# HG changeset patch
# User iuc
# Date 1420745151 18000
# Node ID 82aac94b06c36be7f63f8db73adf30c9a85340cb
# Parent  b8348686a0b9531178bdf7e44eb4a74fe16fa57f
Uploaded

diff -r b8348686a0b9 -r 82aac94b06c3 Bed12ToBed6.xml
--- a/Bed12ToBed6.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,28 +0,0 @@
-<tool id="bedtools_bed12tobed6" name="Convert from BED12 to BED6" version="@WRAPPER_VERSION@.0">
-    <description></description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-        bed12ToBed16
-        -i '$input'
-        &gt; '$output'
-    </command>
-    <inputs>
-        <param format="bed" name="input" type="data" label="Convert the following BED12 file to BED6"/>
-    </inputs>
-    <outputs>
-        <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED6)"/>
-    </outputs>
-    <help>
-
-**What it does**
-
-bed12ToBed6 is a convenience tool that converts BED features in BED12 (a.k.a. “blocked” BED features such as genes) to discrete BED6 features. For example, in the case of a gene with six exons, bed12ToBed6 would create six separate BED6 features (i.e., one for each exon).
-
-@REFERENCES@
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 BedToBam.xml
--- a/BedToBam.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,34 +0,0 @@
-<tool id="bedtools_bedtobam" name="Convert from BED to BAM" version="@WRAPPER_VERSION@.0">
-    <description></description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-        bedtools bedtobam
-        $ubam
-        $bed12
-        -mapq $mapq
-        -i '$input'
-        &gt; '$output'
-    </command>
-    <inputs>
-        <param format="bed" name="input" type="data" label="Convert the following BED file to BAM"/>
-        <param name="bed12" type="boolean" label="Indicate that the input BED file is in BED12 (a.k.a “blocked” BED) format" truevalue="-bed12" falsevalue="" checked="false" help="If Selected, bedToBam will convert blocked BED features (e.g., gene annotaions) into “spliced” BAM alignments by creating an appropriate CIGAR string.."/>
-        <param name="mapq" type="integer" label="Set a mapping quality (SAM MAPQ field) value for all BED entries" value="255" />
-        <param name="ubam" type="boolean" label="Write uncompressed BAM output." truevalue="-ubam" falsevalue="" checked="false"/>
-    </inputs>
-    <outputs>
-        <data format="bam" name="output" metadata_source="input" label="${input.name} (as BAM)"/>
-    </outputs>
-    <help>
-
-**What it does**
-
-bedToBam converts features in a feature file to BAM format. This is useful as an efficient means of storing large genome annotations in a compact, indexed format for visualization purposes.
-
-@REFERENCES@
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 annotateBed.xml
--- a/annotateBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/annotateBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,23 +6,28 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools annotate
-        -i $inputA
-        -files 
-        #for $bed in $names.beds:
-            $bed.input
-        #end for
+        -i "${inputA}"
+        #if $names.names_select == 'yes':
+            -files
+            #for $bed in $names.beds:
+                "${bed.input}"
+            #end for
 
-        #if $names.names_select == 'yes':
             -names
             #for $bed in $names.beds:
-                $bed.inputName
+                "${bed.inputName}"
             #end for
+        #else:
+            #set files = '" "'.join( [ str( $file ) for $file in $names.beds ] )
+            -files "${files}"
         #end if
         $strand
         $counts
         $both
-        &gt; $output
+        > "${output}"
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file" />
@@ -39,28 +44,36 @@
                 </repeat>
             </when>
             <when value="no">
-                <repeat name="beds" title="Add BED files" >
-                    <param name="input" format="bed" type="data" label="BED file" />
-                </repeat>
+                <param name="beds" format="bed" multiple="True" type="data" label="BED file" />
             </when>
         </conditional>
-        
         <expand macro="strand2" />
-        <param name="counts" type="boolean" checked="false" truevalue="-counts" falsevalue="" label="Report the count of features followed by the % coverage for each annotation file. Default is to report solely the fraction of -i covered by each file." />
-        <param name="both" type="boolean" checked="false" truevalue="-both" falsevalue="" label="Report the count of features followed by the % coverage for each annotation file. Default is to report solely the fraction of the input file covered by each file." />
+        <param name="counts" type="boolean" checked="false" truevalue="-counts" falsevalue=""
+            label="Report the count of features followed by the % coverage for each annotation file" 
+            help="Default is to report solely the fraction of -i covered by each file." />
+        <param name="both" type="boolean" checked="false" truevalue="-both" falsevalue=""
+            label="Report the count of features followed by the % coverage for each annotation file" 
+            help="Default is to report solely the fraction of the input file covered by each file." />
     </inputs>
-
     <outputs>
-        <data format="bed" name="output" label="" />
+        <data format="bed" name="output" />
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="annotateBed1.bed" ftype="bed" />
+            <param name="names_select" value="no" />
+            <param name="beds" value="annotateBed2.bed,annotateBed3.bed,annotateBed4.bed" />
+            <output name="output" file="annotateBed_result.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-    
+<![CDATA[
 **What it does**
 
 bedtools annotate, well, annotates one BED/VCF/GFF file with the coverage and number of overlaps observed from multiple other BED/VCF/GFF files. In this way, it allows one to ask to what degree one feature coincides with multiple other feature types with a single command.
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 bamToBed.xml
--- a/bamToBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/bamToBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,14 +6,17 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        bedtools bamtobed 
-        $option 
+<![CDATA[
+        bedtools bamtobed
+        $option
         $ed_score
-        -i '$input'
-        &gt; '$output'
-        #if str($tag):
-          -tag $tag
+        $split
+        #if $tag and str($tag).strip():
+          -tag "${tag}"
         #end if
+        -i "${input}"
+        > "${output}"
+]]>
     </command>
     <inputs>
         <param format="bam" name="input" type="data" label="Convert the following BAM file to BED"/>
@@ -22,15 +25,31 @@
             <option value="-bed12">Create a full, 12-column "blocked" BED file.</option>
             <option value="-bedpe">Create a paired-end, BEDPE format.</option>
         </param>
-        <param name="split" type="boolean" label="Report each portion of a split BAM alignment" truevalue="-split" falsevalue="" checked="false" help="(i.e., having an 'N' CIGAR operation) as a distinct BED intervals."/>
-        <param name="ed_score" type="boolean" label="Use alignment's edit-distance for BED score" truevalue="-ed" falsevalue="" checked="false"/>
-        <param name="tag" type="text" optional="true" label="Use other NUMERIC BAM alignment tag as the BED score"/>
+        <expand macro="split" />
+        <param name="ed_score" type="boolean" truevalue="-ed" falsevalue="" checked="false"
+            label="Use alignment's edit-distance for BED score" />
+        <param name="tag" type="text" optional="true" label="Use other NUMERIC BAM alignment tag as the BED score"
+            help="(-tag)"/>
     </inputs>
     <outputs>
         <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED)"/>
     </outputs>
-<help>
-
+    <tests>
+        <test>
+            <param name="input" value="srma_in3.bam" ftype="bam" />
+            <param name="option" value="" />
+            <param name="tag" value="" />
+            <output name="output" file="bamToBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="input" value="srma_in3.bam" ftype="bam" />
+            <param name="option" value="" />
+            <param name="tag" value="NM" />
+            <output name="output" file="bamToBed_result2.bed" ftype="bed" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
 **What it does**
 
 bedtools bamtobed is a conversion utility that converts sequence alignments in BAM format into BED, BED12, and/or BEDPE records.
