Mercurial > repos > iuc > bbtools_bbmap

changeset 0:07a6e49c7d74 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bbtools commit 3682ff4e2e47438e975fc04f92469eca7814fcfa"
author iuc
date Mon, 04 Oct 2021 12:14:47 +0000
parents
children 17ad142b56e6
files bbmap.xml macros.xml test-data/13-1941-6_S4_L001_R1_600000.fastq.gz test-data/13-1941-6_S4_L001_R2_600000.fastq.gz test-data/NC_002945v4.fasta test-data/fasta_indexes.loc test-data/output1.bam test-data/output2.bam test-data/output3.bam tool-data/fasta_indexes.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test
diffstat 12 files changed, 365 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bbmap.xml	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,157 @@
+<tool id="bbtools_bbmap" name="BBTools: BBMap" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>short-read aligner</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command detect_errors="exit_code"><![CDATA[
+#import os
+#import re
+
+#if str($ref_source_cond.ref_source) == 'cached'
+    #set ref = str($ref_source_cond.reference.fields.path)
+#else:
+    #set ref = $ref_source_cond.reference
+#end if
+
+#if str($input_type_cond.input_type) in ['single', 'pair']:
+    #set read1 = $input_type_cond.read1
+    #set read1_identifier = re.sub('[^\s\w\-]', '_', str($read1.element_identifier))
+    ## bbmap uses the file extension to determine the input format.
+    #set ext = $read1_identifier + '.fastq'
+    #if $read1.ext.endswith('.gz'):
+        #set ext = $ext + '.gz'
+    #end if
+    #set read1_file = $read1_identifier + $ext
+    ln -s '${read1}' '${read1_file}' &&
+    #if str($input_type_cond.input_type) == 'pair':
+        #set read2 = $input_type_cond.read2
+        #set read2_identifier = re.sub('[^\s\w\-]', '_', str($read2.element_identifier))
+        #set read2_file = $read2_identifier + $ext
+        ln -s '${read2}' '${read2_file}' &&
+    #end if
+#else:
+    #set read1 = $input_type_cond.reads_collection['forward']
+    #set read1_identifier = re.sub('[^\s\w\-]', '_', str($read1.name))
+    ## bbmap uses the file extension to determine the input format.
+    #set ext = $read1_identifier + '.fastq'
+    #if $read1.ext.endswith('.gz'):
+        #set ext = $ext + '.gz'
+    #end if
+    #set read1_file = $read1_identifier + $ext
+    ln -s '${read1}' '${read1_file}' &&
+    #set read2 = $input_type_cond.reads_collection['reverse']
+    #set read2_identifier = re.sub('[^\s\w\-]', '_', str($read2.name))
+    #set read2_file = $read2_identifier + $ext
+    ln -s '${read2}' '${read2_file}' &&
+#end if
+
+bbmap.sh t=\${GALAXY_SLOTS:-4} ref='${ref}'
+#if str($input_type_cond.input_type) == 'single':
+    in='${read1_file}'
+#else:
+    in1='${read1_file}' in2='${read2_file}'
+#end if
+#if str($output_sort) == 'coordinate':
+    out='mapped.bam'; samtools sort -@\${GALAXY_SLOTS:-4} -T "\${TMPDIR:-.}" -O bam -o '$output' 'mapped.bam'
+#elif str($output_sort) == 'name':
+    out='mapped.bam'; samtools sort -n -@\${GALAXY_SLOTS:-4} -T '\${TMPDIR:-.}' -O bam -o '$output' 'mapped.bam'
+#else:
+    out='mapped.bam' && mv 'mapped.bam' '$output'
+#end if
+]]></command>
+    <inputs>
+        <conditional name="input_type_cond">
+            <param name="input_type" type="select" label="Choose the category of the files to be analyzed">
+                <option value="single" selected="true">Single dataset</option>
+                <option value="pair">Dataset pair</option>
+                <option value="paired">List of dataset pairs</option>
+            </param>
+            <when value="single">
+                <param name="read1" type="data" format="fastqsanger.gz,fastqsanger" label="Read1 fastq file"/>
+            </when>
+            <when value="pair">
+                <param name="read1" type="data" format="fastqsanger.gz,fastqsanger" label="Read1 fastq file"/>
+                <param name="read2" type="data" format="fastqsanger.gz,fastqsanger" label="Read2 fastq file"/>
