Mercurial > repos > edward-kirton > lucy
changeset 0:38e2b656eb28 default tip
Migrated tool version 1.0.1 from old tool shed archive to new tool shed repository
| author | edward-kirton |
|---|---|
| date | Tue, 07 Jun 2011 17:27:29 -0400 |
| parents | |
| children | |
| files | lucy/lucy.xml lucy/lucy_wrapper.sh |
| diffstat | 2 files changed, 64 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lucy/lucy.xml Tue Jun 07 17:27:29 2011 -0400 @@ -0,0 +1,62 @@ +<tool id="lucy" name="LUCY trimmer" version='1.0.1' description="Less Useful Chunks Yank"> +<command interpreter='perl'>psub -l galaxy_normal.c --fasta $fasta_infile --cat $fasta_outfile --cat $qual_outfile +lucy -quiet -xtra 8 +-error $max_avg_error $max_error_at_ends +-bracket $bracket_window_size $bracket_max_avg_error +#if $vector.vector_select == '1': +-vector $vector.vector_fasta_infile $vector.splice_fasta_infile +#end if +-output $fasta_outfile $qual_outfile +$fasta_infile $qual_infile +</command> + + <inputs> + <param name="fasta_infile" type="data" format="fasta" label="Read sequences (Fasta)"/> + <param name="qual_infile" type="data" format="qual454" label="Qual scores input file (qual454)"/> + <param name="max_avg_error" type="text" value='.007' label="max average error"/> + <param name="max_error_at_ends" type="text" value='.007' label="max error at ends"/> + <param name="bracket_window_size" type="integer" value='20' label="bracket window size"/> + <param name="bracket_max_avg_error" type="text" value='.007' label="bracket max average error"/> + + <conditional name='vector'> + <param name="vector_select" type="select" label="Do you have vector sequence files?" > + <option value="0">no, just trim by quality alone</option> + <option value="1">yes</option> + </param> + <when value='1'> + <param name="vector_fasta_infile" type="data" format="fasta" label="Complete cloning vector sequence (Fasta)"/> + <param name="splice_fasta_infile" type="data" format="fasta" label="Subsequence before and after each insert site (Fasta)"/> + </when> + <when value='0'> + </when> + </conditional> + </inputs> + <outputs> + <data name="fasta_outfile" format="fasta"/> + <data name="qual_outfile" format="qual454"/> + </outputs> + <help> +Less Useful Chunks Yank (lucy) is a utility that prepares raw DNA sequence fragments for sequence assembly. +It performs quality end-trimming and optionally removal of primer/vector sequences or filtering contamination. + +--- + +Each sequence in the output sequence file begins with a header that includes its name, three pass along +clone length values to the fragment assembly program, and a left and right marker denoting the begin and +end of the good quality, vector free region. The following is an example of lucy output:: + + >GCCAA03TF 1500 3000 2000 43 490 + AGCCAAGTTTGCAGCCCTGCAGGTCGACTCTAGAGGATCCCCAGGATGATCAGCCACATT + GGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATCTTGCGCAATGG + GCGAAAGCCTGACGCAGCCATGCCGCGTGAATGATGAAGGTCTTAGGATTGTAAAATTCT + TTCACCGGGGACGATAATGACGGTACCCGGAGAAGAAGCCCCGGCTAACTTCGTGCCAGC + ... + +--- + +**Manual** + +http://galaxy.jgi-psf.org/static/manuals/lucy.pdf + + </help> +</tool>