@@ -49,7 +68,7 @@
 If creating a BEDPE output (see output formatting options), the BAM file should be sorted by query name.
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 bamToFastq.xml
--- a/bamToFastq.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,33 +0,0 @@
-<tool id="bedtools_bamtofastq" name="Convert from BAM to FastQ" version="@WRAPPER_VERSION@.0">
-    <description></description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-        bedtools bamtofastq 
-        $tags
-        $fq2
-        -i '$input'
-        -fq '$output'
-    </command>
-    <inputs>
-        <param format="bam" name="input" type="data" label="Convert the following BAM file to FASTQ"/>
-        <param name="tags" type="boolean" truevalue="-tags" falsevalue="" selected="False" label="Create FASTQ based on the mate info in the BAM R2 and Q2 tags."/>
-        <param name="fq2" type="boolean" truevalue="-fq2" falsevalue="" selected="False" label="ASTQ for second end. Used if BAM contains paired-end data. BAM should be sorted by query name if creating paired FASTQ with this option."/>
-    </inputs>
-    <outputs>
-        <data format="fastq" name="output" metadata_source="input" label="${input.name} (as FASTQ)"/>
-    </outputs>
-<help>
-
-**What it does**
-
-bedtools bamtofastq is a conversion utility for extracting FASTQ records from sequence alignments in BAM format.
-
-@REFERENCES@
-
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 bed12ToBed6.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bed12ToBed6.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,37 @@
+<tool id="bedtools_bed12tobed6" name="BED12 to BED6" version="@WRAPPER_VERSION@.0">
+    <description>converter</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+        bed12ToBed6
+        -i '$input'
+        > '$output'
+]]>
+    </command>
+    <inputs>
+        <param format="bed" name="input" type="data" label="Convert the following BED12 file to BED6"/>
+    </inputs>
+    <outputs>
+        <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED6)"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="bed12.bed" ftype="bed" />
+            <output name="output" file="bed12ToBed6_result1.bed" ftype="bed" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+bed12ToBed6 is a convenience tool that converts BED features in BED12 (a.k.a. “blocked” BED features such as genes) to discrete BED6 features. For example, in the case of a gene with six exons, bed12ToBed6 would create six separate BED6 features (i.e., one for each exon).
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 bedToBam.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bedToBam.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,47 @@
+<tool id="bedtools_bedtobam" name="Convert from BED to BAM" version="@WRAPPER_VERSION@.0">
+    <description></description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+        bedtools bedtobam
+        $bed12
+        -mapq $mapq
+        -g $genome
+        -i '$input'
+        > '$output'
+]]>
+    </command>
+    <inputs>
+        <param format="bed" name="input" type="data" label="Convert the following BED file to BAM"/>
+        <param name="bed12" type="boolean" truevalue="-bed12" falsevalue="" checked="false"
+            label="Indicate that the input BED file is in BED12 (a.k.a 'blocked' BED) format"
+            help="If Selected, bedToBam will convert blocked BED features (e.g., gene annotaions) into 'spliced' BAM alignments by creating an appropriate CIGAR string. (-bed12)"/>
+        <expand macro="genome" />
+        <param name="mapq" type="integer" value="255"
+            label="Set a mapping quality (SAM MAPQ field) value for all BED entries" help="(-mapq)"/>
+    </inputs>
+    <outputs>
+        <data format="bam" name="output" metadata_source="input" label="${input.name} (as BAM)"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="bedToBam1.bed" ftype="bed" />
+            <param name="genome" value="mm9_chr1.len" ftype="tabular" />
+            <output name="output" file="bedToBam_result.bam" lines_diff="2" ftype="bam" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+bedToBam converts features in a feature file to BAM format. This is useful as an efficient means of storing large genome annotations in a compact, indexed format for visualization purposes.
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 bedpeToBam.xml
--- a/bedpeToBam.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/bedpeToBam.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,24 +6,33 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools bedpetobam
-        $ubam
-        -mapq $mapq
-        -i '$input'
-        -g $genome
-        &gt; '$output'
+            -mapq $mapq
+            -i '$input'
+            -g $genome
+            > '$output'
+]]>
     </command>
     <inputs>
-        <param format="bed,gff,vcf" name="input" type="data" label="BED/VCF/GFF file"/>
+        <param name="input" format="bed,gff,vcf" type="data" label="BED/VCF/GFF file"/>
         <expand macro="genome" />
-        <param name="mapq" type="integer" label="Set a mapping quality (SAM MAPQ field) value for all BED entries" value="255" />
-        <param name="ubam" type="boolean" label="Write uncompressed BAM output." truevalue="-ubam" falsevalue="" checked="false"/>
+        <param name="mapq" type="integer" value="255"
+            label="Set a mapping quality (SAM MAPQ field) value for all BED entries"
+            help="(-mapq)" />
     </inputs>
     <outputs>
-        <data format="bam" name="output" metadata_source="input" label="${input.name} (as BAM)"/>
+        <data format="bam" name="output" metadata_source="input"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="bedpeToBamBed1.bed" ftype="bed" />
+            <param name="genome" value="mm9.len"/>
+            <output name="output" file="bedpeToBam_result1.bam" lines_diff="72" ftype="bam" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Converts feature records to BAM format.
@@ -33,6 +42,7 @@
 BED files must be at least BED4 to create BAM (needs name field).
