Mercurial > repos > idot > fastx_toolkit2
diff fastx_trimmer_from_end.xml @ 0:78a7d28f2a15 draft
Uploaded
| author | idot |
|---|---|
| date | Wed, 10 Jul 2013 06:13:48 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_trimmer_from_end.xml Wed Jul 10 06:13:48 2013 -0400 @@ -0,0 +1,81 @@ +<tool id="cshl_fastx_end_trimmer" name="Trim End"> + <description>of sequences</description> + <command> +cat '$input' | +fastx_trimmer +#if $input.ext == "fastqsanger": + -Q 33 +#elif $input.ext == "fastq": + -Q 64 +#end if + -v -t $trimnum -m $minlen -o '$output' +</command> + <inputs> + <param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" /> + + <param name="trimnum" size="4" type="integer" value="5"> + <label>Number of nucleotides to be trimmed</label> + <help>This will trim from the end of the sequences</help> + </param> + + <param name="minlen" size="4" type="integer" value="10"> + <label>Minimum sequence length</label> + <help>Sequences shorter than this length will be discarded</help> + </param> + </inputs> + + <tests> + <test> + <param name="input" value="fastx_trimmer_from_end1.fasta" /> + <param name="trimnum" value="2"/> + <param name="minlen" value="16"/> + <output name="output" file="fastx_trimmer_from_end1.out" /> + </test> + </tests> + + <outputs> + <data format="input" name="output" metadata_source="input" + /> + </outputs> + <help> +**What it does** + +This tool trims (cut nucleotides from) sequences in a FASTQ/FASTA file from the 3' end. + +.. class:: infomark + +When trimming a FASTQ file, the quality scores will be trimmed appropriately (to the same length of the corresponding sequence). + +-------- + +**Example** + +Input Fasta file:: + + >1-1 + TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC + >2-1 + CAGCGAGGCTTTAATGCCATT + + +Trimming 5 nucleotides from the end, and discarding sequences shorter than 10 , we get the following FASTA file:: + + >1-1 + TATGGTCAGAAACCATATGCAGAGCCTGTAG + >2-1 + CAGCGAGGCTTTAATG + +Trimming 10 nucleotides from the end, and discarding sequences shorter than 15 , we get the following FASTA file:: + + >1-1 + TATGGTCAGAAACCATATGCAGAGCC + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + +</help> +</tool> +<!-- FASTX-Trimmer-End is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
