Mercurial > repos > gandres > readseq
comparison readseq.xml @ 3:b38275a23ce0 draft
planemo upload
author | gandres |
---|---|
date | Fri, 11 Dec 2015 09:23:33 -0500 |
parents | |
children | 1a40d002fdc4 |
comparison
equal
deleted
inserted
replaced
2:3fadcdc7b7a6 | 3:b38275a23ce0 |
---|---|
1 <tool id="sniplay_readseq" name="Readseq" version="1.0.2"> | |
2 | |
3 <!-- [REQUIRED] Tool description displayed after the tool name --> | |
4 <description> Convert various alignment formats </description> | |
5 | |
6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> | |
7 <requirements> | |
8 <requirement type="binary">perl</requirement> | |
9 <requirement type="package" version="10.03.13">readseq.jar</requirement> | |
10 </requirements> | |
11 | |
12 <!-- [STRONGLY RECOMMANDED] Exit code rules --> | |
13 <stdio> | |
14 <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR --> | |
15 <exit_code range="1:" level="fatal" /> | |
16 </stdio> | |
17 | |
18 <!-- [REQUIRED] The command to execute --> | |
19 <command> | |
20 echo \$JAVA_JAR_PATH && | |
21 java -jar \$JAVA_JAR_PATH/readseq.jar $filein -f $format >> $fileout_log 2>&1 && | |
22 #if str( $format ) == "1": | |
23 mv ${filein}.ig $fileout | |
24 #elif str( $format ) == "2" : | |
25 mv ${filein}.gb $fileout | |
26 #elif str( $format ) == "3" : | |
27 mv ${filein}.nbrf $fileout | |
28 #elif str( $format ) == "4" : | |
29 mv ${filein}.embl $fileout | |
30 #elif str( $format ) == "5" : | |
31 mv ${filein}.gcg $fileout | |
32 #elif str( $format ) == "6" : | |
33 mv ${filein}.strider $fileout | |
34 #elif str( $format ) == "8" : | |
35 mv ${filein}.fasta $fileout | |
36 #elif str( $format ) == "11" : | |
37 mv ${filein}.phylip2 $fileout | |
38 #elif str( $format ) == "12" : | |
39 mv ${filein}.phylip $fileout | |
40 #elif str( $format ) == "13" : | |
41 mv ${filein}.seq $fileout | |
42 #elif str( $format ) == "14" : | |
43 mv ${filein}.pir $fileout | |
44 #elif str( $format ) == "15" : | |
45 mv ${filein}.msf $fileout | |
46 #elif str( $format ) == "17" : | |
47 mv ${filein}.nexus $fileout | |
48 #elif str( $format ) == "18" : | |
49 mv ${filein}.pretty $fileout | |
50 #elif str( $format ) == "19" : | |
51 mv ${filein}.xml $fileout | |
52 #elif str( $format ) == "22" : | |
53 mv ${filein}.aln $fileout | |
54 #elif str( $format ) == "25" : | |
55 mv ${filein}.ace $fileout | |
56 #end if | |
57 </command> | |
58 | |
59 <!-- [REQUIRED] Input files and tool parameters --> | |
60 <inputs> | |
61 <param name="filein" type="data" format="fasta" optional="false" label="Fasta alignment input" /> | |
62 <param name="fileout_label" type="text" value="phylip conversion" label="Output name" help="Output name for files" /> | |
63 <param name="format" type="select" label="Output format" > | |
64 <option value="1">1.IG|Stanford</option> | |
65 <option value="2">2.GenBank|gb</option> | |
66 <option value="3">3.NBRF</option> | |
67 <option value="4">4.EMBL|em</option> | |
68 <option value="5">5.GCG</option> | |
69 <option value="6">6.DNAStrider</option> | |
70 <option value="8">8.Pearson|Fasta|fa</option> | |
71 <option value="11">11.Phylip3.2</option> | |
72 <option value="12" selected="true">12.Phylip|Phylip4</option> | |
73 <option value="13">13.Plain|Raw</option> | |
74 <option value="14">14.PIR|CODATA</option> | |
75 <option value="15">15.MSF</option> | |
76 <option value="17">17.PAUP|NEXUS</option> | |
77 <option value="18">18.Pretty</option> | |
78 <option value="19">19.XML</option> | |
79 <option value="22">22.Clustal</option> | |