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 closestBed.xml
--- a/closestBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/closestBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,37 +6,138 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
+        #set inputBs = ' '.join( [ str( $file ) for $file in $inputB ] )
+
         closestBed
         $strand
         $addition
+        #if $addition2.addition2_select:
+            -D $addition2.addition2_select
+            $addition2.iu
+            $addition2.id
+        #end if
+        $io
+        -mdb $mdb
         -t $ties
         -a $inputA
-        -b $inputB
-        &gt; $output
+        -b $inputBs
+        > $output
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="overlap intervals in this BED/VCF/GFF file?"/>
+        <param format="bed,gff,vcf,gff3" name="inputB" type="data" multiple="True" label="overlap intervals in this BED/VCF/GFF file?"/>
 
-        <param name="ties" type="select" label="How ties for closest feature should be handled" help="This occurs when two features in B have exactly the same overlap with a feature in A.">
+        <param name="ties" type="select"
+            label="How ties for closest feature should be handled"
+            help="This occurs when two features in B have exactly the same overlap with a feature in A.">
             <option value="all" selected="True">all - Report all ties (default)</option>
             <option value="first">first - Report the first tie that occurred in the B file</option>
             <option value="last">last - Report the last tie that occurred in the B file</option>
         </param>
 
-        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Force strandedness" help="That is, find the closest feature in B overlaps A on the same strand. By default, this is disabled" />
-        <param name="addition" type="boolean" checked="false" truevalue="-d" falsevalue="" label="In addition to the closest feature in B, report its distance to A as an extra column. The reported distance for overlapping features will be 0" />
+        <expand macro="strand2" />
+
+        <param name="addition" type="boolean" checked="false" truevalue="-d" falsevalue=""
+            label="In addition to the closest feature in B, report its distance to A as an extra column" 
+            help="The reported distance for overlapping features will be 0. (-d)" />
+
+        <conditional name="addition2">
+            <param name="addition2_select" type="select" optional="True"
+                label="Add additional columns to report distance to upstream feature. Distance defintion" 
+                help="Like -d, report the closest feature in B, and its distance to A as an extra column. However unlike -d, use negative distances to report upstream features. (-D)">
+                <option value="" selected="True">Do not report the distance et all.</option>
+                <option value="ref">Report distance with respect to the reference genome. B features with a lower (start, stop) are upstream. (-ref)</option>
+                <option value="a">Report distance with respect to A. When A is on the - strand, "upstream" means B has a higher (start,stop). (-a)</option>
+                <option value="b">Report distance with respect to B. When B is on the - strand, "upstream" means A has a higher (start,stop). (-b)</option>
+            </param>
+            <when value="ref">
+                <param name="iu" type="boolean" checked="false" truevalue="-iu" falsevalue=""
+                    label="Ignore features in B that are upstream of features in A" 
+                    help="This option requires -D and follows its orientation rules for determining what is 'upstream'. (-iu)" />
+
+                <param name="id" type="boolean" checked="false" truevalue="-id" falsevalue=""
+                    label="Ignore features in B that are downstream of features in A" 
+                    help="This option requires -D and follows its orientation rules for determining what is 'downstream'. (-id)" />
+            </when>
+            <when value="a">
+                <param name="iu" type="boolean" checked="false" truevalue="-iu" falsevalue=""
+                    label="Ignore features in B that are upstream of features in A" 
+                    help="This option requires -D and follows its orientation rules for determining what is 'upstream'. (-iu)" />
+
+                <param name="id" type="boolean" checked="false" truevalue="-id" falsevalue=""
+                    label="Ignore features in B that are downstream of features in A" 
+                    help="This option requires -D and follows its orientation rules for determining what is 'downstream'. (-id)" />
+            </when>
+            <when value="b">
+                <param name="iu" type="boolean" checked="false" truevalue="-iu" falsevalue=""
+                    label="Ignore features in B that are upstream of features in A" 
+                    help="This option requires -D and follows its orientation rules for determining what is 'upstream'. (-iu)" />
+
+                <param name="id" type="boolean" checked="false" truevalue="-id" falsevalue=""
+                    label="Ignore features in B that are downstream of features in A" 
+                    help="This option requires -D and follows its orientation rules for determining what is 'downstream'. (-id)" />
+            </when>
+        </conditional>
+
+        <param name="io" type="boolean" checked="false" truevalue="-io" falsevalue=""
+            label="Ignore features in B that overlap A" 
+            help="That is, we want close, yet not touching features only. (-io)" />
+
+        <param name="mdb" type="select" optional="True"
+            label="How multiple databases are resolved" 
+            help="(-mdb)">
+            <option value="each" selected="True">Report closest records for each database. (-each)</option>
+            <option value="all">Report closest records among all databases. (-all)</option>
+        </param>
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}"/>
+        <data format_source="inputA" name="output" metadata_source="inputA" label="Clostest region of ${inputA} in ${inputB}"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="closestBedA.bed" ftype="bed" />
+            <param name="inputB" value="closestBedB.bed" ftype="bed" />
+            <output name="output" file="closestBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="closestBed_a.bed" ftype="bed" />
+            <param name="inputB" value="closestBed_b1.bed,closestBed_b2.bed" ftype="bed" />
+            <param name="addition" value="True" />
+            <output name="output" file="closestBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="closestBed_a.bed" ftype="bed" />
+            <param name="inputB" value="closestBed_b1.bed,closestBed_b2.bed" ftype="bed" />
+            <param name="addition" value="True" />
+            <param name="mdb" value="all" />
+            <output name="output" file="closestBed_result3.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="closestBed_c.bed" ftype="bed" />
+            <param name="inputB" value="closestBed_d.bed" ftype="bed" />
+            <param name="addition2_select" value="ref" />
+            <output name="output" file="closestBed_result4.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="closestBed_c.bed" ftype="bed" />
+            <param name="inputB" value="closestBed_d.bed" ftype="bed" />
+            <param name="addition2_select" value="a" />
+            <output name="output" file="closestBed_result5.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Similar to intersectBed, closestBed searches for overlapping features in A and B. In the event that no feature in B overlaps the current feature in A, closestBed will report the closest (that is, least genomic distance from the start or end of A) feature in B. For example, one might want to find which is the closest gene to a significant GWAS polymorphism. Note that closestBed will report an overlapping feature as the closest—that is, it does not restrict to closest non-overlapping feature.
 
+.. image:: $PATH_TO_IMAGES/closest-glyph.png
+
+
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 clusterBed.xml
--- a/clusterBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/clusterBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,11 +6,13 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools cluster
         $strand
         -d $distance
         -i $inputA
-        &gt; $output
+        > $output
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
@@ -21,10 +23,16 @@
             help="Default is 0. That is, overlapping and/or book-ended features are clustered." />
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label=""/>
+        <data format_source="inputA" name="output" metadata_source="inputA"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="mergedBed1.bed" ftype="bed" />
+            <output name="output" file="clusterBed_result.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Similar to merge, cluster report each set of overlapping or “book-ended” features in an interval file. In contrast to merge, cluster does not flatten the cluster of intervals into a new meta-interval; instead, it assigns an unique cluster ID to each record in each cluster. This is useful for having fine control over how sets of overlapping intervals in a single interval file are combined.
@@ -36,6 +44,7 @@
 bedtools cluster requires that you presort your data by chromosome and then by start position (e.g., sort -k1,1 -k2,2n in.bed > in.sorted.bed for BED files).
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 complementBed.xml
--- a/complementBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/complementBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,20 +6,29 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         complementBed
-        -d $distance
-        -g genome
-        &gt; $output
+        -i "$input"
+        -g "$genome"
+        > "$output"
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
         <expand macro="genome" />
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label="Complemen of ${inputA.name}"/>
+        <data format_source="input" name="output" metadata_source="input" label="Complemen of ${input.name}"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="a.bed" ftype="bed" />
+            <param name="genome" value="mm9_chr1.len" />
+            <output name="output" file="complementBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools complement returns all intervals in a genome that are not covered by at least one interval in the input BED/GFF/VCF file.
