# HG changeset patch
# User greg
# Date 1623865015 0
# Node ID 04aded03ab74843ca5a88073ea954a737a1206fc
# Parent  4ebdeb4df6ca622132cf994309902aece5c85ac7
Uploaded

diff -r 4ebdeb4df6ca -r 04aded03ab74 test-data/NC_002945v4.fasta
--- a/test-data/NC_002945v4.fasta	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,101 +0,0 @@
->NC_002945.4 Mycobacterium bovis AF2122/97 genome assembly, chromosome: Mycobacterium_bovis_AF2122/97
-TTGACCGATGACCCCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGAACTTAACGGCGACC
-CTAAGGTTGACGACGGACCCAGCAGTGATGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTG
-GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTATCCGTGCCGAGCAGCTTTGTC
-CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACCGACGCTCTCAGCCGCCGACTCGGACATCAGA
-TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGCCGACGACACTACCGTGCCGCCTTCCGA
-AAATCCTGCTACCACATCGCCAGACACCACAACCGACAACGACGAGATTGATGACAGCGCTGCGGCACGG
-GGCGATAACCAGCACAGTTGGCCAAGTTACTTCACCGAGCGCCCGCGCAATACCGATTCCGCTACCGCTG
-GCGTAACCAGCCTTAACCGTCGCTACACCTTTGATACGTTCGTTATCGGCGCCTCCAACCGGTTCGCGCA
-CGCCGCCGCCTTGGCGATCGCAGAAGCACCCGCCCGCGCTTACAACCCCCTGTTCATCTGGGGCGAGTCC
-GGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCCCAACGGTTGTTCCCGGGAATGCGGG
-TCAAATATGTCTCCACCGAGGAATTCACCAACGACTTCATTAACTCGCTCCGCGATGACCGCAAGGTCGC
-ATTCAAACGCAGCTACCGCGACGTAGACGTGCTGTTGGTCGACGACATCCAATTCATTGAAGGCAAAGAG
-GGTATTCAAGAGGAGTTCTTCCACACCTTCAACACCTTGCACAATGCCAACAAGCAAATCGTCATCTCAT
-CTGACCGCCCACCCAAGCAGCTCGCCACCCTCGAGGACCGGCTGAGAACCCGCTTTGAGTGGGGGCTGAT
-CACTGACGTACAACCACCCGAGCTGGAGACCCGCATCGCCATCTTGCGCAAGAAAGCACAGATGGAACGG
-CTCGCGATCCCCGACGATGTCCTCGAACTCATCGCCAGCAGTATCGAACGCAATATCCGTGAACTCGAGG
-GCGCGCTGATCCGGGTCACCGCGTTCGCCTCATTGAACAAAACACCAATCGACAAAGCGCTGGCCGAGAT
-TGTGCTTCGCGATCTGATCGCCGACGCCAACACCATGCAAATCAGCGCGGCGACGATCATGGCTGCCACC
-GCCGAATACTTCGACACTACCGTCGAAGAGCTTCGCGGGCCCGGCAAGACCCGAGCACTGGCCCAGTCAC
-GACAGATTGCGATGTACCTGTGTCGTGAGCTCACCGATCTTTCGTTGCCCAAAATCGGCCAAGCGTTCGG
-CCGTGATCACACAACCGTCATGTACGCCCAACGCAAGATCCTGTCCGAGATGGCCGAGCGCCGTGAGGTC
-TTTGATCACGTCAAAGAACTCACCACTCGCATCCGTCAGCGCTCCAAGCGCTAGCACGGCGTGTTCTTCC
-GACAACGTTCTTAAAAAAACTTCTCTCTCCCAGGTCACACCAGTCACAGAGATTGGCTGTGAGTGTCGCT
-GTGCACAAACCGCGCACAGACTCATACAGTCCCGGCGGTTCCGTTCACAACCCACGCCTCATCCCCACCG
-ACCCAACACACACCCCACAGTCATCGCCACCGTCATCCACAACTCCGACCGACGTCGACCTGCACCAAGA
-CCAGACTGTCCCCAAACTGCACACCCTCTAATACTGTTACCGAGATTTCTTCGTCGTTTGTTCTTGGAAA
-GACAGCGCTGGGGATCGTTCGCTGGATACCACCCGCATAACTGGCTCGTCGCGGTGGGTCAGAGGTCAAT
-GATGAACTTTCAAGTTGACGTGAGAAGCTCTACGGTTGTTGTTCGACTGCTGTTGCGGCCGTCGTGGCGG
-GTCACGCGTCATGGGCGTTCGTCGTTGGCAGTCCCCACGCTAGCGGGGCGCTAGCCACGGGATCGAACTC