80 <option value="25">25.ACEDB</option> | |
81 </param> | |
82 </inputs> | |
83 | |
84 <!-- [REQUIRED] Output files --> | |
85 <outputs> | |
86 <data name="fileout_log" type="data" format="txt" label="${fileout_label}.log" /> | |
87 <data name="fileout" type="data" format="txt" label="${fileout_label}" /> | |
88 </outputs> | |
89 | |
90 <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin --> | |
91 <tests> | |
92 <!-- [HELP] Test files have to be in the ~/test-data directory --> | |
93 <test> | |
94 <param name="filein" value="readseq-alignment.fa" /> | |
95 <param name="format" value="1" /> | |
96 <output name="fileout" file="readseq-standford" /> | |
97 </test> | |
98 <test> | |
99 <param name="filein" value="readseq-alignment.fa" /> | |
100 <param name="format" value="2" /> | |
101 <output name="fileout" file="readseq-GenBank" /> | |
102 </test> | |
103 <test> | |
104 <param name="filein" value="readseq-alignment.fa" /> | |
105 <param name="format" value="3" /> | |
106 <output name="fileout" file="readseq-NBRF" /> | |
107 </test> | |
108 <test> | |
109 <param name="filein" value="readseq-alignment.fa" /> | |
110 <param name="format" value="4" /> | |
111 <output name="fileout" file="readseq-EMBL" /> | |
112 </test> | |
113 <test> | |
114 <param name="filein" value="readseq-alignment.fa" /> | |
115 <param name="format" value="5" /> | |
116 <assert_command> | |
117 <has_text text="-f 5" /> | |
118 <has_text text=".gcg" /> | |
119 </assert_command> | |
120 </test> | |
121 <test> | |
122 <param name="filein" value="readseq-alignment.fa" /> | |
123 <param name="format" value="6" /> | |
124 <output name="fileout" file="readseq-DNAStrider" /> | |
125 </test> | |
126 <test> | |
127 <param name="filein" value="readseq-alignment.fa" /> | |
128 <param name="format" value="8" /> | |
129 <output name="fileout" file="readseq-Pearson" /> | |
130 </test> | |
131 <test> | |
132 <param name="filein" value="readseq-alignment.fa" /> | |
133 <param name="format" value="11" /> | |
134 <output name="fileout" file="readseq-phylip32" /> | |
135 </test> | |
136 <test> | |
137 <param name="filein" value="readseq-alignment.fa" /> | |
138 <param name="format" value="12" /> | |
139 <output name="fileout" file="readseq-phylip" /> | |
140 </test> | |
141 <test> | |
142 <param name="filein" value="readseq-alignment.fa" /> | |
143 <param name="format" value="13" /> | |
144 <output name="fileout" file="readseq-raw" /> | |
145 </test> | |
146 <test> | |
147 <param name="filein" value="readseq-alignment.fa" /> | |
148 <param name="format" value="14" /> | |
149 <output name="fileout" file="readseq-PIR" /> | |
150 </test> | |
151 <test> | |
152 <param name="filein" value="readseq-alignment.fa" /> | |
153 <param name="format" value="15" /> | |
154 <output name="fileout" file="readseq-MSF.txt" lines_diff="2" /> | |
155 </test> | |
156 <test> | |
157 <param name="filein" value="readseq-alignment.fa" /> | |
158 <param name="format" value="17" /> | |
159 <output name="fileout" file="readseq-NEXUS" /> | |
160 </test> | |
161 <test> | |
162 <param name="filein" value="readseq-alignment.fa" /> | |
163 <param name="format" value="18" /> | |
164 <output name="fileout" file="readseq-Pretty" /> | |
165 </test> | |
166 <test> | |
167 <param name="filein" value="readseq-alignment.fa" /> | |
168 <param name="format" value="19" /> | |
169 <output name="fileout" file="readseq-XML" /> | |
170 </test> | |
171 <test> | |
172 <param name="filein" value="readseq-alignment.fa" /> | |
173 <param name="format" value="22" /> | |
