Mercurial > repos > gga > repeatexplorer_clusterin
view repex_full_clustering.xml @ 0:9b172a5ee4e0 draft default tip
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/repeatexplorer2 commit 5da32fef683efadd7d8046409cdeb12cc1fd2d5d
author | gga |
---|---|
date | Thu, 02 Nov 2023 15:44:51 +0000 |
parents | |
children |
line wrap: on
line source
<tool id="repeatexplorer_clusterin" name="RepeatExplorer (clustering)" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>repeat discovery and characterization using graph-based sequence clustering</description> <macros> <import>macros.xml</import> </macros> <expand macro="creator"/> <expand macro="requirements"/> <command><![CDATA[ export GALAXY_MEMORY_KB=\$((\${GALAXY_MEMORY_MB:-8192}*1024)) && export PYTHONHASHSEED=0 && ## output will go here mkdir -p '${reportfile.extra_files_path}' && /repex_tarean/seqclust --cpu \${GALAXY_SLOTS:-1} --max_memory \${GALAXY_MEMORY_KB} '${paired}' #if $sample: --sample '${sample}' #end if --taxon '${taxon}' --output_dir='${reportfile.extra_files_path}' #if $advanced.mincl: --mincl '${advanced.mincl}' #end if --assembly_min '${advanced.assembly_min}' #if $advanced.keep_names: --keep_names #end if '${fastafile}' && ## pick up the html index cp '${reportfile.extra_files_path}/index.html' ./index.html ]]></command> <inputs> <param name="fastafile" label="NGS reads" type="data" format="fasta" help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/> <param argument="--paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, they must be interleaved and all pairs must be complete. Example of the correct format is provided in the help below."/> <param argument="--sample" type="integer" min="2" optional="true" label="Subsample reads (number)" help="Use an integer > 1 to select a specific number of reads to use. Leave this field blank to use the entire dataset."/> <param argument="--taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats"> <option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0</option> <option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option> <option value="METAZOA3.0">Metazoa version 3.0</option> <option value="METAZOA2.0">Metazoa version 2.0</option> </param> <section name="advanced" title="Advanced options" expanded="false"> <param argument="--mincl" label="Cluster size threshold for detailed analysis" type="float" value="" min="0.0001" max="100" optional="true" help="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/> <param argument="--assembly_min" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/> <param argument="--keep_names" label="Keep original read names" type="boolean" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/> </section> </inputs> <outputs> <data name="reportfile" format="html" from_work_dir="index.html" label="RepeatExplorer - HTML report on ${on_string}"/> </outputs> <tests> <!-- test1: basic function --> <test expect_num_outputs="1"> <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/> <param name="paired" value="True"/> <param name="taxon" value="VIRIDIPLANTAE3.0"/> <output name="reportfile"> <assert_contents> <has_text text="Clustering summary"/> </assert_contents> </output> </test> <!-- test2: read subsample --> <test expect_num_outputs="1"> <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/> <param name="paired" value="True"/> <param name="sample" value="5000"/> <param name="taxon" value="VIRIDIPLANTAE3.0"/> <output name="reportfile"> <assert_contents> <has_text text="Clustering summary"/> </assert_contents> </output> </test> <!-- test3: advanced params --> <test expect_num_outputs="1"> <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/> <param name="paired" value="True"/> <param name="taxon" value="VIRIDIPLANTAE3.0"/> <param name="mincl" value="0.01"/> <param name="keep_names" value="True"/> <output name="reportfile"> <assert_contents> <has_text text="Clustering summary"/> </assert_contents> </output> </test> </tests> <help><![CDATA[ **HELP** RepeatExplorer2 clustering is a computational pipeline for unsupervised identification of repeats from unassembled sequence reads. The pipeline uses low-pass whole genome sequence reads and performs graph-based clustering. Resulting clusters, representing all types of repeats, are then examined to identify and classify into repeats groups. **Input data** The analysis requires either **single** or **paired-end reads** generated by whole genome shotgun sequencing provided as a single fasta-formatted file. Generally, paired-end reads provide significantly better results than single reads. Reads should be of uniform length (optimal size range is 100-200 nt) and the number of analyzed reads should represent less than 1x genome equivalent (genome coverage of 0.01 - 0.50 x is recommended). Reads should be quality-filtered (recommended filtering : quality score >=10 over 95% of bases and no Ns allowed) and only **complete read pairs** should be submitted for analysis. When paired reads are used, input data must be **interlaced** format as fasta file: example of interlaced input format:: >0001_f CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG >0001_r GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT >0002_f ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG >0002_r TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC >0003_f TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT >0003_r TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT ... **Comparative analysis** For comparative analysis sequence names must contain code (prefix) for each group. Prefix in sequences names must be of fixed length. Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB :: >AA0001_f CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG >AA0001_r GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT >AA0002_f ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG >AA0002_r TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC >BB0001_f TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT >BB0001_r TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT >BB0002_f TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT >BB0002_r TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT To prepare quality filtered and interlaced input fasta file from fastq files, use `Preprocessing of paired-reads`__ tool. .. __: tool_runner?tool_id=paired_fastq_filtering **Additional parameters** **Sample size** defines how many reads should be used in calculation. Default setting with 500,000 reads will enable detection of high copy repeats within several hours of computation time. For higher sensitivity the sample size can be set higher. Since sample size affects the memory usage, this parameter may be automatically adjusted to lower value during the run. Maximum sample size which can be processed depends on the repetitiveness of analyzed genome. **Select taxon and protein domain database version (REXdb)**. Classification of transposable elements is based on the similarity to our reference database of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species can be obtained on `repeatexplorer.org`__. Classification system used in REXdb is described in article `Systematic survey of plant LTR-retrotransposons elucidates phylogenetic relationships of their polyprotein domains and provides a reference for element classification`__ Database for Metazoa species is still under development so use it with caution. .. __: http://repeatexplorer.org .. __: https://doi.org/10.1186/s13100-018-0144-1 **Select parameters for protein domain search** REXdb is compared with s equence clusters either using blastx or diamond aligner. Diamond program is about three time faster than blastx with word size 3. **Similarity search options** By default sequence reads are compared using mgblast program. Default threshold is explicitly set to 90% sequence similarity spanning at least 55% of the read length (in the case of reads differing in length it applies to the longer one). Additionally, sequence overlap must be at least 55 nt. If you select option for shorter reads than 100 nt, minimum overlap 55 nt is not required. By default, mgblast search use DUST program to filter out low-complexity sequences. If you want to increase sensitivity of detection of satellites with shorter monomer use option with '*no masking of low complexity repeats*'. Note that omitting DUST filtering will significantly increase running times **Automatic filtering of abundant satellite repeats** perform clustering on smaller dataset of sequence reads to detect abundant high confidence satellite repeats. If such satellites are detected, sequence reads derived from these satellites are depleted from input dataset. This step enable more sensitive detection of less abundant repeats as more reads can be used in clustering step. **Use custom repeat database**. This option allows users to perform similarity comparison of identified repeats to their custom databases. The repeat class must be encoded in FASTA headers of database entries in order to allow correct parsing of similarity hits. Required format for custom database sequence name is: :: >reapeatname#class/subclass **Output** List of clusters identified as putative satellite repeats, their genomic abundance and various cluster characteristics. Output includes a **HTML summary** with table listing of all analyzed clusters. More detailed information about clusters is provided in additional files and directories. All results are also provided as downloadable **zip archive**. Additionally a **log file** reporting the progress of the computational pipeline is provided. ]]></help> <expand macro="citations"/> </tool>