-ATCGTGAGGTGAAAGGGCGCAATGGACGCGGCTACGACAAGAGTTGGCCTCACCGACTTGACGTTTCGTT
-TGCTACGAGAGTCTTTCGCCGATGCGGTGTCGTGGGTGGCTAAAAATCTGCCAGCCAGGCCCGCGGTGCC
-GGTGCTCTCCGGCGTGTTGTTGACCGGCTCGGACAACGGTCTGACGATTTCCGGATTCGACTACGAGGTT
-TCCGCCGAGGCCCAGGTTGGCGCTGAAATTGTTTCTCCTGGAAGCGTTTTAGTTTCTGGCCGATTGTTGT
-CCGATATTACCCGGGCGTTGCCTAACAAGCCCGTAGGCGTTCATGTCGAAGGTAACCGGGTCGCATTGAC
-CTGCGGTAACGCCAGGTTTTCGCTACCGACGATGCCAGTCGAGGATTATCCGACGCTGCCGACGCTGCCG
-GAAGAGACCGGATTGTTGCCTGCGGAATTATTCGCCGAGGCAATCAGTCAGGTCGCTATCGCCGCCGGCC
-GGGACGACACGCTGCCTATGTTGACCGGCATCCGGGTCGAAATCCTCGGTGAGACGGTGGTTTTGGCCGC
-TACCGACAGGTTTCGCCTGGCTGTTCGAGAACTGAAGTGGTCGGCGTCGTCGCCAGATATCGAAGCGGCT
-GTGCTGGTCCCGGCCAAGACGCTGGCCGAGGCCGCCAAAGCGGGCATCGGCGGCTCTGACGTTCGTTTGT
-CGTTGGGTACTGGGCCGGGGGTGGGCAAGGATGGCCTGCTCGGTATCAGTGGGAACGGCAAGCGCAGCAC
-CACGCGACTTCTTGATGCCGAGTTCCCGAAGTTTCGGCAGTTGCTACCAACCGAACACACCGCGGTGGCC
-ACCATGGACGTGGCCGAGTTGATCGAAGCGATCAAGCTGGTTGCGTTGGTAGCTGATCGGGGCGCGCAGG
-TGCGCATGGAGTTCGCTGATGGCAGCGTGCGGCTTTCTGCGGGTGCCGATGATGTTGGACGAGCCGAGGA
-AGATCTTGTTGTTGACTATGCCGGTGAACCATTGACGATTGCGTTTAACCCAACCTATCTAACGGACGGT
-TTGAGTTCGTTGCGCTCGGAGCGAGTGTCTTTCGGGTTTACGACTGCGGGTAAGCCTGCCTTGCTACGTC
-CGGTGTCCGGGGACGATCGCCCTGTGGCGGGTCTGAATGGCAACGGTCCGTTCCCGGCGGTGTCGACGGA
-CTATGTCTATCTGTTGATGCCGGTTCGGTTGCCGGGCTGAGCACTTGGCGCCCGGGTAGGTGTACGTCCG
-TCATTTGGGGCTGCGTGACTTCCGGTCCTGGGCATGTGTAGATCTGGAATTGCATCCAGGGCGGACGGTT
-TTTGTTGGGCCTAACGGTTATGGTAAGACGAATCTTATTGAGGCACTGTGGTATTCGACGACGTTAGGTT
-CGCACCGCGTTAGCGCCGATTTGCCGTTGATCCGGGTAGGTACCGATCGTGCGGTGATCTCCACGATCGT
-GGTGAACGACGGTAGAGAATGTGCCGTCGACCTCGAGATCGCCACGGGGCGAGTCAACAAAGCGCGATTG
-AATCGATCATCGGTCCGAAGTACACGTGATGTGGTCGGAGTGCTTCGAGCTGTGTTGTTTGCCCCTGAGG
-ATCTGGGGTTGGTTCGTGGGGATCCCGCTGACCGGCGGCGCTATCTGGATGATCTGGCGATCGTGCGTAG
-GCCTGCGATCGCTGCGGTACGAGCCGAATATGAGAGGGTGGTGCGCCAGCGGACGGCGTTATTGAAGTCC
-GTACCTGGAGCACGGTATCGGGGTGACCGGGGTGTGTTTGACACTCTTGAGGTATGGGACAGTCGTTTGG
-CGGAGCACGGGGCTGAACTGGTGGCCGCCCGCATCGATTTGGTCAACCAGTTGGCACCGGAAGTGAAGAA
-GGCATACCAGCTGTTGGCGCCGGAATCGCGATCGGCGTCTATCGGTTATCGGGCCAGCATGGATGTAACC
-GGTCCCAGCGAGCAGTCAGATACCGATCGGCAATTGTTAGCAGCTCGGCTGTTGGCGGCGCTGGCGGCCC
-GTCGGGATGCCGAACTCGAGCGTGGGGTTTGTCTAGTTGGTCCGCACCGTGACGACCTAATACTGCGACT
-AGGCGATCAACCCGCGAAAGGATTTGCTAGCCATGGGGAGGCGTGGTCGTTGGCGGTGGCACTGCGGTTG
-GCGGCCTATCAACTGTTACGCGTTGATGGTGGTGAGCCGGTGTTGTTGCTCGACGACGTGTTCGCCGAAC
-TGGATGTCATGCGCCGTCGAGCGTTGGCGACGGCGGCCGAGTCCGCCGAACAGGTGTTGGTGACTGCCGC
-GGTGCTCGAGGATATTCCCGCCGGCTGGGACGCCAGGCGGGTGCACATCGATGTGCGTGCCGATGACACC
-GGATCGATGTCGGTGGTTCTGCCATGACGGGTTCTGTTGACCGGCCCGACCAGAATCGCGGTGAGCGATT
-AATGAAGTCACCAGGGTTGGATTTGGTCAGGCGCACCCTGGACGAAGCTCGTGCTGCTGCCCGCGCGCGC
-GGACAAGACGCCGGTCGAGGGCGGGTCGCTTCCGTTGCGTCGGGTCGGGTGGCCGGACGGCGACGAAGCT