+            </when>
+            <when value="paired">
+                <param name="reads_collection" type="data_collection" format="fastqsanger,fastqsanger.gz" collection_type="paired" label="Collection of fastqsanger paired read files"/>
+            </when>
+        </conditional>
+        <expand macro="reference_source_cond"/>
+        <param name="output_sort" type="select" label="BAM sorting mode" help="The 'Not sorted' option can significantly extend the run time of the tool (it runs using a single thread).">
+            <option value="coordinate" selected="True">Sort by chromosomal coordinates</option>
+            <option value="name">Sort by read names</option>
+            <option value="unsorted">Not sorted (sorted as input)</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data format="bam" name="output" label="${tool.name} on ${on_string} (mapped reads in BAM format)">
+            <expand macro="dbKeyActionsBBMap"/>
+            <change_format>
+                <when input="output_sort" value="name" format="qname_sorted.bam" />
+                <when input="output_sort" value="unsorted" format="qname_input_sorted.bam" />
+            </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <!-- Single file, cached reference, output coordinate sorted -->
+        <test expect_num_outputs="1">
+            <param name="input_type" value="single"/>
+            <param name="read1" value="13-1941-6_S4_L001_R1_600000.fastq.gz"/>
+            <output name="output" file="output1.bam" ftype="bam" lines_diff="4">
+                <metadata name="dbkey" value="89" />
+            </output>
+        </test>
+        <!-- Paired reads in separate datasets, cached reference, output name sorted -->
+        <test expect_num_outputs="1">
+            <param name="input_type" value="pair"/>
+            <param name="read1" value="13-1941-6_S4_L001_R1_600000.fastq.gz"/>
+            <param name="read2" value="13-1941-6_S4_L001_R2_600000.fastq.gz"/>
+            <param name="output_sort" value="name"/>
+            <output name="output" file="output2.bam" ftype="qname_sorted.bam" lines_diff="4">
+                <metadata name="dbkey" value="89" />
+            </output>
+        </test>
+        <!-- Collection of Paired reads, history reference, output unsorted -->
+        <test expect_num_outputs="1">
+            <param name="input_type" value="paired"/>
+            <param name="reads_collection">
+                <collection type="paired">
+                    <element name="forward" value="13-1941-6_S4_L001_R1_600000.fastq.gz"/>
+                    <element name="reverse" value="13-1941-6_S4_L001_R2_600000.fastq.gz"/>
+                </collection>
+            </param>
+            <param name="ref_source" value="history"/>
+            <param name="reference" value="NC_002945v4.fasta" dbkey="89" ftype="fasta"/>
+            <param name="output_sort" value="unsorted"/>
+            <output name="output" file="output3.bam" ftype="qname_input_sorted.bam" lines_diff="4">
+                <metadata name="dbkey" value="89" />
+            </output>
+        </test>
+    </tests>
+    <help>
+**What it does**
+
+BBMap is a splice-aware global aligner for DNA and RNA sequencing reads.  It is fast and extremely accurate, particularly
+with highly mutated genomes or reads with long indels, even whole-gene deletions over 100kbp long. It has no upper limit
+to genome size or number of contigs and has been successfully used for mapping to an 85 gigabase soil metagenome with over
+200 million contigs. the indexing phase is very fast compared to other aligners.
+
+BBMap can output many different statistics files; an empirical read quality histogram, insert-size distribution, and genome
+coverage with or without generating a sam file.  It is useful in quality control of libraries and sequencing runs or
+evaluating new sequencing platforms.
