diff yac.xml @ 0:307cd074fa95 draft

planemo upload for repository https://bitbucket.org/drosofff/gedtools/

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/yac.xml	Wed May 27 17:40:52 2015 -0400
@@ -0,0 +1,79 @@
+<tool id="yac" name="Clip adapter" version="1.3.3">
+    <description />
+    <command interpreter="python">yac.py --input $input
+                                       --output $output
+                                       --output_format "$out_format"
+                                       --adapter_to_clip $clip_source.clip_sequence
+                                       --min $min
+                                       --max $max
+                                       --Nmode $Nmode
+  </command>
+    <inputs>
+        <param format="fastq" label="Source file" name="input" type="data" />
+        <param label="min size" name="min" size="4" type="integer" value="15" />
+        <param label="max size" name="max" size="4" type="integer" value="36" />
+        <param label="Select output format" name="out_format" type="select">
+            <option selected="true" value="fasta">Fasta format</option>
+            <option value="fastq">Fastq format</option>
+        </param>
+        <param label="Accept reads containing N?" name="Nmode" type="select">
+            <option selected="True" value="accept">accept</option>
+            <option value="reject">reject</option>
+        </param>
+        <conditional name="clip_source">
+            <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select">
+                <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option>
+                <option value="user">Use custom sequence</option>
+            </param>
+            <when value="prebuilt">
+                <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select">
+                    <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
+                    <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
+                    <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq  TGGAATTCTCGGGTGCCAAG</option>
+                    <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
+                </param>
+            </when>
+            <when value="user">
+                <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="fasta" metadata="input" name="output" />
+        <change_format>
+            <when format="fastq" input="out_format" value="fastq" />
+        </change_format>
+    </outputs>
+    <tests>
+        <test>
+            <param ftype="fastqsanger" name="input" value="yac.fastq" />
+            <param name="min" value="18" />
+            <param name="max" value="29" />
+            <param name="clip_source_list" value="prebuilt" />
+            <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
+            <param name="Nmode" value="accept" />
+            <output file="yac.out" name="output" />
+        </test>
+        <test>
+            <param ftype="fastqsanger" name="input" value="yac.fastq" />
+            <param name="min" value="18" />
+            <param name="max" value="29" />
+            <param name="clip_source_list" value="prebuilt" />
+            <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
+            <param name="Nmode" value="accept" />
+            <param name="out_format" value="fastq" />
+            <output file="yac_fastq.out" name="output" />
+        </test>
+    </tests>
+    <help>
+This tool clips adapter sequences from a fastq file and outputs either a
+fasta or fastq file of clipped reads with renumbered fasta/fastq headers.
+
+By defualt clipped sequences with unknown nucleotides are kept, but 
+can be discarded by setting "Accept reads containing N?" to reject.
+
+Min size and max size filter clipped reads on their size.
+
+Note that unclipped reads that satisfy the min and max size conditions are kept.
+  </help>
+</tool>