-GGTCGGGTCCGGGGCCCGACATTCGTGATCCACAACCGCTGGGTAAGGCCGCTCGTGAGCTGGCAAAGAA
-ACGCGGCTGGTCGGTGCGGGTCGCCGAGGGTATGGTGCTCGGCCAGTGGTCTGCGGTGGTCGGCCACCAG
-ATCGCCGAACATGCACGCCCGACTGCGCTAAACGACGGGGTGTTGAGCGTGATTGCGGAGTCGACGGCGT
-GGGCGACGCAGTTGAGGATCATGCAGGCCCAGCTTCTGGCCAAGATCGCCGCAGCGGTTGGCAACGATGT
-GGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCATCGTGGCGCAAGGGGCCTCGCCATATTGCCGGT
-AGGGGTCCGCGCGACACCTACGGATAACACGTCGATCGGCCCAGAACAAGGCGCTCCGGTCCCGGCCTGA
-GAGCCTCGAGGACGAAGCGGATCCGTATGCCGGACGTCGGGACGCACCAGGAAGAAAGATGTCCGACGCA
-CGGCGCGGTTAGATGGGTAAAAACGAGGCCAGAAGATCGGCCCTGGCGCCCGATCACGGTACAGTGGTGT
-GCGACCCCCTGCGGCGACTCAACCGCATGCACGCAACCCCTGAGGAGAGTATTCGGATCGTGGCTGCCCA
-GAAAAAGAAGGCCCAAGACGAATACGGCGCTGCGTCTATCACCATTCTCGAAGGGCTGGAGGCCGTCCGC
-AAACGTCCCGGCATGTACATTGGCTCGACCGGTGAGCGCGGTTTACACCATCTCATTTGGGAGGTGGTCG
-ACAACGCGGTCGACGAGGCGATGGCCGGTTATGCAACCACAGTGAACGTAGTGCTGCTTGAGGATGGCGG
-TGTCGAGGTCGCCGACGACGGCCGCGGCATTCCGGTCGCCACCCACGCCTCCGGCATACCGACCGTCGAC
-GTGGTGATGACACAACTACATGCCGGCGGCAAGTTCGACTCGGACGCGTATGCGATATCTGGTGGTCTGC
-ACGGCGTCGGCGTGTCGGTGGTTAACGCGCTATCCACCCGGCTCGAAGTCGAGATCAAGCGCGACGGGTA
-CGAGTGGTCTCAGGTTTATGAGAAGTCGGAACCCCTGGGCCTCAAGCAAGGGGCGCCGACCAAGAAGACG
-GGGTCAACGGTACGGTTCTGGGCCGACCCCGCTGTTTTCGAAACCACGGAATACGACTTCGAAACCGTCG
-CCCGCCGGCTGCAAGAGATGGCGTTCCTCAACAAGGGGCTGACCATCAACCTGACCGACGAGAGGGTGAC
-CCAAGACGAGGTCGTCGACGAAGTGGTCAGCGACGTCGCCGAGGCGCCGAAGTCGGCAAGTGAACGCGCA
-GCCGAATCCACTGCACCGCACAAAGTTAAGAGCCGCACCTTTCACTATCCGGGTGGCCTGGTGGACTTCG
-TGAAACACATCAACCGCACCAAGAACGCGATTCATAGCAGCATCGTGGACTTTTCCGGCAAGGGCACCGG
-GCACGAGGTGGAGATCGCGATGCAATGGAACGCCGGGTATTCGGAGTCGGTGCACACCTTCGCCAACACC
-ATCAACACCCACGAGGGCGGCACCCACGAAGAGGGCTTCCGCAGCGCGCTGACGTCGGTGGTGAACAAGT
-ACGCCAAGGACCGCAAGCTACTGAAGGACAAGGACCCCAACCTCACCGGTGACGATATCCGGGAAGGCCT
-GGCCGCTGTGATCTCGGTGAAGGTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGGCAAC
-ACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAATGAACAGCTGACCCACTGGTTTGAAGCCAACCCCA
-CCGACTCGAAAGTCGTTGTGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTATCGCGGCACGTAAGGCACG
-AGAGTTGGTGCGGCGTAAGAGCGCCACCGACATCGGTGGATTGCCCGGCAAGCTGGCCGATTGCCGTTCC
-ACGGATCCGCGCAAGTCCGAACTGTATGTCGTAGAAGGTGACTCGGCCGGCGGTTCTGCAAAAAGCGGTC
-GCGATTCGATGTTCCAGGCGATACTTCCGCTGCGCGGCAAGATCATCAATGTGGAGAAAGCGCGCATCGA
-CCGGGTGCTAAAGAACACCGAAGTTCAGGCGATCATCACGGCGCTGGGCACCGGGATCCACGACGAGTTC
-GATATCGGCAAGCTGCGCTACCACAAGATCGTGCTGATGGCCGACGCCGATGTTGACGGCCAACATATTT
-CCACGCTGTTGTTGACGTTGTTGTTCCGGTTCATGCGGCCGCTCATCGAGAACGGGCATGTGTTTTTGGC
-ACAACCGCCGCTGTACAAACTCAAGTGGCAGCGCAGTGACCCGGAATTCGCATACTCCGACCGCGAGCGC
diff -r 4ebdeb4df6ca -r 04aded03ab74 test-data/bam_input.bam
Binary file test-data/bam_input.bam has changed