+
+**Options**
+
+  *Bam sorting mode* - the generated bam files can be sorted according to three criteria: coordinates, names and input order.
+
+    * Sort by chromosomal coordinates - the file is sorted by coordinates (i.e., the reads from the beginning of the first
+      chromosome are first in the file.
+    * Sort by read names - the file is sorted by the reference ID (i.e., the QNAME field).
+    * Not sorted (sorted as input) - the file is sorted in the order of the reads in the input file.
+
+    </help>
+    <expand macro="citations"/>
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,63 @@
+<macros>
+    <token name="@WRAPPER_VERSION@">1.0.0</token>
+    <token name="@VERSION_SUFFIX@">1.0.0</token>
+    <token name="@PROFILE@">20.09</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="38.92">bbmap</requirement>
+        </requirements>
+    </xml>
+    <macro name="dbKeyActionsBBMap">
+        <expand macro="dbKeyActions">
+            <option type="from_data_table" name="fasta_indexes" column="1" offset="0">
+                <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
+                <filter type="param_value" ref="ref_source_cond.reference" column="1"/>
+            </option>
+        </expand>
+    </macro>
+    <macro name="dbKeyActions">
+        <actions>
+            <conditional name="ref_source_cond.ref_source">
+                <when value="cached">
+                    <action type="metadata" name="dbkey">
+                        <yield/>
+                    </action>
+                </when>
+                <when value="history">
+                    <action type="metadata" name="dbkey">
+                        <option type="from_param" name="ref_source_cond.reference" param_attribute="dbkey"/>
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </macro>
+    <macro name="reference_source_cond">
+        <conditional name="ref_source_cond">
+            <param name="ref_source" type="select" label="Select reference genome source; a cached reference or one from the history">
+                <option value="cached" selected="True">Use a cached reference</option>
+                <option value="history">Use a reference from the history</option>
+            </param>
+            <when value="cached">
+                <param name="reference" type="select" label="Using reference genome">
+                    <options from_data_table="fasta_indexes">
