Mercurial > repos > drosofff > msp_sr_readmap_and_size_histograms
diff readmap.xml @ 0:ac7d8e55bb67 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/msp_sr_readmap_and_size_histograms commit fe40dec87779c1fcfbd03330e653aa886f4a2cda
| author | drosofff |
|---|---|
| date | Wed, 21 Oct 2015 11:13:18 -0400 |
| parents | |
| children | e4874d1ae69d |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/readmap.xml Wed Oct 21 11:13:18 2015 -0400 @@ -0,0 +1,283 @@ +<tool id="Readmap" name="Generate readmap and histograms from alignment files" version="1.0.4"> + <description>from sRbowtie aligment</description> + <requirements> + <requirement type="package" version="0.12.7">bowtie</requirement> + <requirement type="package" version="0.7.7">pysam</requirement> + <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="2.14">biocbasics</requirement> + <requirement type="package" version="1.9">numpy</requirement> + </requirements> +<command interpreter="python"> + readmap.py + #if $refGenomeSource.genomeSource == "history": + --reference_fasta ## sys.argv[2] + $refGenomeSource.ownFile ## index source + #else: + #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] + --reference_bowtie_index + $reference + #end if + --rcode + $plotCode + --output_readmap + $readmap_dataframe + --output_size_distribution + $size_distribution_dataframe + --minquery + $minquery + --maxquery + $maxquery + --input + #for $i in $refGenomeSource.series + $i.input + #end for + --ext + #for $i in $refGenomeSource.series + $i.input.ext + #end for + --label + #for $i in $refGenomeSource.series + "$i.input.name" + #end for + --normalization_factor + #for $i in $refGenomeSource.series + $i.norm + #end for + #if $gff: + --gff + $gff + #end if + +</command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"> + <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> + </param> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" label="Select a fasta file, that served as the reference index for the alignments" /> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"/> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + </conditional> + <param name="gff" type="data" format="gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> + <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> + <param name="minquery" type="integer" size="3" value="18" label="Min size of query small RNAs" help="'18' = 18 nucleotides"/> + <param name="maxquery" type="integer" size="3" value="28" label="Max size of query small RNAs" help="'28' = 28 nucleotides"/> + <param name="title" type="text" size="15" value= "Readmaps and size distributions" label="Main Titles"/> + <param name="xlabel" type="text" size="15" value="Coordinates/read size" label="x axis label"/> + <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> + <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> + <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> + </param> + </inputs> + <configfiles> + <configfile name="plotCode"> + ## Setup R error handling to go to stderr + options( show.error.messages=F, + error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) + library(RColorBrewer) + library(lattice) + library(latticeExtra) + library(grid) + library(gridExtra) + + ## data frames implementation + + rm=read.delim("${readmap_dataframe}", header=T, row.names=NULL) + n_samples=length(unique(rm\$sample)) + genes=unique(levels(rm\$gene)) + per_gene_readmap=lapply(genes, function(x) subset(rm, gene==x)) ####### ? + n_genes=length(per_gene_readmap) + + size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) + per_gene_size=lapply(genes, function(x) subset(size, gene==x)) ###### ? + + ## end of data frames implementation + + ## functions + + plot_readmap=function(df, ...) { + combineLimits(xyplot(count~coord|factor(sample, levels=unique(sample))+reorder(gene, count, function(x) -sum(abs(x))), + data=df, + type='h', + scales= list(relation="free", x=list(rot=0, cex=0.7, axs="i", tck=0.5), y=list(tick.number=4, rot=90, cex=0.7)), + xlab=NULL, main=NULL, ylab=NULL, + as.table=T, + origin = 0, + horizontal=FALSE, + group=polarity, + col=c("red","blue"), + par.strip.text = list(cex=0.7), + ...)) + } + + plot_size_distribution= function(df, ...) { + smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} + bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, + horizontal=FALSE, + group=polarity, + stack=TRUE, + col=c('red', 'blue'), + cex=0.75, + scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.7), x=list(cex=0.7) ), + prepanel=smR.prepanel, + xlab = NULL, + ylab = NULL, + main = NULL, + as.table=TRUE, + newpage = T, + par.strip.text = list(cex=0.7), + ...) + combineLimits(bc) + } + + ## end of functions + + ## function parameters' + + par.settings.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) ) + par.settings.size=list(layout.heights=list(top.padding=-1, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) ) + par.settings.combination.