diff -r 4ebdeb4df6ca -r 04aded03ab74 test-data/fasta_indexes.loc
--- a/test-data/fasta_indexes.loc	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-89	89	Mycobacterium_AF2122	${__HERE__}/NC_002945v4.fasta
diff -r 4ebdeb4df6ca -r 04aded03ab74 test-data/output_metrics.tabular
--- a/test-data/output_metrics.tabular	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,3 +0,0 @@
-# File	Number of Good SNPs	Average Coverage	Genome Coverage
-vcf_input_vcf		0.659602	50.49%
-vcf_input_vcf	0		
diff -r 4ebdeb4df6ca -r 04aded03ab74 test-data/output_vcf.vcf
--- a/test-data/output_vcf.vcf	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,100 +0,0 @@
-##fileformat=VCFv4.2
-##fileDate=20200302
-##source=freeBayes v1.3.1-dirty
-##reference=/home/galaxy/galaxy/tool-data/AF2122/seq/AF2122.fa
-##contig=<ID=NC_002945.4,length=4349904>
-##phasing=none
-##commandline="freebayes --region NC_002945.4:0..4349904 --bam b_0.bam --fasta-reference /home/galaxy/galaxy/tool-data/AF2122/seq/AF2122.fa --vcf ./vcf_output/part_NC_002945.4:0..4349904.vcf -u -n 0 --haplotype-length -1 --min-repeat-size 5 --min-repeat-entropy 1 -m 1 -q 0 -R 0 -Y 0 -e 1 -F 0.05 -C 2 -G 1 --min-alternate-qsum 0"
-##filter="QUAL > 0"
-##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
-##INFO=<ID=DPB,Number=1,Type=Float,Description="Total read depth per bp at the locus; bases in reads overlapping / bases in haplotype">
-##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
-##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
-##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
-##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
-##INFO=<ID=AO,Number=A,Type=Integer,Description="Count of full observations of this alternate haplotype.">
-##INFO=<ID=PRO,Number=1,Type=Float,Description="Reference allele observation count, with partial observations recorded fractionally">
-##INFO=<ID=PAO,Number=A,Type=Float,Description="Alternate allele observations, with partial observations recorded fractionally">
-##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
-##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
-##INFO=<ID=PQR,Number=1,Type=Float,Description="Reference allele quality sum in phred for partial observations">
-##INFO=<ID=PQA,Number=A,Type=Float,Description="Alternate allele quality sum in phred for partial observations">
-##INFO=<ID=SRF,Number=1,Type=Integer,Description="Number of reference observations on the forward strand">
-##INFO=<ID=SRR,Number=1,Type=Integer,Description="Number of reference observations on the reverse strand">