@@ -27,6 +36,7 @@
 .. image:: $PATH_TO_IMAGES/complement-glyph.png
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 coverageBed.xml
--- a/coverageBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/coverageBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,6 +6,7 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         coverageBed
         #if $inputA.ext == "bam"
             -abam '$inputA'
@@ -18,30 +19,34 @@
         $split
         $strandedness
         | sort -k1,1 -k2,2n
-        &gt; '$output'
+        > '$output'
+]]>
     </command>
     <inputs>
-        <param format="bed,bam,gff,gg3,vcf" name="inputA" type="data" label="Count how many intervals in this BED/VCF/GFF/BAM file (source)">
-            <validator type="unspecified_build" />
-        </param>
-        <param format="bed,gff,gff3,vcf" name="inputB" type="data" label="overlap the intervals in this BED file (target)">
-            <validator type="unspecified_build" />
-        </param>
-        <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage"
-            help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data. (-split)" />
+        <param format="bed,bam,gff,gg3,vcf" name="inputA" type="data" label="Count how many intervals in this BED/VCF/GFF/BAM file (source)" />
+        <param format="bed,gff,gff3,vcf" name="inputB" type="data" label="overlap the intervals in this BED file (target)" />
+        <expand macro="split" />
         <param name="strandedness" type="boolean" label="Force strandedness" truevalue="-s" falsevalue="" checked="false" 
             help="That is, only features in A are only counted towards coverage in B if they are the same strand. (-s)"/>
-        <param name="d" type="boolean" checked="false" truevalue="-d" falsevalue="" label="Report the depth at each position in each B feature"
+        <param name="d" type="boolean" checked="false" truevalue="-d" falsevalue=""
+            label="Report the depth at each position in each B feature"
             help="Positions reported are one based.  Each position and depth follow the complete B feature. (-d)" />
-        <param name="hist" type="boolean" checked="false" truevalue="-hist" falsevalue="" label="Report a histogram of coverage for each feature in B as well as a summary histogram for all features in B"
+        <param name="hist" type="boolean" checked="false" truevalue="-hist" falsevalue=""
+            label="Report a histogram of coverage for each feature in B as well as a summary histogram for all features in B"
             help="Additonal columns after each feature in B: 1) depth 2) # bases at depth 3) size of B 4) % of B at depth. (-hist)" />
     </inputs>
-
     <outputs>
-        <data format="bed" name="output" metadata_source="inputB" label="count of overlaps in ${inputA.name} on ${inputB.name}"/>
+        <data format="bed" name="output" metadata_source="inputB" label="Count of overlaps in ${inputA.name} on ${inputB.name}"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="coverageBedA.bed" ftype="bed" />
+            <param name="genome" value="coverageBedB.bed" ftype="bed" />
+            <output name="output" file="coverageBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 coverageBed_ computes both the depth and breadth of coverage of features in 
@@ -58,7 +63,7 @@
 The output file will be comprised of each interval from your original target BED file, plus an additional column indicating the number of intervals in your source file that overlapped that target interval.
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 expandBed.xml
--- a/expandBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/expandBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,25 +6,40 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools expand
-        -c $cols
-        -i $inputA
-        &gt; $output
+        -c "${cols}"
+        -i "${input}"
+        > "${output}"
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <param name="cols" type="text" value="" label="Specify the column(s) (comma separated) that should be summarized" />
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
+        <expand macro="choose_columns" />
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label=""/>
+        <data name="output" metadata_source="input" format_source="input" />
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="expandBed1.bed" ftype="bed" />
+            <param name="cols" value="5"/>
+            <output name="output" file="expandBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="input" value="expandBed1.bed" ftype="bed" />
+            <param name="cols" value="4,5"/>
+            <output name="output" file="expandBed_result2.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Replicate lines in a file based on columns of comma-separated values.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 fisherBed.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fisherBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,54 @@
+<tool id="bedtools_fisher" name="FisherBed" version="@WRAPPER_VERSION@.0">
+    <description></description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+        bedtools fisher
+        $strand
+        $split
+        -a $inputA
+        -b $inputB
+        -f $overlap
+        -g $genome
+        $reciprocal
+        $m
+        > $output
+]]>
+    </command>
+    <inputs>
+        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
+        <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/>
+        <expand macro="genome" />
+        <expand macro="strand2" />
+        <expand macro="split" />
+        <expand macro="overlap" />
+        <expand macro="reciprocal" />
+        <param name="m" type="boolean" checked="False" truevalue="-m" falsevalue=""
+            label="Merge overlapping intervals before looking at overlap" help="(-m)" />
+    </inputs>
+    <outputs>
+        <data name="output" metadata_source="inputA" format_source="inputA" label="Fisher Test on ${inputA.name} and ${inputB.name}"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="fisherBed1.bed" ftype="bed" />
+            <param name="inputB" value="fisherBed2.bed" ftype="bed" />
+            <param name="genome" value="fisherBed.len" ftype="tabular" />
+            <output name="output" file="fisherBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+Perform fisher’s exact test on the number of overlaps/unique intervals between 2 files.
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 flankBed.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/flankBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,72 @@
+<tool id="bedtools_flankbed" name="FlankBed" version="@WRAPPER_VERSION@.0">
+    <description></description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+        flankBed
+        $pct
+        $strand
+        -g $genome
+        -i $input
+
+        #if $addition.addition_select == 'b':
+            -b $addition.b
+        #else:
+            -l $addition.l
+            -r $addition.r
+        #end if
+        > $output
+]]>
+    </command>
+    <inputs>
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
+        <expand macro="genome" />
+        <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue=""
+            label="Define -l and -r as a fraction of the feature’s length"
+            help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" />
+        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue=""
+            label="Define -l and -r based on strand"
+            help="For example. if used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" />
+        <expand macro="addition" />
+    </inputs>
+    <outputs>
+        <data metadata_source="input" format_source="input" name="output" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="a.bed" ftype="bed" />
+            <param name="genome" value="mm9_chr1.len"/>
+            <param name="addition_select" value="b"/>
+            <param name="b" value="5"/>
+            <output name="output" file="flankBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="input" value="a.bed" ftype="bed" />
+            <param name="genome" value="mm9_chr1.len"/>
+            <param name="addition_select" value="lr"/>
+            <param name="l" value="2"/>
+            <param name="r" value="3"/>
+            <output name="output" file="flankBed_result2.bed" ftype="bed" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+bedtools flank will optionally create flanking intervals whose size is user-specified fraction of the original interval.
