annotate regex.xml @ 5:503bcd6ebe4b draft default tip

planemo upload for repository https://github.com/galaxyproteomics/tools-galaxyp/tree/master/tools/regex_find_replace commit 3eaa2a2bdaeedf1b0771b1b764a550106dcbc186

<tool id="regex1" name="Regex Find And Replace" version="1.0.3" profile="21.01">
  <description></description>
  <requirements>
    <requirement type="package" version="3.7">python</requirement>
  </requirements>
  <command>
    python '$__tool_directory__/regex.py'
    --input '$input'
    --output '$out_file1'
    --input_display_name '$input.display_name'
    #for $check in $checks:
      --pattern='$check.pattern' --replacement='$check.replacement'
    #end for
  </command>
  <inputs>
    <param format="txt" name="input" type="data" label="Select lines from"/>
    <repeat name="checks" title="Check">
      <param name="pattern" type="text" value="chr([0-9A-Za-z]+)" label="Find Regex" help="here you can enter text or regular expression (for syntax check lower part of this frame)">
        <sanitizer>
          <valid>
            <add preset="string.printable"/>
            <remove value="&#92;" />
            <remove value="&apos;" />
          </valid>
          <mapping initial="none">
            <add source="&#92;" target="__backslash__" />
            <add source="&apos;" target="__sq__"/>
          </mapping>
        </sanitizer>
      </param>
      <param name="replacement" type="text" value="newchr\1" label="Replacement">
        <sanitizer>
          <valid>
            <add preset="string.printable"/>
            <remove value="&#92;" />
            <remove value="&apos;" />
          </valid>
          <mapping initial="none">
            <add source="&#92;" target="__backslash__" />
            <add source="&apos;" target="__sq__"/>
          </mapping>
        </sanitizer>      
      </param>
    </repeat>
  </inputs>
  <outputs>
    <data format_source="input" name="out_file1" metadata_source="input"/>
  </outputs>
  <tests>
    <test>
      <param name="input" value="find1.txt" ftype="txt"/>
      <param name="pattern" value="(T\w+)"/>
      <param name="replacement" value="\1 \1" />
      <output name="out_file1" file="replace1.txt" ftype="txt"/>
    </test>
    <test>
      <param name="input" value="find1.txt" ftype="txt"/>
      <param name="pattern" value="f"/>
      <param name="replacement" value="'&quot;" />
      <output name="out_file1" file="replace2.txt" ftype="txt"/>
    </test>
    <test>
      <param name="input" value="find1.txt" ftype="txt"/>
      <param name="checks_0|pattern" value="a test file"/>
      <param name="checks_0|replacement" value="a file named #{input_name}" />
      <param name="checks_1|pattern" value="see here"/>
      <param name="checks_1|replacement" value="see #{input_name}" />
      <param name="checks_2|pattern" value="see (find1).txt"/>
      <param name="checks_2|replacement" value="see \1" />
      <output name="out_file1" file="replace3.txt" ftype="txt"/>
    </test>
  </tests>
  <help>
This tool goes line by line through the specified input file and
replaces text which matches the specified regular expression patterns
with its corresponding specified replacement.

This tool uses Python regular expressions. More information about
Python regular expressions can be found here:
http://docs.python.org/library/re.html.

To convert an Ilumina FATSQ sequence id from the CAVASA 8 format::

 @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
 +EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC

To the CASAVA 7 format::

 @EAS139_FC706VJ:2:2104:15343:197393#0/1
 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
 +EAS139_FC706VJ:2:2104:15343:197393#0/1
 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC

Use Settings::

 Find Regex: ^([@+][A-Z0-9]+):\d+:(\S+)\s(\d).*$
 Replacement: \1_\2#0/\3

Note that the parentheses **()** capture patterns in the text that can be used in the replacement text by using a backslash-number reference:  **\\1**

The regex **^([@+][A-Z0-9]+):\d+:(\S+) (\d).*$** means::

  ^  - start the match at the beginning of the line of text
  (  - start a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1
  [@+]  - matches either a @ or + character
  [A-Z0-9]+  - matches an uppercase letter or a digit, the plus sign means to match 1 or more such characters
  )  - end a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1
  :\d+:   - matches a colon followed by one or more digits followed by a colon character
  (\S+)  - matches one or more non-whitespace charcters,  the enclosing parentheses make this a group (2) that can back-referenced in the replacement text as \2
  \s  - matches a whitespace character
  (\d)  - matches a single digit character,  the enclosing parentheses make this a group (3) that can back-referenced in the replacement text as \3
  .*  - dot means match any character, asterisk means zero more more matches
  $  - the regex must match to the end of the line of text

In the replacement pattern, use the special token #{input_name} to insert the input dataset's display name.
The name can be modified by a second find/replace check. Suppose you want to insert the sample id of your dataset,
named **Sample ABC123**, into the dataset itself, which currently contains the lines::

 Data 1
 Data 2
 Data 3

You can use the following checks::

 Find Regex: Data
 Replacement: #{input_name} Data

 Find Regex: Sample (\S+)
 Replacement: \1

The result will be::

 ABC123 Data 1
 ABC123 Data 2
 ABC123 Data 3



Galaxy aggressively escapes input supplied to tools, so if something
is not working please let us know and we can look into whether this is
the cause. Also if you would like help constructing regular
expressions for your inputs, please let us know at [e-mail].
</help>
</tool>