-##INFO=<ID=SAF,Number=A,Type=Integer,Description="Number of alternate observations on the forward strand">
-##INFO=<ID=SAR,Number=A,Type=Integer,Description="Number of alternate observations on the reverse strand">
-##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
-##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
-##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RPL,Number=A,Type=Float,Description="Reads Placed Left: number of reads supporting the alternate balanced to the left (5') of the alternate allele">
-##INFO=<ID=RPR,Number=A,Type=Float,Description="Reads Placed Right: number of reads supporting the alternate balanced to the right (3') of the alternate allele">
-##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio.  Ratio between depth in samples with each called alternate allele and those without.">
-##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
-##INFO=<ID=GTI,Number=1,Type=Integer,Description="Number of genotyping iterations required to reach convergence or bailout.">
-##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
-##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing.  Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
-##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
-##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
-##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
-##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
-##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
-##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
-##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
-##INFO=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum depth in gVCF output block.">
-##INFO=<ID=END,Number=1,Type=Integer,Description="Last position (inclusive) in gVCF output record.">
-##INFO=<ID=technology.ILLUMINA,Number=A,Type=Float,Description="Fraction of observations supporting the alternate observed in reads from ILLUMINA">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
-##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Number of observation for each allele">
-##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
-##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
-##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
-##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
-##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum depth in gVCF output block.">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	13-1941-6
-NC_002945.4	1	.	N	.	.	.	.	GT	./.
-NC_002945.4	2	.	N	.	.	.	.	GT	./.
-NC_002945.4	3	.	N	.	.	.	.	GT	./.
-NC_002945.4	4	.	N	.	.	.	.	GT	./.
-NC_002945.4	5	.	N	.	.	.	.	GT	./.
-NC_002945.4	6	.	N	.	.	.	.	GT	./.