+
+.. image:: $PATH_TO_IMAGES/flank-glyph.png
+
+.. class:: warningmark
+
+In order to prevent creating intervals that violate chromosome boundaries, bedtools flank requires a genome file defining the length of each chromosome or contig.
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 flankbed.xml
--- a/flankbed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,49 +0,0 @@
-<tool id="bedtools_flankbed" name="FlankBed" version="@WRAPPER_VERSION@.0">
-    <description></description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-        flankBed
-        $pct
-        $strand
-        -g $genome
-        -i $inputA
-
-        #if $addition.addition_select == 'b':
-            -b $addition.b
-        #else:
-            -l $addition.l
-            -r $addition.r
-        #end if
-
-        &gt; $output
-    </command>
-    <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <expand macro="genome" />
-        <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue="" label="Define -l and -r as a fraction of the feature’s length" help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" />
-        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Define -l and -r based on strand" help="For example. if used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" />
-        <expand macro="addition" />
-    </inputs>
-    <outputs>
-        <data format="bed" name="output"  label=""/>
-    </outputs>
-    <help>
-
-**What it does**
-
-bedtools flank will optionally create flanking intervals whose size is user-specified fraction of the original interval.
-
-.. image:: $PATH_TO_IMAGES/flank-glyph.png
-
-.. class:: warningmark
-
-In order to prevent creating intervals that violate chromosome boundaries, bedtools flank requires a genome file defining the length of each chromosome or contig.
-
-@REFERENCES@
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 genomeCoverageBed.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/genomeCoverageBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,168 @@
+<tool id="bedtools_genomecoveragebed" name="Genome Coverage" version="@WRAPPER_VERSION@.0">
+    <description>in bedGraph or histogram format</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+        bedtools genomecov
+        #if $input.ext == "bam"
+            -ibam '$input'
+        #else
+            -i '$input'
+            -g $genome
+        #end if
+
+        $split
+        $strand
+
+        #if str($report.report_select) == "bg":
+            #if $zero_regions.value:
+                $zero_regions
+            #else:
+                -bg
+            #end if
+
+            #if str($scale):
+              -scale $scale
+            #end if
+        #else:
+            #if str($report.max):
+              -max $report.max
+            #end if
+        #end if
+        $d
+        $dz
+        $five
+        $three
+
+        > '$output'
+]]>
+    </command>
+    <inputs>
+        <param format="bed,bam" name="input" type="data" label="The BAM or BED file from which coverage should be computed">
+              <validator type="unspecified_build" />
+        </param>
+        <conditional name="report">
+            <param name="report_select" type="select" label="Output type">
+                <option value="bg" selected="true">BedGraph coverage file</option>
+                <option value="hist">Data suiteable for Histogram</option>
+            </param>
+            <when value="bg">
+                <param name="zero_regions" type="boolean" checked="False" truevalue="-bga" falsevalue=""
+                    label="Report regions with zero coverage" help="If set, regions without any coverage will also be reported.  (-bga)" />
+                <param name="scale" type="float" value="1.0"
+                    label="Scale the coverage by a constant factor"
+                    help="Each bedGraph coverage value is multiplied by this factor before being reported. Useful for normalizing coverage by, e.g., reads per million (RPM). (-scale)"/>
+            </when>
+            <when value="hist">
+                <param name="max" type="integer" label="Specify max depth" value="0"
+                    help="Combine all positions with a depth >= max into a single bin in the histogram. (-max)"/>
+            </when>
+        </conditional>
+        <expand macro="genome" />
+        <expand macro="split" />
+        <param name="strand" type="select" label="Calculate coverage based on" help="(-strand)">
+            <option value="">both strands combined</option>
+            <option value="-strand +">positive strand only</option>
+            <option value="-strand -">negative strand only</option>
+        </param>
+
+        <param name="d" type="boolean" checked="False" truevalue="-d" falsevalue=""
+            label="Report the depth at each genome position with 1-based coordinates" help="(-d)" />
+        <param name="dz" type="boolean" checked="False" truevalue="-dz" falsevalue=""
+            label="Report the depth at each genome position with 0-based coordinatess" help="(-dz)" />
+        <param name="five" type="boolean" checked="False" truevalue="-d" falsevalue=""
+            label="Calculate coverage of 5’ positions" help="Instead of entire interval. (-5)" />
+        <param name="three" type="boolean" checked="False" truevalue="-3" falsevalue=""
+            label="Calculate coverage of 3’ positions" help="Instead of entire interval. (-3)" />
+    </inputs>
+    <outputs>
+        <data format="bedgraph" name="output">
+            <change_format>
+                <when input="report.report_select" value="hist" format="tabular" />
+            </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="genomeCoverageBed1.bed" ftype="bed" />
+            <param name="genome" value="genomeCoverageBed1.len" />
+            <param name="report_select" value="hist" />
+            <output name="output" file="genomeCoverageBed_result1.bed" ftype="tabular" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+This tool calculates the genome-wide coverage of intervals defined in a BAM or BED file and reports them in BedGraph format.
+
+.. image:: $PATH_TO_IMAGES/genomecov-glyph.png
+
+.. class:: warningmark
+
+The input BED or BAM file must be sorted by chromosome name (but doesn't necessarily have to be sorted by start position).
+
+-----
+
+**Example 1**
+
+Input (BED format)-
+Overlapping, un-sorted intervals::
+
+    chr1    140 176
+    chr1    100 130
+    chr1    120 147
+
+
+Output (BedGraph format)-
+Sorted, non-overlapping intervals, with coverage value on the 4th column::
+
+    chr1    100 120 1
+    chr1    120 130 2
+    chr1    130 140 1
+    chr1    140 147 2
+    chr1    147 176 1
+
+-----
+
+**Example 2 - with ZERO-Regions selected (assuming hg19)**
+
+Input (BED format)-
+Overlapping, un-sorted intervals::
+
+    chr1    140 176
+    chr1    100 130
+    chr1    120 147
+
+
+BedGraph output will contain five columns:
+
+    * 1. Chromosome name (or 'genome' for whole-genome coverage)
+    * 2. Coverage depth
+    * 3. The number of bases on chromosome (or genome) with depth equal to column 2.
+    * 4. The size of chromosome (or entire genome) in base pairs
+    * 5. The fraction of bases on chromosome (or entire genome) with depth equal to column 2.
