workflow_outputs": [ | |
32 { | |
33 "label": null, | |
34 "output_name": "output", | |
35 "uuid": "bb3f50ae-6b7e-413f-bc2f-e86b8df2296b" | |
36 } | |
37 ] | |
38 }, | |
39 "1": { | |
40 "annotation": "", | |
41 "content_id": null, | |
42 "id": 1, | |
43 "input_connections": {}, | |
44 "inputs": [ | |
45 { | |
46 "description": "", | |
47 "name": "AnCV genome" | |
48 } | |
49 ], | |
50 "label": null, | |
51 "name": "Input dataset", | |
52 "outputs": [], | |
53 "position": { | |
54 "left": 639.982666015625, | |
55 "top": 510.98963737487793 | |
56 }, | |
57 "tool_errors": null, | |
58 "tool_id": null, | |
59 "tool_state": "{\"name\": \"AnCV genome\"}", | |
60 "tool_version": null, | |
61 "type": "data_input", | |
62 "uuid": "5551b3da-5866-4474-8bc2-0f8dfea29902", | |
63 "workflow_outputs": [ | |
64 { | |
65 "label": null, | |
66 "output_name": "output", | |
67 "uuid": "b0f79ec9-f874-48d0-b665-2867dfbf76ac" | |
68 } | |
69 ] | |
70 }, | |
71 "2": { | |
72 "annotation": "", | |
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", | |
74 "id": 2, | |
75 "input_connections": { | |
76 "input": { | |
77 "id": 0, | |
78 "output_name": "output" | |
79 } | |
80 }, | |
81 "inputs": [], | |
82 "label": null, | |
83 "name": "Clip adapter", | |
84 "outputs": [ | |
85 { | |
86 "name": "output", | |
87 "type": "fasta" | |
88 } | |
89 ], | |
90 "position": { | |
91 "left": 387.51739501953125, | |
92 "top": 324.53126335144043 | |
93 }, | |
94 "post_job_actions": { | |
95 "HideDatasetActionoutput": { | |
96 "action_arguments": {}, | |
97 "action_type": "HideDatasetAction", | |
98 "output_name": "output" | |
99 } | |
100 }, | |
101 "tool_errors": null, | |
102 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", | |
103 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", | |
104 "tool_version": "1.3.6", | |
105 "type": "tool", | |
106 "uuid": "None", | |
107 "workflow_outputs": [] | |
108 }, | |
109 "3": { | |
110 "annotation": "", | |
111 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | |
112 "id": 3, | |
113 "input_connections": { | |
114 "input": { | |
115 "id": 2, | |
116 "output_name": "output" | |
117 } | |
118 }, | |
119 "inputs": [], | |
120 "label": null, | |
121 "name": "Concatenate multiple datasets", | |
122 "outputs": [ | |
123 { | |
124 "name": "out_file1", | |
125 "type": "input" | |
126 } | |
127 ], | |
128 "position": { | |
129 "left": 552.5173950195312, | |
130 "top": 226.5451488494873 | |
131 }, | |
132 "post_job_actions": { | |
133 "ChangeDatatypeActionout_file1": { | |
134 "action_arguments": { | |
135 "newtype": "fasta" | |
136 }, | |
137 "action_type": "ChangeDatatypeAction", | |
138 "output_name": "out_file1" | |
139 }, | |
140 "HideDatasetActionout_file1": { | |
141 "action_arguments": {}, | |
142 "action_type": "HideDatasetAction", | |
143 "output_name": "out_file1" | |
144 }, | |
145 "RenameDatasetActionout_file1": { | |
146 "action_arguments": { | |
147 "newname": "clipped Reads" | |
148 }, | |
149 "action_type": "RenameDatasetAction", | |
150 "output_name": "out_file1" | |
151 } | |
152 }, | |
153 "tool_errors": null, | |
154 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | |
155 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", | |
156 "tool_version": "0.2", | |
157 "type": "tool", | |
158 "uuid": "None", | |
159 "workflow_outputs": [] | |
160 }, | |
161 "4": { | |
162 "annotation": "", | |
163 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", | |
164 "id": 4, | |
165 "input_connections": { | |
166 "input": { | |
167 "id": 3, | |
168 "output_name": "out_file1" | |
169 }, | |
170 "refGenomeSource|ownFile": { | |
171 "id": 1, | |
172 "output_name": "output" | |
173 } | |
174 }, | |
175 "inputs": [], | |
176 "label": null, | |
177 "name": "sRbowtie", | |
178 "outputs": [ | |
179 { | |
180 "name": "output", | |
181 "type": "tabular" | |
182 }, | |
183 { | |
184 "name": "aligned", | |
185 "type": "fasta" | |
186 }, | |
187 { | |
188 "name": "unaligned", | |
189 "type": "fasta" | |
190 } | |
191 ], | |
192 "position": { | |
193 "left": 846.545166015625, | |
194 "top": 264.53126335144043 | |
195 }, | |
196 "post_job_actions": { | |