174 <output name="fileout" file="readseq-Clustal" /> | |
175 </test> | |
176 <test> | |
177 <param name="filein" value="readseq-alignment.fa" /> | |
178 <param name="format" value="25" /> | |
179 <output name="fileout" file="readseq-ACEDB" /> | |
180 </test> | |
181 | |
182 </tests> | |
183 | |
184 <!-- [OPTIONAL] Help displayed in Galaxy --> | |
185 <help> | |
186 | |
187 .. class:: infomark | |
188 | |
189 **Authors** Don Gilbert software@bio.indiana.edu | |
190 | |
191 | **Please cite** If you use this tool, please cite Don Gilbert software@bio.indiana.edu | |
192 | |
193 | |
194 .. class:: infomark | |
195 | |
196 **Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. | |
197 | |
198 .. class:: infomark | |
199 | |
200 **Support** For any questions about Galaxy integration, please send an e-mail to support.abims@sb-roscoff.fr | |
201 | |
202 --------------------------------------------------- | |
203 | |
204 | |
205 ======= | |
206 Readseq | |
207 ======= | |
208 | |
209 ----------- | |
210 Description | |
211 ----------- | |
212 | |
213 Compute a phylip tree from a fasta alignment. | |
214 | |
215 | |
216 ----------------- | |
217 Workflow position | |
218 ----------------- | |
219 | |
220 **Upstream tools** | |
221 | |
222 =========== ========================== ======= | |
223 Name output file(s) format | |
224 =========== ========================== ======= | |
225 =========== ========================== ======= | |
226 | |
227 | |
228 **Downstream tools** | |
229 | |
230 =========== ========================== ======= | |
231 Name output file(s) format | |
232 =========== ========================== ======= | |
233 fastme Newick tree Newick | |
234 Rooting out tree Newick | |
235 =========== ========================== ======= | |
236 | |
237 | |
238 ---------- | |
239 Input file | |
240 ---------- | |
241 | |
242 Fasta file | |
243 The input data file contains sequence alignment(s) | |
244 | |
245 | |
246 ---------- | |
247 Parameters | |
248 ---------- | |
249 | |
250 Output name | |
251 Output base name for the ouput files | |
252 | |
253 | |
254 ------------ | |
255 Output files | |
256 ------------ | |
257 | |
258 Output_name | |
259 Resulting tree in phylip format | |
260 | |
261 Output_name.log | |
262 Log file | |
263 | |
264 ------------ | |
265 Dependencies | |
266 ------------ | |
267 ReadSeq | |
268 readseq.jar at 10.03.13 version | |
269 | |
270 --------------------------------------------------- | |
271 | |
272 --------------- | |
273 Working example | |
274 --------------- | |
275 | |
276 Input files | |
277 =========== | |
278 | |
279 Fasta file | |
280 ----------- | |
281 | |
282 :: | |
283 | |
284 >IRAT112 GAGAACCGTCCTGTAAGTACTCTTGCTTTAAGTAATAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATTATCATTATGAATCAATAAACAACTTGATGTTGTGCTCCATGTACGATATATAAAGACAGATA | |
285 >KARASUKARASURANKASU GAGAACCGTCCTGTAAGTACTCTTGCTTTAAATACGAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATGTTCATCATGAATCTATAGTTAACTTGATGTTGTGCTCCATGTACGATATAAAAAGTTAGATA | |
286 | |
287 | |
288 Parameters | |
289 ========== | |
290 | |
291 Output name -> phylip conversion | |
292 | |
293 | |
294 Output files | |
295 ============ | |
296 | |
297 phylip conversion | |
298 ----------------- | |
299 | |
300 :: | |
301 | |
302 168 5125 | |
303 IRAT112 GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AGTAATAAAG TAATACTAAT | |
304 KARASUKARA GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AATACGAAAG TAATACTAAT | |
305 | |
306 </help> | |
307 | |
308 </tool> |