comparison query.xml @ 12:039e8e1e8b1f draft

Uploaded 20180201

11:0d0f7080b55c

            <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input">
                <option value="0" selected="true">By file</option>
                <option value="1">By manually inserted text</option>
            </param>
            <when value="0">
                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
            <when value="1">
                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
        </conditional>            
        <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
    </inputs>
    <outputs>
        <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="tabular" />
        </collection>
    </outputs>

    <help><![CDATA[
The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available 
sequenced samples which express a transcript of interest.

----

**Example**

The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
in a tab delimited format::
    
    id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
    id1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
    ...

12:039e8e1e8b1f

            <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input">
                <option value="0" selected="true">By file</option>
                <option value="1">By manually inserted text</option>
            </param>
            <when value="0">
                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
            <when value="1">
                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
        </conditional>            
        <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
    </inputs>
    <outputs>
        <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="auto" />
        </collection>
    </outputs>

    <help><![CDATA[
The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available 
sequenced samples which express a transcript of interest.

----

The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line,
in a tab delimited format::
    
    id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
    id1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
    ...