Mercurial > repos > gga > repeatexplorer_clustering
changeset 0:6eec21828dd4 draft default tip
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/repeatexplorer2 commit 3407a4e6a60ff89a0ab5eab87ab94b0d9a209500
| author | gga |
|---|---|
| date | Thu, 02 Nov 2023 16:20:35 +0000 |
| parents | |
| children | |
| files | macros.xml repex_full_clustering.xml test-data/LAS_paired_10k.fa.gz |
| diffstat | 3 files changed, 269 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Thu Nov 02 16:20:35 2023 +0000 @@ -0,0 +1,29 @@ +<macros> + <token name="@TOOL_VERSION@">2.3.8</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">23.0</token> + <xml name="requirements"> + <requirements> + <container type="docker">kavonrtep/repeatexplorer:@TOOL_VERSION@</container> + </requirements> + </xml> + <xml name="citations"> + <citations> + <citation type="bibtex">@software{repeatexplorer2, + author = {repeatexplorer}, + year = {2023}, + title = {repeatexplorer2}, + publisher = {GitHub}, + url = {https://github.com/repeatexplorer/repex_tarean} + }</citation> + </citations> + </xml> + <xml name="creator"> + <creator> + <person name="Petr Novak" /> + <organization name="Laboratory of Molecular Cytogenetics" url="http://w3lamc.umbr.cas.cz/lamc" address="Institute of Plant Molecular Biology, Biology Centre CAS, Branisovska 31, Ceske Budejoice, Czech Republic"/> + <person name="Tom Harrop"/> + <organization name="Galaxy Australia" url="https://site.usegalaxy.org.au"/> + </creator> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repex_full_clustering.xml Thu Nov 02 16:20:35 2023 +0000 @@ -0,0 +1,240 @@ +<tool id="repeatexplorer_clustering" name="RepeatExplorer (clustering)" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> + <description>repeat discovery and characterization using graph-based sequence clustering</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="creator"/> + <expand macro="requirements"/> + <command><![CDATA[ + + export GALAXY_MEMORY_KB=\$((\${GALAXY_MEMORY_MB:-8192}*1024)) + && + + export PYTHONHASHSEED=0 + && + + ## output will go here + mkdir -p '${reportfile.extra_files_path}' + && + + /repex_tarean/seqclust + --cpu \${GALAXY_SLOTS:-1} + --max_memory \${GALAXY_MEMORY_KB} + '${paired}' + #if $sample: + --sample '${sample}' + #end if + --taxon '${taxon}' + --output_dir='${reportfile.extra_files_path}' + #if $advanced.mincl: + --mincl '${advanced.mincl}' + #end if + --assembly_min '${advanced.assembly_min}' + #if $advanced.keep_names: + --keep_names + #end if + '${fastafile}' + && + + ## pick up the html index + cp '${reportfile.extra_files_path}/index.html' ./index.html + + ]]></command> + <inputs> + <param name="fastafile" label="NGS reads" type="data" format="fasta" help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/> + <param argument="--paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, they must be interleaved and all pairs must be complete. Example of the correct format is provided in the help below."/> + <param argument="--sample" type="integer" min="2" optional="true" label="Subsample reads (number)" help="Use an integer > 1 to select a specific number of reads to use. Leave this field blank to use the entire dataset."/> + <param argument="--taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats"> + <option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0</option> + <option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option> + <option value="METAZOA3.0">Metazoa version 3.0</option> + <option value="METAZOA2.0">Metazoa version 2.0</option> + </param> + <section name="advanced" title="Advanced options" expanded="false"> + <param argument="--mincl" label="Cluster size threshold for detailed analysis" type="float" value="" min="0.0001" max="100" optional="true" help="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/> + <param argument="--assembly_min" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/> + <param argument="--keep_names" label="Keep original read names" type="boolean" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/> + </section> + </inputs> + <outputs> + <data name="reportfile" format="html" from_work_dir="index.html" label="RepeatExplorer - HTML report on ${on_string}"/> + </outputs> + <tests> + <!-- test1: basic function --> + <test expect_num_outputs="1"> + <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/> + <param name="paired" value="True"/> + <param name="taxon" value="VIRIDIPLANTAE3.0"/> + <output name="reportfile"> + <assert_contents> + <has_text text="Clustering summary"/> + </assert_contents> + </output> + </test> + <!-- test2: read subsample --> + <test expect_num_outputs="1"> + <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/> + <param name="paired" value="True"/> + <param name="sample" value="5000"/> + <param name="taxon" value="VIRIDIPLANTAE3.0"/> + <output name="reportfile"> + <assert_contents> + <has_text text="Clustering summary"/> + </assert_contents> + </output> + </test> + <!