-NC_002945.4	7	.	N	.	.	.	.	GT	./.
-NC_002945.4	8	.	N	.	.	.	.	GT	./.
-NC_002945.4	9	.	N	.	.	.	.	GT	./.
-NC_002945.4	10	.	N	.	.	.	.	GT	./.
-NC_002945.4	11	.	N	.	.	.	.	GT	./.
-NC_002945.4	12	.	N	.	.	.	.	GT	./.
-NC_002945.4	13	.	N	.	.	.	.	GT	./.
-NC_002945.4	14	.	N	.	.	.	.	GT	./.
-NC_002945.4	15	.	N	.	.	.	.	GT	./.
-NC_002945.4	16	.	N	.	.	.	.	GT	./.
-NC_002945.4	17	.	N	.	.	.	.	GT	./.
-NC_002945.4	18	.	N	.	.	.	.	GT	./.
-NC_002945.4	19	.	N	.	.	.	.	GT	./.
-NC_002945.4	20	.	N	.	.	.	.	GT	./.
-NC_002945.4	21	.	N	.	.	.	.	GT	./.
-NC_002945.4	22	.	N	.	.	.	.	GT	./.
-NC_002945.4	23	.	N	.	.	.	.	GT	./.
-NC_002945.4	24	.	N	.	.	.	.	GT	./.
-NC_002945.4	25	.	N	.	.	.	.	GT	./.
-NC_002945.4	26	.	N	.	.	.	.	GT	./.
-NC_002945.4	27	.	N	.	.	.	.	GT	./.
-NC_002945.4	28	.	N	.	.	.	.	GT	./.
-NC_002945.4	29	.	N	.	.	.	.	GT	./.
-NC_002945.4	30	.	N	.	.	.	.	GT	./.
-NC_002945.4	31	.	N	.	.	.	.	GT	./.
-NC_002945.4	32	.	N	.	.	.	.	GT	./.
-NC_002945.4	33	.	N	.	.	.	.	GT	./.
-NC_002945.4	34	.	N	.	.	.	.	GT	./.
-NC_002945.4	35	.	N	.	.	.	.	GT	./.
-NC_002945.4	36	.	N	.	.	.	.	GT	./.
-NC_002945.4	37	.	N	.	.	.	.	GT	./.
diff -r 4ebdeb4df6ca -r 04aded03ab74 test-data/vcf_input.vcf
--- a/test-data/vcf_input.vcf	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,64 +0,0 @@
-##fileformat=VCFv4.2
-##fileDate=20200302
-##source=freeBayes v1.3.1-dirty
-##reference=/home/galaxy/galaxy/tool-data/AF2122/seq/AF2122.fa
-##contig=<ID=NC_002945.4,length=4349904>
-##phasing=none
-##commandline="freebayes --region NC_002945.4:0..4349904 --bam b_0.bam --fasta-reference /home/galaxy/galaxy/tool-data/AF2122/seq/AF2122.fa --vcf ./vcf_output/part_NC_002945.4:0..4349904.vcf -u -n 0 --haplotype-length -1 --min-repeat-size 5 --min-repeat-entropy 1 -m 1 -q 0 -R 0 -Y 0 -e 1 -F 0.05 -C 2 -G 1 --min-alternate-qsum 0"
-##filter="QUAL > 0"
-##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
-##INFO=<ID=DPB,Number=1,Type=Float,Description="Total read depth per bp at the locus; bases in reads overlapping / bases in haplotype">
-##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
-##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
-##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
-##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
-##INFO=<ID=AO,Number=A,Type=Integer,Description="Count of full observations of this alternate haplotype.">
-##INFO=<ID=PRO,Number=1,Type=Float,Description="Reference allele observation count, with partial observations recorded fractionally">
-##INFO=<ID=PAO,Number=A,Type=Float,Description="Alternate allele observations, with partial observations recorded fractionally">
-##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
-##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
-##INFO=<ID=PQR,Number=1,Type=Float,Description="Reference allele quality sum in phred for partial observations">
-##INFO=<ID=PQA,Number=A,Type=Float,Description="Alternate allele quality sum in phred for partial observations">
-##INFO=<ID=SRF,Number=1,Type=Integer,Description="Number of reference observations on the forward strand">
-##INFO=<ID=SRR,Number=1,Type=Integer,Description="Number of reference observations on the reverse strand">
-##INFO=<ID=SAF,Number=A,Type=Integer,Description="Number of alternate observations on the forward strand">
-##INFO=<ID=SAR,Number=A,Type=Integer,Description="Number of alternate observations on the reverse strand">
-##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
-##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
-##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RPL,Number=A,Type=Float,Description="Reads Placed Left: number of reads supporting the alternate balanced to the left (5') of the alternate allele">
-##INFO=<ID=RPR,Number=A,Type=Float,Description="Reads Placed Right: number of reads supporting the alternate balanced to the right (3') of the alternate allele">
-##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio.  Ratio between depth in samples with each called alternate allele and those without.">
-##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
