view repex_full_clustering.xml @ 0:6eec21828dd4 draft default tip

planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/repeatexplorer2 commit 3407a4e6a60ff89a0ab5eab87ab94b0d9a209500

<tool id="repeatexplorer_clustering" name="RepeatExplorer (clustering)" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
  <description>repeat discovery and characterization using graph-based sequence clustering</description>
  <macros>
    <import>macros.xml</import>
  </macros>
  <expand macro="creator"/>
  <expand macro="requirements"/>
  <command><![CDATA[
      
      export GALAXY_MEMORY_KB=\$((\${GALAXY_MEMORY_MB:-8192}*1024))
      &&

      export PYTHONHASHSEED=0
      &&

      ## output will go here
      mkdir -p '${reportfile.extra_files_path}'
      &&

      /repex_tarean/seqclust
      --cpu \${GALAXY_SLOTS:-1}
      --max_memory \${GALAXY_MEMORY_KB}
      '${paired}'
      #if $sample:
        --sample '${sample}'
      #end if
      --taxon '${taxon}'
      --output_dir='${reportfile.extra_files_path}'
      #if $advanced.mincl:
        --mincl '${advanced.mincl}'
      #end if
      --assembly_min '${advanced.assembly_min}'
      #if $advanced.keep_names:
        --keep_names
      #end if
      '${fastafile}'
      &&

      ## pick up the html index
      cp '${reportfile.extra_files_path}/index.html' ./index.html

      ]]></command>
  <inputs>
    <param name="fastafile" label="NGS reads" type="data" format="fasta" help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/>
    <param argument="--paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, they must be interleaved and all pairs must be complete. Example of the correct format is provided in the help below."/>
    <param argument="--sample" type="integer" min="2" optional="true" label="Subsample reads (number)" help="Use an integer &gt; 1 to select a specific number of reads to use. Leave this field blank to use the entire dataset."/>
    <param argument="--taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats">
      <option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0</option>
      <option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option>
      <option value="METAZOA3.0">Metazoa version 3.0</option>
      <option value="METAZOA2.0">Metazoa version 2.0</option>
    </param>
    <section name="advanced" title="Advanced options" expanded="false">
      <param argument="--mincl" label="Cluster size threshold  for detailed analysis" type="float" value="" min="0.0001" max="100" optional="true" help="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/>
      <param argument="--assembly_min" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/>
      <param argument="--keep_names" label="Keep original read names" type="boolean" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/>
    </section>
  </inputs>
  <outputs>
    <data name="reportfile" format="html" from_work_dir="index.html" label="RepeatExplorer - HTML report on ${on_string}"/>
  </outputs>
  <tests>
    <!-- test1: basic function -->
    <test expect_num_outputs="1">
      <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
      <param name="paired" value="True"/>
      <param name="taxon" value="VIRIDIPLANTAE3.0"/>
      <output name="reportfile">
      <assert_contents>
        <has_text text="Clustering summary"/>
      </assert_contents>
    </output>
    </test>
    <!-- test2: read subsample -->
    <test expect_num_outputs="1">
      <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
      <param name="paired" value="True"/>
      <param name="sample" value="5000"/>
      <param name="taxon" value="VIRIDIPLANTAE3.0"/>
      <output name="reportfile">
        <assert_contents>
          <has_text text="Clustering summary"/>
        </assert_contents>
      </output>
    </test>
    <!-- test3: advanced params -->
    <test expect_num_outputs="1">
      <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
      <param name="paired" value="True"/>
      <param name="taxon" value="VIRIDIPLANTAE3.0"/>
      <param name="mincl" value="0.01"/>
      <param name="keep_names" value="True"/>
      <output name="reportfile">
        <assert_contents>
          <has_text text="Clustering summary"/>
        </assert_contents>
      </output>
    </test>
  </tests>
  <help><![CDATA[
      **HELP**
      
      RepeatExplorer2 clustering is a computational pipeline for unsupervised
      identification of repeats from unassembled sequence reads. The
      pipeline uses low-pass whole genome sequence reads and performs graph-based
      clustering. Resulting clusters, representing all types of repeats, are then
      examined to identify and classify into repeats groups. 