+                        <filter type="sort_by" column="2"/>
+                        <validator type="no_options" message="A built-in reference genome is not available"/>
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="reference" type="data" format="fasta" label="Using reference genome">
+                    <validator type="no_options" message="The current history does not include a fasta dataset"/>
+                </param>
+            </when>
+        </conditional>
+    </macro>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">
+                https://doi.org/10.1371/journal.pone.0185056
+            </citation>
+        </citations>
+    </xml>
+</macros>
+
Binary file test-data/13-1941-6_S4_L001_R1_600000.fastq.gz has changed
Binary file test-data/13-1941-6_S4_L001_R2_600000.fastq.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_002945v4.fasta	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,101 @@
+>NC_002945.4 Mycobacterium bovis AF2122/97 genome assembly, chromosome: Mycobacterium_bovis_AF2122/97
+TTGACCGATGACCCCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGAACTTAACGGCGACC
+CTAAGGTTGACGACGGACCCAGCAGTGATGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTG
+GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTATCCGTGCCGAGCAGCTTTGTC
+CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACCGACGCTCTCAGCCGCCGACTCGGACATCAGA
+TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGCCGACGACACTACCGTGCCGCCTTCCGA
+AAATCCTGCTACCACATCGCCAGACACCACAACCGACAACGACGAGATTGATGACAGCGCTGCGGCACGG
+GGCGATAACCAGCACAGTTGGCCAAGTTACTTCACCGAGCGCCCGCGCAATACCGATTCCGCTACCGCTG
+GCGTAACCAGCCTTAACCGTCGCTACACCTTTGATACGTTCGTTATCGGCGCCTCCAACCGGTTCGCGCA
+CGCCGCCGCCTTGGCGATCGCAGAAGCACCCGCCCGCGCTTACAACCCCCTGTTCATCTGGGGCGAGTCC
+GGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCCCAACGGTTGTTCCCGGGAATGCGGG
+TCAAATATGTCTCCACCGAGGAATTCACCAACGACTTCATTAACTCGCTCCGCGATGACCGCAAGGTCGC
+ATTCAAACGCAGCTACCGCGACGTAGACGTGCTGTTGGTCGACGACATCCAATTCATTGAAGGCAAAGAG
+GGTATTCAAGAGGAGTTCTTCCACACCTTCAACACCTTGCACAATGCCAACAAGCAAATCGTCATCTCAT
+CTGACCGCCCACCCAAGCAGCTCGCCACCCTCGAGGACCGGCTGAGAACCCGCTTTGAGTGGGGGCTGAT
+CACTGACGTACAACCACCCGAGCTGGAGACCCGCATCGCCATCTTGCGCAAGAAAGCACAGATGGAACGG
+CTCGCGATCCCCGACGATGTCCTCGAACTCATCGCCAGCAGTATCGAACGCAATATCCGTGAACTCGAGG
+GCGCGCTGATCCGGGTCACCGCGTTCGCCTCATTGAACAAAACACCAATCGACAAAGCGCTGGCCGAGAT
+TGTGCTTCGCGATCTGATCGCCGACGCCAACACCATGCAAATCAGCGCGGCGACGATCATGGCTGCCACC
+GCCGAATACTTCGACACTACCGTCGAAGAGCTTCGCGGGCCCGGCAAGACCCGAGCACTGGCCCAGTCAC