-- test3: advanced params --> + <test expect_num_outputs="1"> + <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/> + <param name="paired" value="True"/> + <param name="taxon" value="VIRIDIPLANTAE3.0"/> + <param name="mincl" value="0.01"/> + <param name="keep_names" value="True"/> + <output name="reportfile"> + <assert_contents> + <has_text text="Clustering summary"/> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + **HELP** + + RepeatExplorer2 clustering is a computational pipeline for unsupervised + identification of repeats from unassembled sequence reads. The + pipeline uses low-pass whole genome sequence reads and performs graph-based + clustering. Resulting clusters, representing all types of repeats, are then + examined to identify and classify into repeats groups. + + **Input data** + + The analysis requires either **single** or **paired-end reads** generated + by whole genome shotgun sequencing provided as a single fasta-formatted file. + Generally, paired-end reads provide significantly better results than single + reads. Reads should be of uniform length (optimal size range is 100-200 nt) and + the number of analyzed reads should represent less than 1x genome equivalent + (genome coverage of 0.01 - 0.50 x is recommended). Reads should be + quality-filtered (recommended filtering : quality score >=10 over 95% of bases + and no Ns allowed) and only **complete read pairs** should be submitted for + analysis. When paired reads are used, input data must be **interlaced** format + as fasta file: + + example of interlaced input format:: + + >0001_f + CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG + >0001_r + GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT + >0002_f + ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG + >0002_r + TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC + >0003_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >0003_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + ... + + + **Comparative analysis** + + For comparative analysis sequence names must contain code (prefix) for each group. + Prefix in sequences names must be of fixed length. + + Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB :: + + >AA0001_f + CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG + >AA0001_r + GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT + >AA0002_f + ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG + >AA0002_r + TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC + >BB0001_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >BB0001_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + >BB0002_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >BB0002_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + + + To prepare quality filtered and interlaced input fasta file from fastq + files, use `Preprocessing of paired-reads`__ tool. + + .. __: tool_runner?tool_id=paired_fastq_filtering + + + **Additional parameters** + + **Sample size** defines how many reads should be used in calculation. + Default setting with 500,000 reads will enable detection of high copy + repeats within several hours of computation time. For higher + sensitivity the sample size can be set higher. Since sample size affects + the memory usage, this parameter may be automatically adjusted to lower + value during the run. Maximum sample size which can be processed depends on + the repetitiveness of analyzed genome. + + + **Select taxon and protein domain database version (REXdb)**. Classification + of transposable elements is based on the similarity to our reference database + of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species + can be obtained on `repeatexplorer.org`__. Classification + system used in REXdb is described in article `Systematic survey of plant + LTR-retrotransposons elucidates phylogenetic relationships of their + polyprotein domains and provides a reference for element classification`__ + Database for Metazoa species is still under development so use it with caution. + + .. __: http://repeatexplorer.org + .. __: https://doi.org/10.1186/s13100-018-0144-1 + + **Select parameters for protein domain search** REXdb is compared with s + equence clusters either using blastx or diamond aligner. Diamond program + is about three time faster than blastx with word size 3. + + **Similarity search options** By default sequence reads are compared using + mgblast program. Default threshold is explicitly set to 90% sequence + similarity spanning at least 55% of the read length (in the case of reads + differing in length it applies to the longer one). Additionally, sequence + overlap must be at least 55 nt. If you select option for shorter reads + than 100 nt, minimum overlap 55 nt is not required. + + By default, + mgblast search use DUST program to filter out + low-complexity sequences. If you want + to increase sensitivity of detection of satellites with shorter monomer + use option with '*no masking of low complexity repeats*'. Note that omitting + DUST filtering will significantly increase running times + + + **Automatic filtering of abundant satellite repeats** perform clustering on + smaller dataset of sequence reads to detect abundant high confidence + satellite repeats. If such satellites are detected, sequence reads derived + from these satellites are depleted from input dataset. This step enable more + sensitive detection of less abundant repeats as more reads can be used + in clustering step. + + **Use custom repeat database**. This option allows users to perform similarity + comparison of identified repeats to their custom databases. The repeat class must + be encoded in FASTA headers of database entries in order to allow correct + parsing of similarity hits. Required format for custom database sequence name is: :: + + >reapeatname#class/subclass + + + **Output** + + List of clusters identified as putative satellite repeats, their genomic + abundance and various cluster characteristics. + + Output includes a **HTML summary** with table listing of all analyzed + clusters. More detailed information about clusters is provided in + additional files and directories. All results are also provided as + downloadable **zip archive**. Additionally a **log file** reporting + the progress of the computational pipeline is provided. + + ]]></help> + <expand macro="citations"/> +</tool>