+
+**Example Output**:
+    
+    chr2L       0           1379895     23011544    0.0599653
+    chr2L       1           837250      23011544    0.0363839
+    chr2L       2           904442      23011544    0.0393038
+    chr2L       3           913723      23011544    0.0397072
+    chr2L       4           952166      23011544    0.0413778
+    chr2L       5           967763      23011544    0.0420555
+    chr2L       6           986331      23011544    0.0428624
+    chr2L       7           998244      23011544    0.0433801
+    chr2L       8           995791      23011544    0.0432735
+    chr2L       9           996398      23011544    0.0432999
+
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 genomeCoverageBed_bedgraph.xml
--- a/genomeCoverageBed_bedgraph.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,106 +0,0 @@
-<tool id="bedtools_genomecoveragebed_bedgraph" name="Create a BedGraph of genome coverage" version="@WRAPPER_VERSION@.0">
-    <description>
-    </description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-        genomeCoverageBed
-        #if $input.ext == "bam"
-            -ibam '$input'
-        #else
-            -i '$input'
-            -g ${chromInfo}
-        #end if
-        
-        #if str($scale):
-          -scale $scale
-        #end if
-
-        -bg
-        $zero_regions
-        $split
-        $strand
-        &gt; '$output'
-    </command>
-    <inputs>
-        <param format="bed,bam" name="input" type="data" label="The BAM or BED file from which coverage should be computed">
-              <validator type="unspecified_build" />
-        </param>
-
-        <param name="zero_regions" type="boolean" checked="true" truevalue="-bga" falsevalue="" label="Report regions with zero coverage" help="If set, regions without any coverage will also be reported." />
-
-        <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." />
-
-        <param name="strand" type="select" label="Calculate coverage based on">
-            <option value="">both strands combined</option>
-            <option value="-strand +">positive strand only</option>
-            <option value="-strand -">negative strand only</option>
-        </param>
-
-        <param name="scale" type="float" optional="true" label="Scale the coverage by a constant factor" help="Each BEDGRAPH coverage value is multiplied by this factor before being reported. Useful for normalizing coverage by, e.g., reads per million (RPM)"/>
-    </inputs>
-    <outputs>
-        <data format="bedgraph" name="output"  metadata_source="input" label="${input.name} (Genome Coverage BedGraph)" />
-    </outputs>
-    <help>
-
-
-**What it does**
-
-This tool calculates the genome-wide coverage of intervals defined in a BAM or BED file and reports them in BedGraph format.
-
-.. class:: warningmark
-
-The input BED or BAM file must be sorted by chromosome name (but doesn't necessarily have to be sorted by start position).
-
------
-
-**Example 1**
-
-Input (BED format)-
-Overlapping, un-sorted intervals::
-
-    chr1    140 176
-    chr1    100 130
-    chr1    120 147
-
-
-Output (BedGraph format)-
-Sorted, non-overlapping intervals, with coverage value on the 4th column::
-
-    chr1    100 120 1
-    chr1    120 130 2
-    chr1    130 140 1
-    chr1    140 147 2
-    chr1    147 176 1
-
------
-
-**Example 2 - with ZERO-Regions selected (assuming hg19)**
-
-Input (BED format)-
-Overlapping, un-sorted intervals::
-
-    chr1    140 176
-    chr1    100 130
-    chr1    120 147
-
-
-Output (BedGraph format)-
-Sorted, non-overlapping intervals, with coverage value on the 4th column::
-
-    chr1    0 100 0
-    chr1    100 120 1
-    chr1    120 130 2
-    chr1    130 140 1
-    chr1    140 147 2
-    chr1    147 176 1
-    chr1    176 249250621 0
-
-@REFERENCES@
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 genomeCoverageBed_histogram.xml
--- a/genomeCoverageBed_histogram.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,68 +0,0 @@
-<tool id="bedtools_genomecoveragebed_histogram" name="Create a histogram of genome coverage" version="@WRAPPER_VERSION@.0">
-    <description>
-    </description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-    genomeCoverageBed
-        #if $input.ext == "bam"
-            -ibam '$input'
-        #else
-            -i '$input'
-            -g ${chromInfo}
-        #end if
-        #if str($max):
-          -max $max
-        #end if
-        &gt; '$output'
-    </command>
-
-    <inputs>
-        <param format="bed,bam" name="input" type="data" label="The BAM or BED file from which coverage should be computed"></param>
-        <param name="max" type="text" optional="true" label="Max depth" help="Combine all positions with a depth >= max into a single bin in the histogram."/>
-    </inputs>
-
-    <outputs>
-        <data format="tabular" name="output"  metadata_source="input" label="${input.name} (Genome Coverage Histogram)" />
-    </outputs>
-
-<help>
-**What it does**
-
-This tool calculates a histogram of genome coverage depth based on mapped reads in BAM format or intervals in BED format.
-
-
-------
-
-
-.. class:: infomark
-
-The output file will contain five columns:
-
-    * 1. Chromosome name (or 'genome' for whole-genome coverage)
-    * 2. Coverage depth
-    * 3. The number of bases on chromosome (or genome) with depth equal to column 2.
-    * 4. The size of chromosome (or entire genome) in base pairs
-    * 5. The fraction of bases on chromosome (or entire genome) with depth equal to column 2.
-
-**Example Output**::
-    
-    chr2L       0           1379895     23011544    0.0599653
-    chr2L       1           837250      23011544    0.0363839
-    chr2L       2           904442      23011544    0.0393038
-    chr2L       3           913723      23011544    0.0397072
-    chr2L       4           952166      23011544    0.0413778
-    chr2L       5           967763      23011544    0.0420555
-    chr2L       6           986331      23011544    0.0428624
-    chr2L       7           998244      23011544    0.0433801
-    chr2L       8           995791      23011544    0.0432735
-    chr2L       9           996398      23011544    0.0432999
-
-
-@REFERENCES@
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 getfastaBed.xml
--- a/getfastaBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/getfastaBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,30 +6,59 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools getfasta
         $name
         $tab
         $strand
         $split
         -fi $fasta 
-        -bed $inputA
+        -bed $input
         -fo $output
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file" />
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file" />
         <param format="fasta" name="fasta" type="data" label="Fasta file" />
-        <param name="name" type="boolean" checked="false" truevalue="-name" falsevalue="" label="Use the “name” column in the BED file for the FASTA headers in the output FASTA file" />
-        <param name="tab" type="boolean" checked="false" truevalue="-tab" falsevalue="" label="Report extract sequences in a tab-delimited format instead of in FASTA format" />
-        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Force strandedness" help="If the feature occupies the antisense strand, the sequence will be reverse complemented." />
-        <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Given BED12 input, extract and concatenate the sequences from the BED 'blocks' (e.g., exons)" />
+        <param name="name" type="boolean" checked="false" truevalue="-name" falsevalue=""
+            label="Use the 'name' column in the BED file for the FASTA headers in the output FASTA file"
+            help="(-name)" />
+        <param name="tab" type="boolean" checked="false" truevalue="-tab" falsevalue=""
+            label="Report extract sequences in a tab-delimited format instead of in FASTA format"
+            help="(-tab)" />
+        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue=""
+            label="Force strandedness"
+            help="If the feature occupies the antisense strand, the sequence will be reverse complemented. (-s)" />
+        <expand macro="split" />
     </inputs>
     <outputs>
-        <data format="fasta" name="output" />
+        <data format="fasta" name="output">
+            <change_format>
+                <when input="tab" value="-tab" format="tabular" />
+            </change_format>
+        </data>
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="tab" value="False" />
+            <param name="split" value="False" />
+            <output name="output" file="getfastaBed_result1.bed" ftype="fasta" />
+        </test>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="tab" value="True" />
+            <param name="split" value="False" />
+            <output name="output" file="getfastaBed_result2.tabular" ftype="tabular" />
+        </test>
+    </tests>
     <help>
+<![CDATA[
 **What it does**
 
-bedtools getfasta will extract the sequence defined by the coordinates in a BED interval and create a new FASTA entry in the output file for each extracted sequence. By default, the FASTA header for each extracted sequence will be formatted as follows: “&lt;chrom>:&lt;start>-&lt;end>”.