-##INFO=<ID=GTI,Number=1,Type=Integer,Description="Number of genotyping iterations required to reach convergence or bailout.">
-##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
-##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing.  Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
-##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
-##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
-##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
-##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
-##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
-##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
-##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
-##INFO=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum depth in gVCF output block.">
-##INFO=<ID=END,Number=1,Type=Integer,Description="Last position (inclusive) in gVCF output record.">
-##INFO=<ID=technology.ILLUMINA,Number=A,Type=Float,Description="Fraction of observations supporting the alternate observed in reads from ILLUMINA">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
-##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Number of observation for each allele">
-##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
-##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
-##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
-##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
-##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum depth in gVCF output block.">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	13-1941-6
-NC_002945.4	2898437	.	T	G	0.263449	.	AB=0;ABP=0;AC=0;AF=0;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=2.77259;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=0;QR=0;RO=0;RPL=2;RPP=7.35324;RPPR=0;RPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.ILLUMINA=1	GT:DP:AD:RO:QR:AO:QA:GL	0/0:2:0,2:0:0:2:0:0,-0.60206,-8.68589e-09
diff -r 4ebdeb4df6ca -r 04aded03ab74 tool-data/fasta_indexes.loc.sample
--- a/tool-data/fasta_indexes.loc.sample	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,29 +0,0 @@
-#This is a sample file distributed with Galaxy that enables tools
-#to use a directory of Samtools indexed sequences data files.  You will need
-#to create these data files and then create a fasta_indexes.loc file
-#similar to this one (store it in this directory) that points to
-#the directories in which those files are stored. The fasta_indexes.loc
-#file has this format (white space characters are TAB characters):
-#
-# <unique_build_id>	<dbkey>	<display_name>	<file_base_path>
-#
-#So, for example, if you had hg19 Canonical indexed stored in
-#
-# /depot/data2/galaxy/hg19/sam/,
-#
-#then the fasta_indexes.loc entry would look like this:
-#
-#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
-#
-#and your /depot/data2/galaxy/hg19/sam/ directory
-#would contain hg19canon.fa and hg19canon.fa.fai files.
-#
-#Your fasta_indexes.loc file should include an entry per line for
-#each index set you have stored.  The file in the path does actually
-#exist, but it should never be directly used. Instead, the name serves
-#as a prefix for the index file.  For example:
-#
-#hg18canon	hg18	Human (Homo sapiens): hg18 Canonical	/depot/data2/galaxy/hg18/sam/hg18canon.fa
-#hg18full	hg18	Human (Homo sapiens): hg18 Full	/depot/data2/galaxy/hg18/sam/hg18full.fa
-#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
-#hg19full	hg19	Human (Homo sapiens): hg19 Full	/depot/data2/galaxy/hg19/sam/hg19full.fa
diff -r 4ebdeb4df6ca -r 04aded03ab74 tool_data_table_conf.xml.sample
--- a/tool_data_table_conf.xml.sample	Wed Jun 16 15:09:13 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,8 +0,0 @@
-<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
-<tables>
-    <!-- Location of SAMTools indexes for FASTA files -->
-    <table name="fasta_indexes" comment_char="#">
-        <columns>value, dbkey, name, path</columns>
-        <file path="tool-data/fasta_indexes.loc" />
-    </table>
-</tables>