view query.xml @ 9:f9ba0b65e1fa draft

Deleted selected files
author fabio
date Wed, 31 Jan 2018 16:05:25 -0500
parents 35593423c2e2
children 027f2e9d4a25
line wrap: on
line source

<?xml version="1.0"?>
<tool name="Query" id="sbtas_se_query" version="1.0.0">
    <description>the AllSome Sequence Bloom Tree</description>
    <requirements>
        <requirement type="package" version="2.7.10">python</requirement>
        <requirement type="package" version="2.18.4">requests</requirement>
    </requirements>
    <command detect_errors="exit_code">
<![CDATA[
    python '$__tool_directory__/query.py'
    
    --search 'rrr'
    --sthreshold ${sthreshold}
    --exact 0
    
    #if $conditional_input.inputtype == '0':
        #set file_paths = ','.join( [ str( $f ) for $f in $conditional_input.txtfiles ] )
        #if $file_paths is not 'None':
            --files '${file_paths}'
            #set file_names = ','.join( [ str( $f.name ) for $f in $conditional_input.txtfiles ] )
                --names '${file_names}'
        #end if
    #elif $conditional_input.inputtype == '1':
        --sequences '${conditional_input.sequences}'
    #end if

    --outputdir 'collection_content'
]]>
    </command>
    <inputs>
        <conditional name="conditional_input">
            <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input">
                <option value="0" selected="true">By file</option>
                <option value="1">By manually inserted text</option>
            </param>
            <when value="0">
                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
            <when value="1">
                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." />
            </when>
        </conditional>            
        <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
    </inputs>
    <outputs>
        <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="tabular" />
        </collection>
    </outputs>

    <help><![CDATA[
The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available 
sequenced samples which express a transcript of interest.

----

**Example**

The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
in a tab delimited format::
    
    seq_id_0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
    seq_id_1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
    ...
    seq_id_n  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC

The output of the tool is a collection that contains a file for each ID with a list of
accession numbers representing the samples that express one particular transcript.

----

.. class:: infomark

**Notes**

This Galaxy tool has been developed by Fabio Cumbo.

Please visit this GithHub_repository_ for more information about the AllSome Sequence Bloom Tree Search Engine

.. _GithHub_repository: https://github.com/fabio-cumbo/bloomtree-allsome-search-engine
    ]]></help>

    <citations>
        <citation type="doi">10.1101/090464</citation>
    </citations>
</tool>