+bedtools getfasta will extract the sequence defined by the coordinates in a BED interval and create a new FASTA entry in the output file for each extracted sequence. By default, the FASTA header for each extracted sequence will be formatted as follows: “>chrom>:&lt;start>-&lt;end>”.
 
 .. image:: $PATH_TO_IMAGES/getfasta-glyph.png
 
@@ -40,6 +69,7 @@
 2. You can use the UNIX fold command to set the line width of the FASTA output. For example, fold -w 60 will make each line of the FASTA file have at most 60 nucleotides for easy viewing.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 groupbyBed.xml
--- a/groupbyBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/groupbyBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,23 +6,31 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools groupby
-        -c $cols
+        -c "${cols}"
         -g $group
         -o $operation
-        -i $inputA
-        &gt; $output
+        -i "${inputA}"
+        > "${output}"
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <param name="cols" type="text" value="" label="Specify the column(s) (comma separated) that should be summarized" />
-        <param name="group" type="text" value="1,2,3" label="Specifies which column(s) (1-based) should be used to group the input. Columns may be comma-separated with each column must be explicitly listed. Or, ranges (e.g. 1-4) are also allowed." />
-        <param name="operation" type="select" label="Specify the operation">
+        <param format="bed" name="inputA" type="data" label="BED file"/>
+        <expand macro="choose_columns" />
+        <param name="group" type="text" value="1,2,3" 
+            label="Specifies which column(s) (1-based) should be used to group the input"
+            help="Columns may be comma-separated with each column must be explicitly listed. Or, ranges (e.g. 1-4) are also allowed. (-g)">
+            <sanitizer invalid_char="">
+                <valid initial="string.digits"><add value=","/><add value="-"/></valid>
+            </sanitizer>
+        </param>
+        <param name="operation" type="select" label="Specify the operation" help="(-o)">
             <option value="sum" selected="True">Sum - numeric only</option>
             <option value="stdev">Stdev - numeric only</option>
             <option value="sstdev">Sstdev - numeric only</option>
-            <option value="freqasc">Freqasc - print a comma separated list of values observed and the number of times they were observed. Reported in ascending order of frequency*</option>
-            <option value="freqdesc">Freqdesc - - print a comma separated list of values observed and the number of times they were observed. Reported in descending order of frequency*</option>
+            <option value="freqasc">Freqasc - comma separated list of values observed and the number of times they were observed (ascending)</option>
+            <option value="freqdesc">Freqdesc - comma separated list of values observed and the number of times they were observed (descending)</option>
             <option value="first">First - numeric or text</option>
             <option value="last">Last - numeric or text</option>
             <expand macro="math_options" />
@@ -30,15 +38,39 @@
         </param>
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label=""/>
+        <data format_source="inputA" name="output" metadata_source="inputA"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="groupbyBed1.bed" ftype="bed" />
+            <param name="cols" value="9" />
+            <param name="group" value="1,2,3" />
+            <param name="operation" value="sum" />
+            <output name="output" file="groupbyBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="groupbyBed1.bed" ftype="bed" />
+            <param name="cols" value="9" />
+            <param name="group" value="1,2,3" />
+            <param name="operation" value="min" />
+            <output name="output" file="groupbyBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="groupbyBed1.bed" ftype="bed" />
+            <param name="cols" value="9" />
+            <param name="group" value="1-4" />
+            <param name="operation" value="median" />
+            <output name="output" file="groupbyBed_result3.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Replicate lines in a file based on columns of comma-separated values.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 intersectBed.xml
--- a/intersectBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/intersectBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,65 +6,92 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        intersectBed
-        #if $inputA.ext == "bam":
-            -abam $inputA
-        #else:
-            -a $inputA
-        #end if
+<![CDATA[
+        #set inputBs = '" "'.join( [ str( $file ) for $file in $inputB ] )
+        #set modes = ' '.join( str($overlap_mode).split(',') )
+
+        bedtools intersect
+            #if $inputA.ext == "bam":
+                -abam "${inputA}"
+            #else:
+                -a "${inputA}"
+            #end if
 
-        -b $inputB
-        $split
-        $strand
-        #if str($fraction):
-          -f $fraction
-        #end if
-        $reciprocal
-        $invert
-        $once
-        $header
-        $overlap_mode
-        &gt; $output
+            -b "${inputBs}"
+            $split
+            $strand
+            #if str($fraction) != "None" and str($fraction):
+              -f "${fraction}"
+            #end if
+            $reciprocal
+            $invert
+            $once
+            $header
+            $modes
+            > "${output}"
+]]>
     </command>
     <inputs>
         <param format="bed,bam,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF/BAM file"/>
-        <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="overlap intervals in this BED file?"/>
-
-        <param name="strand" type="select" label="Calculate the intersection based on strandedness?">
-            <option value="" selected="True">Overlaps on either strand</option>
-            <option value="-s">Only overlaps occurring on the **same** strand.</option>
-            <option value="-S">Only overlaps occurring on the **opposite** strand.</option>
-        </param>
-
-        <param name="overlap_mode" type="select" label="What should be written to the output file?">
-            <option value="-wa" selected="True">Write the original entry in A for each overlap.</option>
-            <option value="-wb">Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by the fraction- and reciprocal option.</option>
-            <option value="-wo">Write the original A and B entries plus the number of base pairs of overlap between the two features. Only A features with overlap are reported. Restricted by the fraction- and reciprocal option.</option>
-            <option value="-wao">Write the original A and B entries plus the number of base pairs of overlap between the two features. However, A features w/o overlap are also reported with a NULL B feature and overlap = 0. Restricted by the fraction- and reciprocal option.</option>
-            <option value="-loj">Perform a "left outer join". That is, for each feature in A report each overlap with B.  If no overlaps are found, report a NULL feature for B.</option>
+        <param format="bed,bam,gff,vcf,gff3" name="inputB" type="data" multiple="True" label="One or more BAM/BED/GFF/VCF file(s)"/>
+        <expand macro="strand2" />
+        <param name="overlap_mode" type="select" multiple="True" label="What should be written to the output file?">
+            <option value="-wa" selected="True">Write the original entry in A for each overlap (-wa)</option>
+            <option value="-wb">Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by the fraction- and reciprocal option (-wb)</option>
+            <option value="-wo">Write the original A and B entries plus the number of base pairs of overlap between the two features. Only A features with overlap are reported. Restricted by the fraction- and reciprocal option (-wo)</option>
+            <option value="-wao">Write the original A and B entries plus the number of base pairs of overlap between the two features. However, A features w/o overlap are also reported with a NULL B feature and overlap = 0. Restricted by the fraction- and reciprocal option (-wao)</option>