      **Input data**
      
      The analysis requires either **single** or **paired-end reads** generated
      by whole genome shotgun sequencing provided as a single fasta-formatted file.
      Generally, paired-end reads provide significantly better results than single
      reads. Reads should be of uniform length (optimal size range is 100-200 nt) and
      the number of analyzed reads should represent less than 1x genome equivalent
      (genome coverage of 0.01 - 0.50 x is recommended). Reads should be
      quality-filtered (recommended filtering : quality score >=10 over 95% of bases
      and no Ns allowed) and only **complete read pairs** should be submitted for
      analysis. When paired reads are used, input data must be **interlaced** format
      as fasta file:

      example of interlaced input format::
      
        >0001_f
        CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
        >0001_r
        GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
        >0002_f
        ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
        >0002_r
        TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
        >0003_f
        TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
        >0003_r
        TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
        ...


      **Comparative analysis**

      For comparative analysis sequence names must contain code (prefix) for each group.
      Prefix in sequences names  must be of fixed length.

      Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB ::

        >AA0001_f
        CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
        >AA0001_r
        GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
        >AA0002_f
        ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
        >AA0002_r
        TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
        >BB0001_f
        TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
        >BB0001_r
        TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
        >BB0002_f
        TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
        >BB0002_r
        TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
        

      To prepare quality filtered and interlaced input fasta file from fastq
      files, use `Preprocessing of paired-reads`__  tool.

      .. __: tool_runner?tool_id=paired_fastq_filtering


      **Additional parameters**

      **Sample size** defines how many reads should be used in calculation.
      Default setting with 500,000 reads will enable detection of high copy
      repeats within several hours of computation time. For higher
      sensitivity the sample size can be set higher. Since sample size affects
      the memory usage, this parameter may be automatically adjusted to lower
      value during the run. Maximum sample size which can be processed depends on
      the repetitiveness of analyzed genome.

      
      **Select taxon and protein domain database version (REXdb)**. Classification
      of transposable elements is based on the similarity to our reference database
      of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species
      can be obtained on `repeatexplorer.org`__. Classification
      system used in REXdb is described in article `Systematic survey of plant
      LTR-retrotransposons elucidates phylogenetic relationships of their
      polyprotein domains and provides a reference for element classification`__
      Database for Metazoa species is still under development so use it with caution.

      .. __: http://repeatexplorer.org
      .. __: https://doi.org/10.1186/s13100-018-0144-1

      **Select parameters for protein domain search** REXdb is compared with s
      equence clusters either using blastx or diamond aligner. Diamond program
      is about three time faster than blastx with word size 3.

      **Similarity search options** By default sequence reads are compared using
      mgblast program. Default threshold is explicitly set to 90% sequence
      similarity spanning at least 55% of the read length (in the case of reads
      differing in length it applies to the longer one). Additionally, sequence
      overlap must be at least 55 nt. If you select option for shorter reads
      than 100 nt,  minimum overlap 55 nt is not required.

      By default,
      mgblast search use DUST program to filter out
      low-complexity sequences. If you want
      to increase sensitivity of detection of satellites with shorter monomer
      use option with '*no masking of low complexity repeats*'. Note that omitting
      DUST filtering will significantly increase running times
     

      **Automatic filtering of abundant satellite repeats** perform clustering on
      smaller dataset of sequence reads to detect abundant high confidence
      satellite repeats. If such satellites are detected, sequence reads derived
      from these satellites are depleted from input dataset. This step enable more
      sensitive detection of less abundant repeats as more reads can be used
      in clustering step.

      **Use custom repeat database**. This option allows users to perform similarity
      comparison of identified repeats to their custom databases. The repeat class must
      be encoded in FASTA headers of database entries in order to allow correct 
      parsing of similarity hits. Required format for custom database sequence name is: ::

        >reapeatname#class/subclass


      **Output**

      List of clusters identified as putative satellite repeats, their genomic
      abundance and various cluster characteristics. 

      Output includes a **HTML summary** with table listing of all analyzed
      clusters. More detailed information about clusters is provided in
      additional files and directories. All results are also provided as
      downloadable **zip archive**. Additionally a **log file** reporting
      the progress of the computational pipeline is provided.
      
      ]]></help>
  <expand macro="citations"/>
</tool>