Mercurial > repos > drosofff > msp_sr_size_histograms
diff size_histogram.xml @ 0:ef64759eb181 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/msp_sr_size_histograms commit fe40dec87779c1fcfbd03330e653aa886f4a2cda
| author | drosofff |
|---|---|
| date | Wed, 21 Oct 2015 11:38:40 -0400 |
| parents | |
| children | 00852209fd9f |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/size_histogram.xml Wed Oct 21 11:38:40 2015 -0400 @@ -0,0 +1,240 @@ +<tool id="Size_histogram" name="Generate size histograms from alignment files" version="0.9.7"> + <description>from sRbowtie aligment</description> + <requirements> + <requirement type="package" version="0.12.7">bowtie</requirement> + <requirement type="package" version="0.7.7">pysam</requirement> + <requirement type="package" version="3.1.2">R</requirements> + <requirement type="package" version="2.14">biocbasics</requirement> + <requirement type="package" version="1.9">numpy</requirement> + </requirements> +<command interpreter="python"> + size_histogram.py + #if $refGenomeSource.genomeSource == "history": + --reference_fasta ## sys.argv[2] + $refGenomeSource.ownFile ## index source + #else: + #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] + --reference_bowtie_index + $reference + #end if + --rcode + $plotCode + --output_size_distribution + $size_distribution_dataframe + --minquery + $minquery + --maxquery + $maxquery + --input + #for $i in $refGenomeSource.series + $i.input + #end for + --ext + #for $i in $refGenomeSource.series + $i.input.ext + #end for + --label + #for $i in $refGenomeSource.series + "$i.input.name" + #end for + --normalization_factor + #for $i in $refGenomeSource.series + $i.norm + #end for + #if $gff: + --gff + $gff + #end if + #if $global.value == 'yes': + --global_size + #end if + #if $collapsestrands.value == 'yes': + --collapse + #end if + +</command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"> + <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> + </param> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" /> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"/> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + </conditional> + <param name="gff" type="data" format="gff,gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> + <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> + <param name="global" type="select" label="Generate size distribution for each item, or generate a global alignment"> + <option value="no">for each item</option> + <option value="yes">global</option> + </param> + <param name="collapsestrands" type="select" label="Whether + and - reads should be collapsed or not"> + <option value="no">Do not collapse</option> + <option value="yes">Collapse + and - reads</option> + </param> + <param name="minquery" type="integer" size="3" value="18" label="Min size of reads to plot" help="'15' = 15 nucleotides"/> + <param name="maxquery" type="integer" size="3" value="28" label="Max size of reads to plot" help="'30' = 30 nucleotides"/> + <param name="title" type="text" size="15" value="Size distribution" label="Main Titles"/> + <param name="xlabel" type="text" size="15" value="Size in nucleotides" label="x axis label"/> + <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> + <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> + <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> + </param> + </inputs> + <configfiles> + <configfile name="plotCode"> + ## Setup R error handling to go to stderr + options( show.error.messages=F, + error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) + library(RColorBrewer) + library(lattice) + library(latticeExtra) + library(grid) + library(gridExtra) + + ##cheetahtemplate data frame implementation + size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) + n_samples = length(unique (size\$sample)) + n_genes = length (unique (levels(size\$gene))) + + par.settings.size=list(layout.heights=list(top.padding=1, bottom.padding=1), + strip.background = list(col = c("lightblue", "lightgreen")) + ) + + smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} # use if one want y axis in the middle of the plot + + plot_size_distribution= function(df, ...) { + bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, + horizontal=FALSE, + group=polarity, + stack=TRUE, + col=c('red', 'blue'), + cex=0.75, + scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.5, alternating=T), x=list(cex=.6 ) ), + xlab = "readsize in nucleotides", + ylab = "${ylabel}", + main="${title}" , + par.strip.text = list(cex=0.75), + as.table=TRUE, + newpage = T, + ...) + + combineLimits(update(useOuterStrips(bc, + strip.left = strip.custom(par.strip.text = list(cex=0.5)) + ), + layout=c(n_samples,${rows_per_page})), + margin.x=F, margin.y=1) + } + + # per_gene_size=lapply(genes, function(x) subset(size, gene==x)) # no object in this script + + global = "no" + #if $global.value == 'yes': + global = "yes" + #end if + + if (global=="no") { + + options(warn=-1) + pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677*n_samples/4) + plot_size_distribution(size, par.settings=par.settings.size) # removed , prepanel=smR.prepanel + + } else { + + pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677) + bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample)), data = size, origin = 0, + horizontal=FALSE, + group=polarity, + stack=TRUE, + col=c('red', 'blue'), +# par.settings=list(fontsize = list(text=8, points=8)), + scales=list(y=list(tick.number=4, rot=90, relation="same"), cex=1), + xlab = "readsize in nucleotides", + ylab = "${ylabel}", + main="${title}" , as.table=TRUE, newpage = T, + aspect=0.5, + strip = strip.custom(par.strip.text = list(cex = 1), which.given=1, bg="lightblue") + ) + bc + } + devname=dev.off() + + </configfile> + </configfiles> + + <outputs> + <data format="tabular" name="size_distribution_dataframe" label="Size_distribution_dataframe.tab"/> + <data format="pdf" name="size_PDF" label="Size_distribution.pdf"/> + </outputs> +<help> + +**What it does** + +Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a histogram of read sizes, +where by default for each "chromosome" a histogram of read sizes is drawn. +Reads that map in sense are on the top (red), reads that map antisense are on the bottom (blue). + + +.. class:: warningmark + +'''TIP''' The input data can be produced using the sRbowtie tool. + +---- + +'''Example''' + +Query sequence:: +For a SAM file as the following: + + 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 + + 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 + + 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 + +produce a plot like this: + +---- + +.. image:: static/images/size_histogram.png + :height: 800 + :width: 500 + +</help> + <tests> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="transposons.fasta" ftype="fasta" /> + <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> + <param name="series_0|norm" value="1" /> + <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> + <param name="series_1|norm" value="1" /> + <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> + <param name="series_2|norm" value="1" /> + <param name="global" value="no" /> + <param name="collapsestrands" value="no" /> + <param name="minquery" value="18"/> + <param name="maxquery" value="30"/> + <param name="title" value="Size distribution"/> + <param name="xlabel" value="Size in nucleotides"/> + <param name="ylabel" value="Number of reads"/> + <param name="rows_per_page" value="10"/> + <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> + <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> + </test> + </tests> +</tool> +