comparison bcftools_consensus.xml @ 13:d6dc477167f8 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit 8ad854180e3be0934cdb1f0021886199a2edf9c3"

12:e522022137f6

<?xml version='1.0' encoding='utf-8'?>
<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@">
    <description>Create consensus sequence by applying VCF variants to a reference fasta file</description>
    <macros>
        <token name="@EXECUTABLE@">consensus</token>
        <import>macros.xml</import>
    </macros>

#if $section.select_haplotype:
  --haplotype '${section.select_haplotype}'
#end if
@SAMPLE@

#if $chain:
  --chain '$chain_file'
#end if

## Primary Input/Outputs

                <option value="2">2</option>
            </param>
        </section>
        <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" />
        <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" />
    </inputs>
    <outputs>
        <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/>
        <data name="chain_file" format="txt" label="${tool.name} on ${on_string}: chain">
            <filter>chain</filter>

                <assert_contents>
                    <has_text text=">consensus.vcf-2" />
                </assert_contents>
            </output>
        </test>
    </tests>
    <help><![CDATA[
=====================================
 bcftools @EXECUTABLE@ plugin
=====================================

13:d6dc477167f8

<?xml version='1.0' encoding='utf-8'?>
<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy1">
    <description>Create consensus sequence by applying VCF variants to a reference fasta file</description>
    <macros>
        <token name="@EXECUTABLE@">consensus</token>
        <import>macros.xml</import>
    </macros>

#if $section.select_haplotype:
  --haplotype '${section.select_haplotype}'
#end if
@SAMPLE@

#set $section = $sec_restrict
@INCLUDE@
@EXCLUDE@

#if $chain:
  --chain '$chain_file'
#end if

## Primary Input/Outputs

                <option value="2">2</option>
            </param>
        </section>
        <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" />
        <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" />
        <section name="sec_restrict" expanded="false" title="Restrict to">    
            <expand macro="macro_include" />
            <expand macro="macro_exclude" />
        </section>
    </inputs>
    <outputs>
        <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/>
        <data name="chain_file" format="txt" label="${tool.name} on ${on_string}: chain">
            <filter>chain</filter>

                <assert_contents>
                    <has_text text=">consensus.vcf-2" />
                </assert_contents>
            </output>
        </test>
        <test>
            <expand macro="test_using_reference" ref="consensus.fa" />
            <param name="input_file" ftype="vcf" value="consensus.vcf" />
            <section name="sec_restrict">
                <param name="include" value='TYPE="snp"' />
            </section>
            <output name="output_file">
                <assert_contents>
                    <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
                </assert_contents>
            </output>
        </test>
    </tests>
    <help><![CDATA[
=====================================
 bcftools @EXECUTABLE@ plugin
=====================================