Mercurial > repos > iuc > amas_replicate
diff macros.xml @ 0:24431ccf6352 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/amas commit 158ec0e635067d354c425baf14b95cb616fd93c4
| author | iuc |
|---|---|
| date | Tue, 02 Dec 2025 09:26:59 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue Dec 02 09:26:59 2025 +0000 @@ -0,0 +1,173 @@ +<macros> + <token name="@TOOL_VERSION@">1.0</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">25.0</token> + + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">amas</requirement> + </requirements> + </xml> + + <xml name="version_command"> + <version_command>python -c "import amas; print(amas.__version__)"</version_command> + </xml> + + <token name="@SNIFF_INPUT_FORMAT@"><![CDATA[ + #set $in_format = $input_files[0].ext + #if $in_format == 'nex' + #set $in_format = 'nexus' + #end if + ]]></token> + + <token name="@CHECK_INTERLEAVED@"><![CDATA[ + ## Check if inputs are interleaved + IN_FORMAT=\$(python '$__tool_directory__/check_interleaved.py' + #for $f in $input_files + '${f}' + #end for + --format '${in_format}') && + ]]></token> + + <token name="@SYMLINK_INPUTS@"><![CDATA[ + ## Create symlinks with original filename for consistent tests + #for $f in $input_files + #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) + ln -s '${f}' '${safename_input}'; + #end for + ]]></token> + + <token name="@INPUT_FILENAMES@"><![CDATA[ + #for $f in $input_files + #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) + '${safename_input}' + #end for + ]]></token> + + <xml name="output_format" token_name="out_format" token_label="Format of the output file"> + <param name="out_format" type="select" label="@LABEL@"> + <option value="fasta">fasta</option> + <option value="phylip">phylip (sequential)</option> + <option value="phylip-int">phylip (interleaved)</option> + <option value="nexus">nexus (sequential)</option> + <option value="nexus-int">nexus (interleaved)</option> + </param> + </xml> + + <xml name="data_type"> + <param name="data_type" type="select" label="Data type"> + <option value="aa">Protein alignments</option> + <option value="dna">Nucleotide alignments</option> + </param> + </xml> + + <xml name="check_align"> + <param argument="--check-align" type="boolean" label="Check if input sequences are aligned" checked="false" truevalue="--check-align" falsevalue="" /> + </xml> + + <!-- Galaxy doesn't currently detect whether PHYLIP or NEXUS format is interleaved/sequential; if implemented update here and assoc in subcommands --> + <xml name="collection_outputs" token_name="alignments" token_label="alignment files"> + <collection name="@NAME@_fasta" type="list" label="${tool.name} on ${on_string}: fasta"> + <discover_datasets pattern="(?P<name>.+-out\..+)" format="fasta" /> + <filter>out_format == "fasta"</filter> + </collection> + + <collection name="@NAME@_phylip" type="list" label="${tool.name} on ${on_string}: phylip"> + <discover_datasets pattern="(?P<name>.+-out\..+)" format="phylip" /> + <filter>out_format == "phylip" or out_format == "phylip-int"</filter> + </collection> + + <collection name="@NAME@_nexus" type="list" label="${tool.name} on ${on_string}: nexus"> + <discover_datasets pattern="(?P<name>.+-out\..+)" format="nex" /> + <filter>out_format == "nexus" or out_format == "nexus-int"</filter> + </collection> + </xml> + + <token name="@PARTITIONS_HELP@"><![CDATA[ + **What is a partitions file?** + + The partitions file maps each gene/locus to its position in the concatenated alignment. This is essential for downstream phylogenetic analyses (e.g., RAxML, IQ-TREE) that can apply different evolutionary models to different partitions. + + **Example:** + + If you concatenate three genes:: + + gene1.fasta (500 bp) + gene2.fasta (700 bp) + gene3.fasta (400 bp) + + The partitions file (unspecified format) will contain:: + + gene1 = 1-500 + gene2 = 501-1200 + gene3 = 1201-1600 + + **Partition formats:** + + - **Unspecified** + + :: + + gene1 = 1-500 + gene2 = 501-1200 + + - **RAxML** + + :: + + DNA, gene1 = 1-500 + DNA, gene2 = 501-1200 + + - **NEXUS** + + :: + + #NEXUS + + Begin sets; + charset gene1 = 1-500; + charset gene2 = 501-1200; + End; + ]]></token> + + <token name="@AMAS_SHARED_HELP@"><![CDATA[ + **Sequential vs Interleaved Phylip Format** + + - **Sequential**: Each complete sequence is written in order, one after another. Easier for programmatic parsing. + + :: + + 4 60 + Seq1 ATGCATGCATATGCATGCATATGCATGCAT... + Seq2 ATGCATGCATATGCATGCATATGCATGCAT... + Seq3 ATGCATGCATATGCATGCATATGCATGCAT... + Seq4 ATGCATGCATATGCATGCATATGCATGCAT... + + - **Interleaved**: Sequences are written in aligned blocks, making it easier to visually compare positions across sequences. + + :: + + 4 60 + Seq1 ATGCATGCATATGCATGCAT + Seq2 ATGCATGCATATGCATGCAT + Seq3 ATGCATGCATATGCATGCAT + Seq4 ATGCATGCATATGCATGCAT + + Seq1 ATGCATGCAT... + Seq2 ATGCATGCAT... + Seq3 ATGCATGCAT... + Seq4 ATGCATGCAT... + + **About AMAS** + + AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. + + Source code and manual: https://github.com/marekborowiec/AMAS + ]]></token> + + <xml name="citations"> + <citations> + <citation type="doi">10.7717/peerj.1660</citation> + </citations> + </xml> +</macros> \ No newline at end of file