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-3), strip.background=list(col=c("lightblue","lightgreen")) ) + par.settings.combination.size=list(layout.heights=list(top.padding=-2, bottom.padding=-0.5), strip.background=list(col=c("lightblue", "lightgreen")) ) + + ## end of function parameters' + + ## GRAPHS + + if (n_genes > 7) {page_height_simple = 11.69; page_height_combi=11.69; rows_per_page=${rows_per_page}; extrarow=0 } else { + rows_per_page= n_genes; page_height_simple = 11.69/n_genes/4; page_height_combi=11.69/(n_genes*2); extrarow=1 } + if (n_samples > 4) {page_width = 8.2677*n_samples/4} else {page_width = 8.2677*n_samples/3} # to test + + pdf(file="${readmap_PDF}", paper="special", height=page_height_simple, width=page_width) + for (i in seq(1,n_genes,rows_per_page)) { + start=i + end=i+rows_per_page-1 + if (end>n_genes) {end=n_genes} + readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.readmap)) + args.list=c(readmap_plot.list, list(nrow=rows_per_page, ncol=1, + main=textGrob("Read Maps (nucleotide coordinates)", gp=gpar(cex=1), just="top"), + left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90) + #sub=textGrob("readmap coordinates", gp=gpar(cex=.75), just="bottom") + ) + ) + do.call(grid.arrange, args.list) + } + devname=dev.off() + + + pdf(file="${size_PDF}", paper="special", height=page_height_simple, width=page_width) + for (i in seq(1,n_genes,rows_per_page)) { + start=i + end=i+rows_per_page-1 + if (end>n_genes) {end=n_genes} + plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, par.settings=par.settings.size) ) + args.list=c(plot.list, list(nrow=rows_per_page, ncol=1, + main=textGrob("Size distributions (in nucleotides)", gp=gpar(cex=1), just="top"), + left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90) + #sub="readsize in nucleotides" + ) + ) + do.call(grid.arrange, args.list) + } + devname=dev.off() + + pdf(file="${combi_PDF}", paper="special", height=page_height_combi, width=page_width) + for (i in seq(1,n_genes,rows_per_page/2)) { + start=i + end=i+rows_per_page/2-1 + if (end>n_genes) {end=n_genes} + read_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.combination.readmap)) + size_plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, strip=FALSE, par.settings=par.settings.combination.size)) + plot.list=rbind(read_plot.list, size_plot.list ) + args.list=c(plot.list, list(nrow=rows_per_page + extrarow, ncol=1, + main=textGrob("${title}", gp=gpar(cex=1), just="top"), + left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90), + sub=textGrob("${xlabel}", gp=gpar(cex=1), just="bottom") + ) + ) + do.call(grid.arrange, args.list) + } + devname=dev.off() + + + </configfile> + </configfiles> + + <outputs> + <data format="tabular" name="readmap_dataframe" label="Readmap dataframe"/> + <data format="tabular" name="size_distribution_dataframe" label="Size distribution dataframe"/> + <data format="pdf" name="readmap_PDF" label="Readmaps"/> + <data format="pdf" name="size_PDF" label="Size distribution"/> + <data format="pdf" name="combi_PDF" label="Size distribution and Readmaps"/> + </outputs> +<help> + +**What it does** + +Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a "Readmap", +where by default for each "chromosome" the position of the read is recorded on the x-axis, and the y-axis indicates +the number of reads per position. Reads that map in sense are on the top, reads that map antisense are on the bottom. + + +.. class:: warningmark + +'''TIP''' The input data can be produced using the sRbowtie tool. + +---- + +'''Example''' + +Query sequence:: +For a SAM file as the following: + + 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 + + 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 + + 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 + +produce a plot like this: + +---- + +.. image:: static/images/readmap.png + :height: 800 + :width: 500 + +</help> + <tests> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value ="transposons.fasta" ftype="fasta" /> + <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> + <param name="series_0|norm" value="1" /> + <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> + <param name="series_1|norm" value="1" /> + <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> + <param name="series_2|norm" value="1" /> + <param name="minquery" value="20" /> + <param name="maxquery" value="30" /> + <param name="title" value="Readmaps and size distributions" /> + <param name="xlabel" value="Coordinates/read size" /> + <param name="ylabel" value="Number of reads" /> + <param name="rows_per_page" value="8" /> + <output name="readmap_dataframe" ftype="tabular" file="Readmap_dataframe.tab" /> + <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> + <output name="readmap_PDF" ftype="pdf" file="Readmaps.pdf" /> + <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> + <output name="combi_PDF" ftype="pdf" file="Size_distribution_and_Readmaps.pdf" /> + </test> + </tests> +</tool>