+GACAGATTGCGATGTACCTGTGTCGTGAGCTCACCGATCTTTCGTTGCCCAAAATCGGCCAAGCGTTCGG
+CCGTGATCACACAACCGTCATGTACGCCCAACGCAAGATCCTGTCCGAGATGGCCGAGCGCCGTGAGGTC
+TTTGATCACGTCAAAGAACTCACCACTCGCATCCGTCAGCGCTCCAAGCGCTAGCACGGCGTGTTCTTCC
+GACAACGTTCTTAAAAAAACTTCTCTCTCCCAGGTCACACCAGTCACAGAGATTGGCTGTGAGTGTCGCT
+GTGCACAAACCGCGCACAGACTCATACAGTCCCGGCGGTTCCGTTCACAACCCACGCCTCATCCCCACCG
+ACCCAACACACACCCCACAGTCATCGCCACCGTCATCCACAACTCCGACCGACGTCGACCTGCACCAAGA
+CCAGACTGTCCCCAAACTGCACACCCTCTAATACTGTTACCGAGATTTCTTCGTCGTTTGTTCTTGGAAA
+GACAGCGCTGGGGATCGTTCGCTGGATACCACCCGCATAACTGGCTCGTCGCGGTGGGTCAGAGGTCAAT
+GATGAACTTTCAAGTTGACGTGAGAAGCTCTACGGTTGTTGTTCGACTGCTGTTGCGGCCGTCGTGGCGG
+GTCACGCGTCATGGGCGTTCGTCGTTGGCAGTCCCCACGCTAGCGGGGCGCTAGCCACGGGATCGAACTC
+ATCGTGAGGTGAAAGGGCGCAATGGACGCGGCTACGACAAGAGTTGGCCTCACCGACTTGACGTTTCGTT
+TGCTACGAGAGTCTTTCGCCGATGCGGTGTCGTGGGTGGCTAAAAATCTGCCAGCCAGGCCCGCGGTGCC
+GGTGCTCTCCGGCGTGTTGTTGACCGGCTCGGACAACGGTCTGACGATTTCCGGATTCGACTACGAGGTT
+TCCGCCGAGGCCCAGGTTGGCGCTGAAATTGTTTCTCCTGGAAGCGTTTTAGTTTCTGGCCGATTGTTGT
+CCGATATTACCCGGGCGTTGCCTAACAAGCCCGTAGGCGTTCATGTCGAAGGTAACCGGGTCGCATTGAC
+CTGCGGTAACGCCAGGTTTTCGCTACCGACGATGCCAGTCGAGGATTATCCGACGCTGCCGACGCTGCCG
+GAAGAGACCGGATTGTTGCCTGCGGAATTATTCGCCGAGGCAATCAGTCAGGTCGCTATCGCCGCCGGCC
+GGGACGACACGCTGCCTATGTTGACCGGCATCCGGGTCGAAATCCTCGGTGAGACGGTGGTTTTGGCCGC
+TACCGACAGGTTTCGCCTGGCTGTTCGAGAACTGAAGTGGTCGGCGTCGTCGCCAGATATCGAAGCGGCT
+GTGCTGGTCCCGGCCAAGACGCTGGCCGAGGCCGCCAAAGCGGGCATCGGCGGCTCTGACGTTCGTTTGT
+CGTTGGGTACTGGGCCGGGGGTGGGCAAGGATGGCCTGCTCGGTATCAGTGGGAACGGCAAGCGCAGCAC
+CACGCGACTTCTTGATGCCGAGTTCCCGAAGTTTCGGCAGTTGCTACCAACCGAACACACCGCGGTGGCC
+ACCATGGACGTGGCCGAGTTGATCGAAGCGATCAAGCTGGTTGCGTTGGTAGCTGATCGGGGCGCGCAGG
+TGCGCATGGAGTTCGCTGATGGCAGCGTGCGGCTTTCTGCGGGTGCCGATGATGTTGGACGAGCCGAGGA
+AGATCTTGTTGTTGACTATGCCGGTGAACCATTGACGATTGCGTTTAACCCAACCTATCTAACGGACGGT
+TTGAGTTCGTTGCGCTCGGAGCGAGTGTCTTTCGGGTTTACGACTGCGGGTAAGCCTGCCTTGCTACGTC
+CGGTGTCCGGGGACGATCGCCCTGTGGCGGGTCTGAATGGCAACGGTCCGTTCCCGGCGGTGTCGACGGA
+CTATGTCTATCTGTTGATGCCGGTTCGGTTGCCGGGCTGAGCACTTGGCGCCCGGGTAGGTGTACGTCCG
+TCATTTGGGGCTGCGTGACTTCCGGTCCTGGGCATGTGTAGATCTGGAATTGCATCCAGGGCGGACGGTT
+TTTGTTGGGCCTAACGGTTATGGTAAGACGAATCTTATTGAGGCACTGTGGTATTCGACGACGTTAGGTT
+CGCACCGCGTTAGCGCCGATTTGCCGTTGATCCGGGTAGGTACCGATCGTGCGGTGATCTCCACGATCGT
+GGTGAACGACGGTAGAGAATGTGCCGTCGACCTCGAGATCGCCACGGGGCGAGTCAACAAAGCGCGATTG
+AATCGATCATCGGTCCGAAGTACACGTGATGTGGTCGGAGTGCTTCGAGCTGTGTTGTTTGCCCCTGAGG
+ATCTGGGGTTGGTTCGTGGGGATCCCGCTGACCGGCGGCGCTATCTGGATGATCTGGCGATCGTGCGTAG
