Mercurial > repos > drosofff > metavisitor_workflows
view Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga @ 4:46614c7dd247 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit 3db1fee84ce9679a358ea55630cac47a16256a30
author | drosofff |
---|---|
date | Sun, 16 Apr 2017 19:14:41 -0400 |
parents | ba15c770fd40 |
children | 26e2d79e4c17 |
line wrap: on
line source
{ "a_galaxy_workflow": "true", "annotation": "", "format-version": "0.1", "name": "Metavisitor: Workflow for Use Case 1-2", "steps": { "0": { "annotation": "", "content_id": null, "id": 0, "input_connections": {}, "inputs": [ { "description": "", "name": "Input Dataset Collection" } ], "label": null, "name": "Input dataset collection", "outputs": [], "position": { "left": 211.9375, "top": 200 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", "tool_version": null, "type": "data_collection_input", "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "940fadea-7557-4c56-a6df-c58db232b6f0" } ] }, "1": { "annotation": "", "content_id": null, "id": 1, "input_connections": {}, "inputs": [ { "description": "", "name": "viral nucleotide BLAST database (NCBI 19-10-2015)" } ], "label": null, "name": "Input dataset", "outputs": [], "position": { "left": 1024.9375, "top": 963.984375 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", "tool_version": null, "type": "data_input", "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "9a03415f-fd4b-43ea-ae2d-c9004b97d703" } ] }, "2": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", "id": 2, "input_connections": {}, "inputs": [], "label": null, "name": "Retrieve FASTA from NCBI", "outputs": [ { "name": "outfilename", "type": "fasta" }, { "name": "logfile", "type": "txt" } ], "position": { "left": 1587.5, "top": 994.484375 }, "post_job_actions": { "HideDatasetActionlogfile": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "logfile" }, "RenameDatasetActionoutfilename": { "action_arguments": { "newname": "${ncbi_guide_ID}" }, "action_type": "RenameDatasetAction", "output_name": "outfilename" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", "tool_shed_repository": { "changeset_revision": "a9d8f69d59fb", "name": "fetch_fasta_from_ncbi", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", "tool_version": "0.9.4", "type": "tool", "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", "workflow_outputs": [ { "label": null, "output_name": "outfilename", "uuid": "4a4625bf-6029-4f4d-b110-3bec39c97ef3" } ] }, "3": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", "id": 3, "input_connections": { "input": { "id": 0, "output_name": "output" } }, "inputs": [], "label": null, "name": "Clip adapter", "outputs": [ { "name": "output", "type": "fasta" } ], "position": { "left": 420.46875, "top": 292.5 }, "post_job_actions": {}, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", "tool_shed_repository": { "changeset_revision": "a18edcf9c7ed", "name": "yac_clipper", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", "tool_version": "1.3.6", "type": "tool", "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "54f9c80d-225e-4239-b813-bdebca04d857" } ] }, "4": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.08", "id": 4, "input_connections": { "input_file": { "id": 2, "output_name": "outfilename" } }, "inputs": [], "label": null, "name": "NCBI BLAST+ makeblastdb", "outputs": [ { "name": "outfile", "type": "data" } ], "position": { "left": 1866.484375, "top": 1084.484375 }, "post_job_actions": { "HideDatasetActionoutfile": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "outfile" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.08", "tool_shed_repository": { "changeset_revision": "3034ce97dd33", "name": "ncbi_blast_plus", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", "tool_version": "0.1.08", "type": "tool", "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", "workflow_outputs": [] }, "5": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "id": 5, "input_connections": { "input": { "id": 3, "output_name": "output" } }, "inputs": [], "label": null, "name": "Concatenate multiple datasets", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 576.5, "top": 418.484375 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { "action_arguments": { "newtype": "fasta" }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" }, "HideDatasetActionout_file1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "tool_shed_repository": { "changeset_revision": "201c568972c3", "name": "concatenate_multiple_datasets", "owner": "mvdbeek", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", "tool_version": "0.2", "type": "tool", "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", "workflow_outputs": [] }, "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", "id": 6, "input_connections": { "input": { "id": 5, "output_name": "out_file1" } }, "inputs": [], "label": null, "name": "sRbowtie", "outputs": [ { "name": "output", "type": "tabular" }, { "name": "aligned", "type": "fasta" }, { "name": "unaligned", "type": "fasta" } ], "position": { "left": 830.46875, "top": 288.484375 }, "post_job_actions": { "HideDatasetActionaligned": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "aligned" }, "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "RenameDatasetActionunaligned": { "action_arguments": { "newname": "Non D. melanogaster sequences" }, "action_type": "RenameDatasetAction", "output_name": "unaligned" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", "tool_shed_repository": { "changeset_revision": "615d2550977f", "name": "msp_sr_bowtie", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", "tool_version": "1.1.2.1", "type": "tool", "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", "workflow_outputs": [ { "label": null, "output_name": "unaligned", "uuid": "48d4c763-e2ec-40d5-8eec-a19107d5c41c" } ] }, "7": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.2.1", "id": 7, "input_connections": { "inputs_0|input": { "id": 6, "output_name": "unaligned" } }, "inputs": [], "label": null, "name": "Oases_optimiser", "outputs": [ { "name": "transcripts", "type": "fasta" } ], "position": { "left": 1099.46875, "top": 509.484375 }, "post_job_actions": { "RenameDatasetActiontranscripts": { "action_arguments": { "newname": "Oases Contigs" }, "action_type": "RenameDatasetAction", "output_name": "transcripts" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.2.1", "tool_shed_repository": { "changeset_revision": "68ed36eed6c5", "name": "msp_oases", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", "tool_version": "1.1.5", "type": "tool", "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", "workflow_outputs": [ { "label": null, "output_name": "transcripts", "uuid": "0e1ec8f7-c026-4982-b854-6d406ffb5d10" } ] }, "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.08", "id": 8, "input_connections": { "db_opts|histdb": { "id": 1, "output_name": "output" }, "query": { "id": 7, "output_name": "transcripts" } }, "inputs": [], "label": null, "name": "NCBI BLAST+ blastn", "outputs": [ { "name": "output1", "type": "tabular" } ], "position": { "left": 1273.484375, "top": 800.484375 }, "post_job_actions": { "HideDatasetActionoutput1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.08", "tool_shed_repository": { "changeset_revision": "3034ce97dd33", "name": "ncbi_blast_plus", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"false\\\", \\\"filter_query\\\": \\\"true\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", "tool_version": "0.1.08", "type": "tool", "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", "workflow_outputs": [] }, "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", "id": 9, "input_connections": { "blast": { "id": 8, "output_name": "output1" }, "sequences": { "id": 7, "output_name": "transcripts" } }, "inputs": [], "label": null, "name": "Parse blast output and compile hits", "outputs": [ { "name": "tabularOutput", "type": "tabular" }, { "name": "fastaOutput", "type": "fasta" }, { "name": "al_sequences", "type": "fasta" }, { "name": "un_sequences", "type": "fasta" } ], "position": { "left": 1563.984375, "top": 513.484375 }, "post_job_actions": { "HideDatasetActional_sequences": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "al_sequences" }, "HideDatasetActionun_sequences": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "un_sequences" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", "tool_shed_repository": { "changeset_revision": "1991c830504a", "name": "msp_blastparser_and_hits", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", "tool_version": "2.4.3", "type": "tool", "uuid": "84989771-81db-4d86-bff6-cfda892b1959", "workflow_outputs": [ { "label": null, "output_name": "tabularOutput", "uuid": "d53d4680-1c8c-4397-8369-936ca8f283c1" }, { "label": null, "output_name": "fastaOutput", "uuid": "082373bd-ddaf-472f-b669-0eca37d75d80" } ] }, "10": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", "id": 10, "input_connections": { "inputSequences": { "id": 9, "output_name": "fastaOutput" } }, "inputs": [], "label": null, "name": "cap3", "outputs": [ { "name": "contigsandsinglets", "type": "fasta" }, { "name": "cap3stdout", "type": "txt" }, { "name": "contigs", "type": "fasta" }, { "name": "contigsqual", "type": "txt" }, { "name": "contigslink", "type": "txt" }, { "name": "ace", "type": "txt" }, { "name": "info", "type": "txt" }, { "name": "singlets", "type": "txt" } ], "position": { "left": 1924.484375, "top": 666.484375 }, "post_job_actions": { "HideDatasetActionace": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "ace" }, "HideDatasetActioncap3stdout": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "cap3stdout" }, "HideDatasetActioncontigs": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "contigs" }, "HideDatasetActioncontigslink": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "contigslink" }, "HideDatasetActioncontigsqual": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "contigsqual" }, "HideDatasetActioninfo": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "info" }, "HideDatasetActionsinglets": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "singlets" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", "tool_shed_repository": { "changeset_revision": "ddb463fdf57e", "name": "msp_cap3", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", "tool_version": "1.2.0", "type": "tool", "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", "workflow_outputs": [ { "label": null, "output_name": "contigsandsinglets", "uuid": "029bd9db-59a4-4683-8136-86c80fb5e8d6" } ] }, "11": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.08", "id": 11, "input_connections": { "db_opts|histdb": { "id": 4, "output_name": "outfile" }, "query": { "id": 10, "output_name": "contigsandsinglets" } }, "inputs": [], "label": null, "name": "NCBI BLAST+ blastn", "outputs": [ { "name": "output1", "type": "tabular" } ], "position": { "left": 2234.484375, "top": 956.484375 }, "post_job_actions": { "HideDatasetActionoutput1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.08", "tool_shed_repository": { "changeset_revision": "3034ce97dd33", "name": "ncbi_blast_plus", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", "tool_version": "0.1.08", "type": "tool", "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", "workflow_outputs": [] }, "12": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", "id": 12, "input_connections": { "blast_tab": { "id": 11, "output_name": "output1" }, "guideSequence": { "id": 2, "output_name": "outfilename" }, "sequences": { "id": 10, "output_name": "contigsandsinglets" } }, "inputs": [], "label": null, "name": "blast_to_scaffold", "outputs": [ { "name": "output", "type": "fasta" } ], "position": { "left": 2535, "top": 774.5 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", "tool_shed_repository": { "changeset_revision": "81ffa74cf96e", "name": "blast_to_scaffold", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", "tool_version": "0.9.0", "type": "tool", "uuid": "ca2b5401-fc07-4d46-8d5e-3a77a3e3b174", "workflow_outputs": [] }, "13": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", "id": 13, "input_connections": { "input": { "id": 12, "output_name": "output" } }, "inputs": [], "label": null, "name": "Regex Find And Replace", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 2726.984375, "top": 1140 }, "post_job_actions": { "ChangeDatatypeActionout_file1": { "action_arguments": { "newtype": "fasta" }, "action_type": "ChangeDatatypeAction", "output_name": "out_file1" }, "RenameDatasetActionout_file1": { "action_arguments": { "newname": "Nora_raw_reads_${ncbi_guide_ID}_guided" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", "tool_shed_repository": { "changeset_revision": "9ea374bb0350", "name": "regex_find_replace", "owner": "jjohnson", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_raw_reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", "tool_version": "0.1.0", "type": "tool", "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", "workflow_outputs": [ { "label": null, "output_name": "out_file1", "uuid": "b5cf0dd9-bfe3-4021-99fe-12faf47d29e0" } ] } }, "uuid": "52976d74-fcd5-4e3c-a474-cd7aaf6e1047" }