diff Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga @ 0:4a47903bb4df draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga	Tue Apr 05 06:42:47 2016 -0400
@@ -0,0 +1,462 @@
+{
+    "a_galaxy_workflow": "true", 
+    "annotation": "", 
+    "format-version": "0.1", 
+    "name": "Metavisitor: Workflow for Use Case 1-4", 
+    "steps": {
+        "0": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 0, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "Input Dataset Collection"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset collection", 
+            "outputs": [], 
+            "position": {
+                "left": 211.94445514678955, 
+                "top": 200.00001525878906
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", 
+            "tool_version": null, 
+            "type": "data_collection_input", 
+            "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "f9af6731-280d-4606-b7c3-ff6e5bc0870e"
+                }
+            ]
+        }, 
+        "1": {
+            "annotation": "", 
+            "content_id": null, 
+            "id": 1, 
+            "input_connections": {}, 
+            "inputs": [
+                {
+                    "description": "", 
+                    "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
+                }
+            ], 
+            "label": null, 
+            "name": "Input dataset", 
+            "outputs": [], 
+            "position": {
+                "left": 1024.9826965332031, 
+                "top": 963.9931259155273
+            }, 
+            "tool_errors": null, 
+            "tool_id": null, 
+            "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", 
+            "tool_version": null, 
+            "type": "data_input", 
+            "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "89f3e51c-db84-4ff4-85f3-d3030a160685"
+                }
+            ]
+        }, 
+        "2": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "id": 2, 
+            "input_connections": {
+                "input": {
+                    "id": 0, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Clip adapter", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 420.4861297607422, 
+                "top": 292.5000228881836
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", 
+            "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", 
+            "tool_version": "1.3.6", 
+            "type": "tool", 
+            "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "5d28fac9-5b17-48b1-927d-5ae3fbcd2790"
+                }
+            ]
+        }, 
+        "3": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "id": 3, 
+            "input_connections": {
+                "input": {
+                    "id": 2, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Concatenate multiple datasets", 
+            "outputs": [
+                {
+                    "name": "out_file1", 
+                    "type": "input"
+                }
+            ], 
+            "position": {
+                "left": 452.50001525878906, 
+                "top": 463.48961639404297
+            }, 
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "fasta"
+                    }, 
+                    "action_type": "ChangeDatatypeAction", 
+                    "output_name": "out_file1"
+                }, 
+                "HideDatasetActionout_file1": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", 
+            "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", 
+            "tool_version": "0.2", 
+            "type": "tool", 
+            "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", 
+            "workflow_outputs": []
+        }, 
+        "4": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 4, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 3, 
+                    "output_name": "out_file1"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 631.5972595214844, 
+                "top": 605.5903244018555
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "c700f2a8-231e-4792-a0cc-0e542d36b414", 
+            "workflow_outputs": []
+        }, 
+        "5": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "id": 5, 
+            "input_connections": {
+                "switch|input": {
+                    "id": 4, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "fasta - tabular", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 740.5729675292969, 
+                "top": 786.5799179077148
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Initial Clipped sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "output"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0", 
+            "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}", 
+            "tool_version": "1.1.0", 
+            "type": "tool", 
+            "uuid": "a51f4a8a-2bea-4fc8-97a5-97af74cd4144", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output", 
+                    "uuid": "28b7e800-5b85-4a42-9af3-7399c7306071"
+                }
+            ]
+        }, 
+        "6": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "id": 6, 
+            "input_connections": {
+                "input": {
+                    "id": 5, 
+                    "output_name": "output"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "sRbowtie", 
+            "outputs": [
+                {
+                    "name": "output", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "aligned", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "unaligned", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 830.4861755371094, 
+                "top": 288.4896011352539
+            }, 
+            "post_job_actions": {
+                "HideDatasetActionaligned": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "aligned"
+                }, 
+                "HideDatasetActionoutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "output"
+                }, 
+                "RenameDatasetActionunaligned": {
+                    "action_arguments": {
+                        "newname": "Non D. melanogaster sequences"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", 
+            "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", 
+            "tool_version": "1.1.2", 
+            "type": "tool", 
+            "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "unaligned", 
+                    "uuid": "ffe3bdf3-dea8-420a-8e04-498463c26691"
+                }
+            ]
+        }, 
+        "7": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "id": 7, 
+            "input_connections": {
+                "inputs_0|input": {
+                    "id": 6, 
+                    "output_name": "unaligned"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Oases_optimiser", 
+            "outputs": [
+                {
+                    "name": "transcripts", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1099.4965515136719, 
+                "top": 509.49654388427734
+            }, 
+            "post_job_actions": {
+                "RenameDatasetActiontranscripts": {
+                    "action_arguments": {
+                        "newname": "Oases Contigs"
+                    }, 
+                    "action_type": "RenameDatasetAction", 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", 
+            "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", 
+            "tool_version": "1.1.4", 
+            "type": "tool", 
+            "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "transcripts", 
+                    "uuid": "f5bf1efc-241a-4b48-8fda-5d83ca3eb956"
+                }
+            ]
+        }, 
+        "8": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "id": 8, 
+            "input_connections": {
+                "db_opts|histdb": {
+                    "id": 1, 
+                    "output_name": "output"
+                }, 
+                "query": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "NCBI BLAST+ blastn", 
+            "outputs": [
+                {
+                    "name": "output1", 
+                    "type": "tabular"
+                }
+            ], 
+            "position": {
+                "left": 1273.4895935058594, 
+                "top": 800.4861679077148
+            }, 
+            "post_job_actions": {}, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", 
+            "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", 
+            "tool_version": "0.1.06", 
+            "type": "tool", 
+            "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "output1", 
+                    "uuid": "c53ba510-461f-4f0d-a075-d8c97924beab"
+                }
+            ]
+        }, 
+        "9": {
+            "annotation": "", 
+            "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "id": 9, 
+            "input_connections": {
+                "blast": {
+                    "id": 8, 
+                    "output_name": "output1"
+                }, 
+                "sequences": {
+                    "id": 7, 
+                    "output_name": "transcripts"
+                }
+            }, 
+            "inputs": [], 
+            "label": null, 
+            "name": "Parse blast output and compile hits", 
+            "outputs": [
+                {
+                    "name": "tabularOutput", 
+                    "type": "tabular"
+                }, 
+                {
+                    "name": "fastaOutput", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "al_sequences", 
+                    "type": "fasta"
+                }, 
+                {
+                    "name": "un_sequences", 
+                    "type": "fasta"
+                }
+            ], 
+            "position": {
+                "left": 1564.9827575683594, 
+                "top": 513.489616394043
+            }, 
+            "post_job_actions": {
+                "HideDatasetActional_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "al_sequences"
+                }, 
+                "HideDatasetActionfastaOutput": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "fastaOutput"
+                }, 
+                "HideDatasetActionun_sequences": {
+                    "action_arguments": {}, 
+                    "action_type": "HideDatasetAction", 
+                    "output_name": "un_sequences"
+                }
+            }, 
+            "tool_errors": null, 
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", 
+            "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"use_filters\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", 
+            "tool_version": "2.4.3", 
+            "type": "tool", 
+            "uuid": "84989771-81db-4d86-bff6-cfda892b1959", 
+            "workflow_outputs": [
+                {
+                    "label": null, 
+                    "output_name": "tabularOutput", 
+                    "uuid": "8b327d4e-27c9-4ec3-a4f7-be8f8ea27452"
+                }
+            ]
+        }
+    }, 
+    "uuid": "50e69b15-e7a2-4e1d-8fc4-47f35223efd4"
+}
\ No newline at end of file