+GCCTGCGATCGCTGCGGTACGAGCCGAATATGAGAGGGTGGTGCGCCAGCGGACGGCGTTATTGAAGTCC
+GTACCTGGAGCACGGTATCGGGGTGACCGGGGTGTGTTTGACACTCTTGAGGTATGGGACAGTCGTTTGG
+CGGAGCACGGGGCTGAACTGGTGGCCGCCCGCATCGATTTGGTCAACCAGTTGGCACCGGAAGTGAAGAA
+GGCATACCAGCTGTTGGCGCCGGAATCGCGATCGGCGTCTATCGGTTATCGGGCCAGCATGGATGTAACC
+GGTCCCAGCGAGCAGTCAGATACCGATCGGCAATTGTTAGCAGCTCGGCTGTTGGCGGCGCTGGCGGCCC
+GTCGGGATGCCGAACTCGAGCGTGGGGTTTGTCTAGTTGGTCCGCACCGTGACGACCTAATACTGCGACT
+AGGCGATCAACCCGCGAAAGGATTTGCTAGCCATGGGGAGGCGTGGTCGTTGGCGGTGGCACTGCGGTTG
+GCGGCCTATCAACTGTTACGCGTTGATGGTGGTGAGCCGGTGTTGTTGCTCGACGACGTGTTCGCCGAAC
+TGGATGTCATGCGCCGTCGAGCGTTGGCGACGGCGGCCGAGTCCGCCGAACAGGTGTTGGTGACTGCCGC
+GGTGCTCGAGGATATTCCCGCCGGCTGGGACGCCAGGCGGGTGCACATCGATGTGCGTGCCGATGACACC
+GGATCGATGTCGGTGGTTCTGCCATGACGGGTTCTGTTGACCGGCCCGACCAGAATCGCGGTGAGCGATT
+AATGAAGTCACCAGGGTTGGATTTGGTCAGGCGCACCCTGGACGAAGCTCGTGCTGCTGCCCGCGCGCGC
+GGACAAGACGCCGGTCGAGGGCGGGTCGCTTCCGTTGCGTCGGGTCGGGTGGCCGGACGGCGACGAAGCT
+GGTCGGGTCCGGGGCCCGACATTCGTGATCCACAACCGCTGGGTAAGGCCGCTCGTGAGCTGGCAAAGAA
+ACGCGGCTGGTCGGTGCGGGTCGCCGAGGGTATGGTGCTCGGCCAGTGGTCTGCGGTGGTCGGCCACCAG
+ATCGCCGAACATGCACGCCCGACTGCGCTAAACGACGGGGTGTTGAGCGTGATTGCGGAGTCGACGGCGT
+GGGCGACGCAGTTGAGGATCATGCAGGCCCAGCTTCTGGCCAAGATCGCCGCAGCGGTTGGCAACGATGT
+GGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCATCGTGGCGCAAGGGGCCTCGCCATATTGCCGGT
+AGGGGTCCGCGCGACACCTACGGATAACACGTCGATCGGCCCAGAACAAGGCGCTCCGGTCCCGGCCTGA
+GAGCCTCGAGGACGAAGCGGATCCGTATGCCGGACGTCGGGACGCACCAGGAAGAAAGATGTCCGACGCA
+CGGCGCGGTTAGATGGGTAAAAACGAGGCCAGAAGATCGGCCCTGGCGCCCGATCACGGTACAGTGGTGT
+GCGACCCCCTGCGGCGACTCAACCGCATGCACGCAACCCCTGAGGAGAGTATTCGGATCGTGGCTGCCCA
+GAAAAAGAAGGCCCAAGACGAATACGGCGCTGCGTCTATCACCATTCTCGAAGGGCTGGAGGCCGTCCGC
+AAACGTCCCGGCATGTACATTGGCTCGACCGGTGAGCGCGGTTTACACCATCTCATTTGGGAGGTGGTCG
+ACAACGCGGTCGACGAGGCGATGGCCGGTTATGCAACCACAGTGAACGTAGTGCTGCTTGAGGATGGCGG
+TGTCGAGGTCGCCGACGACGGCCGCGGCATTCCGGTCGCCACCCACGCCTCCGGCATACCGACCGTCGAC
+GTGGTGATGACACAACTACATGCCGGCGGCAAGTTCGACTCGGACGCGTATGCGATATCTGGTGGTCTGC
+ACGGCGTCGGCGTGTCGGTGGTTAACGCGCTATCCACCCGGCTCGAAGTCGAGATCAAGCGCGACGGGTA
+CGAGTGGTCTCAGGTTTATGAGAAGTCGGAACCCCTGGGCCTCAAGCAAGGGGCGCCGACCAAGAAGACG
+GGGTCAACGGTACGGTTCTGGGCCGACCCCGCTGTTTTCGAAACCACGGAATACGACTTCGAAACCGTCG
+CCCGCCGGCTGCAAGAGATGGCGTTCCTCAACAAGGGGCTGACCATCAACCTGACCGACGAGAGGGTGAC
+CCAAGACGAGGTCGTCGACGAAGTGGTCAGCGACGTCGCCGAGGCGCCGAAGTCGGCAAGTGAACGCGCA
+GCCGAATCCACTGCACCGCACAAAGTTAAGAGCCGCACCTTTCACTATCCGGGTGGCCTGGTGGACTTCG
+TGAAACACATCAACCGCACCAAGAACGCGATTCATAGCAGCATCGTGGACTTTTCCGGCAAGGGCACCGG
