diff query.xml @ 10:027f2e9d4a25 draft

Uploaded 20180131

--- a/query.xml	Wed Jan 31 16:05:25 2018 -0500
+++ b/query.xml	Wed Jan 31 17:29:01 2018 -0500
@@ -34,10 +34,10 @@
                 <option value="1">By manually inserted text</option>
             </param>
             <when value="0">
-                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." />
+                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
             <when value="1">
-                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." />
+                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
         </conditional>            
         <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
@@ -59,10 +59,13 @@
 The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
 in a tab delimited format::
     
-    seq_id_0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
-    seq_id_1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
+    id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
+    id1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
     ...
-    seq_id_n  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
+    idn  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
+
+The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
+Any additional characters will be trimmed out.
 
 The output of the tool is a collection that contains a file for each ID with a list of
 accession numbers representing the samples that express one particular transcript.