# HG changeset patch # User fubar # Date 1712729319 0 # Node ID 0fae1d68347fab16c0c3200f0b508f2e7659e5fb # Parent 3b2ff98649957cb9c0a6528ec04035e3b407882f planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/jbrowse2 commit f09abc1f5ef8d261dff2d1b0063fff99a1b25f93 diff -r 3b2ff9864995 -r 0fae1d68347f jbrowse2.xml --- a/jbrowse2.xml Tue Apr 09 00:26:49 2024 +0000 +++ b/jbrowse2.xml Wed Apr 10 06:08:39 2024 +0000 @@ -361,7 +361,8 @@ name="category" type="text" value="Default" - help="Organise your tracks into Categories for a nicer end-user experience. You can use #date# and it will be replaced with the current date in 'yyyy-mm-dd' format, which is very useful for repeatedly updating a JBrowse instance when member databases / underlying tool versions are updated." optional="False"/> + help="Organise your tracks into Categories for a nicer end-user experience. You can use #date# and it will be replaced with the current date in 'yyyy-mm-dd' format, + which is very useful for repeatedly updating a JBrowse instance when member databases / underlying tool versions are updated." optional="False"/> @@ -381,7 +382,9 @@ @@ -480,6 +484,191 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ @@ -834,7 +1023,6 @@ - @@ -898,6 +1086,18 @@ Annotation Tracks ----------------- +MAF +~~~ + +For history references, the name of the reference genome dataset in your history is very important for MAF tracks, +because it becomes the "dbkey" for that reference. So, it must be exactly the same as the genome name (dbkey) used +when making the MAF, typically in the Lastz tool. + +If you used "hg38" as the reference in Lastz, that is exactly what the reference fasta should be named for any MAF track. +Change it using the "pencil" icon on the reference data in your history. Any other name, such as "hg38.fasta" +will cause the MAF track to show no data since there are no matches with that reference dbkey. + + GFF3/BED ~~~~~~~~ diff -r 3b2ff9864995 -r 0fae1d68347f test-data/jbrowse2_result02.zip Binary file test-data/jbrowse2_result02.zip has changed diff -r 3b2ff9864995 -r 0fae1d68347f test-data/merlin_tab.maf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/merlin_tab.maf Wed Apr 10 06:08:39 2024 +0000 @@ -0,0 +1,37 @@ +##maf version=1 scoring=lastz.v1.04.22 +# lastz.v1.04.22 --strand=both --ambiguous=iupac --traceback=160M --format=maf --action:target=multiple +# +# hsp_threshold = 3000 +# gapped_threshold = 3000 +# x_drop = 910 +# y_drop = 9400 +# gap_open_penalty = 400 +# gap_extend_penalty = 30 +# A C G T +# A 91 -114 -31 -123 +# C -114 100 -125 -31 +# G -31 -125 100 -114 +# T -123 -31 -114 91 +a score=5703 +s Merlin.Merlin 1320 60 + 172788 ATGTAAGCTCAGGAGCTCCACACGCAACAGGAACACAACCTGTGAACATTATCACAGTAT +s Merlin1.Merlin 0 60 + 60 ATGTAAGCTCAGGAGCTCCACACGCAACAGGAACACAACCTGTGAACATTATCACAGTAT + +a score=5595 +s Merlin.Merlin 4020 60 + 172788 ATGAATTTATCAGTCCAATACTTAAAATGAATACGAAGTAAATCTATGCCTAATACTAAT +s Merlin2.Merlin 0 60 + 60 ATGAATTTATCAGTCCAATACTTAAAATGAATACGAAGTAAATCTATGCCTAATACTAAT + +a score=5667 +s Merlin.Merlin 5220 60 + 172788 TAATCAACGTGTGATGCTTCAAGCCAAGCTTAGGAATAGAAATGGTTTTGCCATTGACTT +s Merlin3.Merlin 0 60 + 60 TAATCAACGTGTGATGCTTCAAGCCAAGCTTAGGAATAGAAATGGTTTTGCCATTGACTT + +a score=5640 +s Merlin.Merlin 7740 60 + 172788 AAAAGCTTATTGCTTAAGCCTACAGTTAAACTCGCTATTCCAGTTAAATGCGATAAATGT +s Merlin4.Merlin 0 60 + 60 AAAAGCTTATTGCTTAAGCCTACAGTTAAACTCGCTATTCCAGTTAAATGCGATAAATGT + +a score=5649 +s Merlin.Merlin 9720 60 + 172788 TTTTCTTTGCTAATTTAACACCAAGAGCTGCAATCCATTGGTTTCTTCGTTTATATCCTG +s Merlin5.Merlin 0 60 + 60 TTTTCTTTGCTAATTTAACACCAAGAGCTGCAATCCATTGGTTTCTTCGTTTATATCCTG + +a score=5658 +s Merlin.Merlin 10380 60 + 172788 ATACTGCATCCTTTTGATACCAATGCGGTTCAATTTGAGTGTTACCAGAGTATATCTTGA +s Merlin6.Merlin 0 60 + 60 ATACTGCATCCTTTTGATACCAATGCGGTTCAATTTGAGTGTTACCAGAGTATATCTTGA