197 "HideDatasetActionaligned": { | |
198 "action_arguments": {}, | |
199 "action_type": "HideDatasetAction", | |
200 "output_name": "aligned" | |
201 }, | |
202 "HideDatasetActionoutput": { | |
203 "action_arguments": {}, | |
204 "action_type": "HideDatasetAction", | |
205 "output_name": "output" | |
206 }, | |
207 "HideDatasetActionunaligned": { | |
208 "action_arguments": {}, | |
209 "action_type": "HideDatasetAction", | |
210 "output_name": "unaligned" | |
211 } | |
212 }, | |
213 "tool_errors": null, | |
214 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", | |
215 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", | |
216 "tool_version": "1.1.2", | |
217 "type": "tool", | |
218 "uuid": "None", | |
219 "workflow_outputs": [] | |
220 }, | |
221 "5": { | |
222 "annotation": "", | |
223 "content_id": "wc_gnu", | |
224 "id": 5, | |
225 "input_connections": { | |
226 "input1": { | |
227 "id": 4, | |
228 "output_name": "output" | |
229 } | |
230 }, | |
231 "inputs": [], | |
232 "label": null, | |
233 "name": "Line/Word/Character count", | |
234 "outputs": [ | |
235 { | |
236 "name": "out_file1", | |
237 "type": "tabular" | |
238 } | |
239 ], | |
240 "position": { | |
241 "left": 1215.5208740234375, | |
242 "top": 298.52430534362793 | |
243 }, | |
244 "post_job_actions": { | |
245 "RenameDatasetActionout_file1": { | |
246 "action_arguments": { | |
247 "newname": "nbre of remapped reads" | |
248 }, | |
249 "action_type": "RenameDatasetAction", | |
250 "output_name": "out_file1" | |
251 } | |
252 }, | |
253 "tool_errors": null, | |
254 "tool_id": "wc_gnu", | |
255 "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", | |
256 "tool_version": "1.0.0", | |
257 "type": "tool", | |
258 "uuid": "None", | |
259 "workflow_outputs": [ | |
260 { | |
261 "label": null, | |
262 "output_name": "out_file1", | |
263 "uuid": "7545c393-0ac1-4c52-b1ba-b34c2ed5462f" | |
264 } | |
265 ] | |
266 }, | |
267 "6": { | |
268 "annotation": "", | |
269 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", | |
270 "id": 6, | |
271 "input_connections": { | |
272 "refGenomeSource|ownFile": { | |
273 "id": 1, | |
274 "output_name": "output" | |
275 }, | |
276 "refGenomeSource|series_0|input": { | |
277 "id": 4, | |
278 "output_name": "output" | |
279 } | |
280 }, | |
281 "inputs": [], | |
282 "label": null, | |
283 "name": "Generate readmap and histograms from alignment files", | |
284 "outputs": [ | |
285 { | |
286 "name": "readmap_dataframe", | |
287 "type": "tabular" | |
288 }, | |
289 { | |
290 "name": "size_distribution_dataframe", | |
291 "type": "tabular" | |
292 }, | |
293 { | |
294 "name": "readmap_PDF", | |
295 "type": "pdf" | |
296 }, | |
297 { | |
298 "name": "size_PDF", | |
299 "type": "pdf" | |
300 }, | |
301 { | |
302 "name": "combi_PDF", | |
303 "type": "pdf" | |
304 } | |
305 ], | |
306 "position": { | |
307 "left": 1204.49658203125, | |
308 "top": 412.98612785339355 | |
309 }, | |
310 "post_job_actions": { | |
311 "HideDatasetActionreadmap_dataframe": { | |
312 "action_arguments": {}, | |
313 "action_type": "HideDatasetAction", | |
314 "output_name": "readmap_dataframe" | |
315 }, | |
316 "HideDatasetActionsize_distribution_dataframe": { | |
317 "action_arguments": {}, | |
318 "action_type": "HideDatasetAction", | |
319 "output_name": "size_distribution_dataframe" | |
320 } | |
321 }, | |
322 "tool_errors": null, | |
323 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", | |
324 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", | |
325 "tool_version": "1.1.5", | |
326 "type": "tool", | |
327 "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", | |
328 "workflow_outputs": [ | |
329 { | |
330 "label": null, | |
331 "output_name": "size_PDF", | |
332 "uuid": "28a51c7e-58d9-4728-8ac0-04d252cd5943" | |
333 }, | |
334 { | |
335 "label": null, | |
336 "output_name": "combi_PDF", | |
337 "uuid": "f9aaace3-8bdb-4b83-a40b-d6d9a26fd345" | |
338 }, | |
339 { | |
340 "label": null, | |
341 "output_name": "readmap_PDF", | |
342 "uuid": "ad51fc18-9cdf-4068-bbee-269801cdbde3" | |
343 } | |
344 ] | |
345 } | |
346 }, | |
347 "uuid": "e670f707-78ad-4128-8549-8a210c7dcbf1" | |
348 } |