comparison lucy/lucy.xml @ 0:38e2b656eb28 default tip

Migrated tool version 1.0.1 from old tool shed archive to new tool shed repository

0:38e2b656eb28

<tool id="lucy" name="LUCY trimmer" version='1.0.1' description="Less Useful Chunks Yank">
<command interpreter='perl'>psub -l galaxy_normal.c --fasta $fasta_infile --cat $fasta_outfile --cat $qual_outfile
lucy -quiet -xtra 8 
-error $max_avg_error $max_error_at_ends
-bracket $bracket_window_size $bracket_max_avg_error
#if $vector.vector_select == '1':
-vector $vector.vector_fasta_infile $vector.splice_fasta_infile
#end if
-output $fasta_outfile $qual_outfile
$fasta_infile $qual_infile
</command>

	<inputs>
		<param name="fasta_infile" type="data" format="fasta" label="Read sequences (Fasta)"/>
		<param name="qual_infile" type="data" format="qual454" label="Qual scores input file (qual454)"/>
        <param name="max_avg_error" type="text" value='.007' label="max average error"/>
        <param name="max_error_at_ends" type="text" value='.007' label="max error at ends"/>
        <param name="bracket_window_size" type="integer" value='20' label="bracket window size"/>
        <param name="bracket_max_avg_error" type="text" value='.007' label="bracket max average error"/>

        <conditional name='vector'>
            <param name="vector_select" type="select" label="Do you have vector sequence files?" >
                <option value="0">no, just trim by quality alone</option>
                <option value="1">yes</option>
            </param>
            <when value='1'>
                <param name="vector_fasta_infile" type="data" format="fasta" label="Complete cloning vector sequence (Fasta)"/>
                <param name="splice_fasta_infile" type="data" format="fasta" label="Subsequence before and after each insert site (Fasta)"/>
            </when>
            <when value='0'>
            </when>
        </conditional>
	</inputs>
	<outputs>
		<data name="fasta_outfile" format="fasta"/>
		<data name="qual_outfile" format="qual454"/>
	</outputs>
	<help>
Less Useful Chunks Yank (lucy) is a utility that prepares raw DNA sequence fragments for sequence assembly.
It performs quality end-trimming and optionally removal of primer/vector sequences or filtering contamination.

---	

Each sequence in the output sequence file begins with a header that includes its name, three pass along 
clone length values to the fragment assembly program, and a left and right marker denoting the begin and
end of the good quality, vector free region. The following is an example of lucy output::

	&gt;GCCAA03TF 1500 3000 2000 43 490 
	AGCCAAGTTTGCAGCCCTGCAGGTCGACTCTAGAGGATCCCCAGGATGATCAGCCACATT 
	GGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATCTTGCGCAATGG 
	GCGAAAGCCTGACGCAGCCATGCCGCGTGAATGATGAAGGTCTTAGGATTGTAAAATTCT 
	TTCACCGGGGACGATAATGACGGTACCCGGAGAAGAAGCCCCGGCTAACTTCGTGCCAGC
	...

---

**Manual**

http://galaxy.jgi-psf.org/static/manuals/lucy.pdf

	</help>
</tool>