+GCACGAGGTGGAGATCGCGATGCAATGGAACGCCGGGTATTCGGAGTCGGTGCACACCTTCGCCAACACC
+ATCAACACCCACGAGGGCGGCACCCACGAAGAGGGCTTCCGCAGCGCGCTGACGTCGGTGGTGAACAAGT
+ACGCCAAGGACCGCAAGCTACTGAAGGACAAGGACCCCAACCTCACCGGTGACGATATCCGGGAAGGCCT
+GGCCGCTGTGATCTCGGTGAAGGTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGGCAAC
+ACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAATGAACAGCTGACCCACTGGTTTGAAGCCAACCCCA
+CCGACTCGAAAGTCGTTGTGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTATCGCGGCACGTAAGGCACG
+AGAGTTGGTGCGGCGTAAGAGCGCCACCGACATCGGTGGATTGCCCGGCAAGCTGGCCGATTGCCGTTCC
+ACGGATCCGCGCAAGTCCGAACTGTATGTCGTAGAAGGTGACTCGGCCGGCGGTTCTGCAAAAAGCGGTC
+GCGATTCGATGTTCCAGGCGATACTTCCGCTGCGCGGCAAGATCATCAATGTGGAGAAAGCGCGCATCGA
+CCGGGTGCTAAAGAACACCGAAGTTCAGGCGATCATCACGGCGCTGGGCACCGGGATCCACGACGAGTTC
+GATATCGGCAAGCTGCGCTACCACAAGATCGTGCTGATGGCCGACGCCGATGTTGACGGCCAACATATTT
+CCACGCTGTTGTTGACGTTGTTGTTCCGGTTCATGCGGCCGCTCATCGAGAACGGGCATGTGTTTTTGGC
+ACAACCGCCGCTGTACAAACTCAAGTGGCAGCGCAGTGACCCGGAATTCGCATACTCCGACCGCGAGCGC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_indexes.loc	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,1 @@
+89	89	Mycobacterium_AF2122	${__HERE__}/NC_002945v4.fasta
Binary file test-data/output1.bam has changed
Binary file test-data/output2.bam has changed
Binary file test-data/output3.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/fasta_indexes.loc.sample	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files.  You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+# <unique_build_id>	<dbkey>	<display_name>	<file_base_path>
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored.  The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file.  For example:
+#
+#hg18canon	hg18	Human (Homo sapiens): hg18 Canonical	/depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full	hg18	Human (Homo sapiens): hg18 Full	/depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full	hg19	Human (Homo sapiens): hg19 Full	/depot/data2/galaxy/hg19/sam/hg19full.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,8 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
+<tables>
+    <!-- Location of SAMTools indexes for FASTA files -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/fasta_indexes.loc" />
+    </table>
+</tables>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Mon Oct 04 12:14:47 2021 +0000
@@ -0,0 +1,6 @@
+<tables>
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/fasta_indexes.loc" />
+    </table>
+</tables>