+            <option value="-loj">Perform a "left outer join". That is, for each feature in A report each overlap with B.  If no overlaps are found, report a NULL feature for B (-loj)</option>
         </param>
 
-        <param name="split" type="boolean" checked="true" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." />
+        <expand macro="split" />
         <!-- -f -->
-        <param name="fraction" type="text" optional="true" label="Minimum overlap required as a fraction of the BAM alignment" help="Alignments are only retained if the overlap with the an interval in the BED file comprises at least this fraction of the BAM alignment's length.  For example, to require that the overlap affects 50% of the BAM alignment, use 0.50. (-f)"/>
+        <param name="fraction" type="text"
+            label="Minimum overlap required as a fraction of the BAM alignment"
+            help="Alignments are only retained if the overlap with the an interval in the BED file comprises at least this fraction of the BAM alignment's length.  For example, to require that the overlap affects 50% of the BAM alignment, use 0.50. (-f)"/>
         <!-- -r -->
-        <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Require reciprocal overlap." help="If set, the overlap between the BAM alignment and the BED interval must affect the above fraction of both the alignment and the BED interval. (-r)" />
+        <expand macro="reciprocal" />
         <!-- -v -->
-        <param name="invert" type="boolean" checked="false" truevalue="-v" falsevalue="" label="Report only those alignments that **do not** overlap the BED file. (-v)"/>
+        <param name="invert" type="boolean" checked="false" truevalue="-v" falsevalue=""
+            label="Report only those alignments that **do not** overlap the BED file"
+            help="(-v)"/>
         <!-- -u -->
-        <param name="once" type="boolean" checked="false" truevalue="-u" falsevalue="" label="Write the original A entry _once_ if _any_ overlaps found in B." help="Just report the fact >=1 hit was found. (-u)" />
+        <param name="once" type="boolean" checked="false" truevalue="-u" falsevalue=""
+            label="Write the original A entry _once_ if _any_ overlaps found in B."
+            help="Just report the fact >=1 hit was found. (-u)" />
         <!-- -c -->
-        <param name="count" type="boolean" checked="false" truevalue="-c" falsevalue="" label="For each entry in A, report the number of overlaps with B." help="Reports 0 for A entries that have no overlap with B. (-c)" />
-        <!-- header -->
-        <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results." />
-        <!-- header -->
-        <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results." />
+        <param name="count" type="boolean" checked="false" truevalue="-c" falsevalue=""
+            label="For each entry in A, report the number of overlaps with B."
+            help="Reports 0 for A entries that have no overlap with B. (-c)" />
+        <expand macro="print_header" />
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}"/>
+        <data format_source="inputA" name="output" metadata_source="inputA"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="intersectBed1.bed" ftype="bed" />
+            <param name="inputB" value="intersectBed2.bed" ftype="bed" />
+            <param name="overlap_mode" value="-wa" />
+            <param name="split" value="False" />
+            <output name="output" file="intersectBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="intersectBed1.bed" ftype="bed" />
+            <param name="inputB" value="intersectBed2.bed" ftype="bed" />
+            <param name="overlap_mode" value="-wa,-wb" />
+            <param name="split" value="False" />
+            <output name="output" file="intersectBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="intersectBed1.bed" ftype="bed" />
+            <param name="inputB" value="intersectBed2.bed" ftype="bed" />
+            <param name="invert" value="True" />
+            <param name="split" value="False" />
+            <output name="output" file="intersectBed_result3.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 By far, the most common question asked of two sets of genomic features is whether or not any of the features in the two sets “overlap” with one another. This is known as feature intersection. bedtools intersect allows one to screen for overlaps between two sets of genomic features. Moreover, it allows one to have fine control as to how the intersections are reported. bedtools intersect works with both BED/GFF/VCF and BAM files as input.
@@ -80,7 +107,7 @@
 Note that a BAM alignment will be sent to the output file **once** even if it overlaps more than one interval in the BED file.
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 jaccardBed.xml
--- a/jaccardBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/jaccardBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,29 +6,44 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools jaccard
-        
-        $reciprocal
-        $strand
-        $split
-        -f $overlap 
-        -a $inputA
-        -b $inputB
-        &gt; $output
+            $strand
+            $split
+            $reciprocal
+            -f $overlap
+            -a $inputA
+            -b $inputB
+            > $output
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
         <param format="bed,vcf,gff,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/>
-        <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" />
-
-        <param name="reciprocal" type="boolean" checked="false" truevalue="-f" falsevalue="" label="Require that the fraction of overlap be reciprocal for A and B. In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B" />
-        <param name="tab" type="boolean" checked="false" truevalue="-tab" falsevalue="" label="Report extract sequences in a tab-delimited format instead of in FASTA format." />
-    <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Force strandedness" help="That is, only report hits in B that overlap A on the same strand. By default, overlaps are reported without respect to strand" />
+        <expand macro="overlap" />
+        <expand macro="reciprocal" />
+        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" 
+            label="Force strandedness"
+            help="That is, only report hits in B that overlap A on the same strand. By default, overlaps are reported without respect to strand. (-s)" />
         <expand macro="strand2" />
+        <expand macro="split" />
     </inputs>
     <outputs>
         <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}" />
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="jaccardBed1.bed" ftype="bed" />
+            <param name="inputB" value="jaccardBed2.bed" ftype="bed" />
+            <output name="output" file="jaccardBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="jaccardBed1.bed" ftype="bed" />
+            <param name="inputB" value="jaccardBed2.bed" ftype="bed" />
+            <param name="overlap" value="0.1" />
+            <output name="output" file="jaccardBed_result2.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
 
 **What it does**
diff -r b8348686a0b9 -r 82aac94b06c3 linksBed.xml
--- a/linksBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/linksBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,29 +6,49 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        linksBed
-        -base $basename
-        -org $org
-        -db $db
-        -i $inputA
-        &gt; $output
+<![CDATA[
+        bedtools links
+            -base "${basename}"
+            -org "${org}"
+            -db "${db}"
+            -i "${input}"
+            > "${output}"
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <param name="basename" type="text" value="http://genome.ucsc.edu" label="The “basename” for the UCSC browser" />
-        <param name="org" type="text" value="human" label="The organism (e.g. mouse, human)" />
-        <param name="db" type="text" value="hg18" label="The genome build" />
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
+        <param name="basename" type="text" value="http://genome.ucsc.edu"
+            label="The 'basename' for the UCSC genome browser" />
+        <param name="org" type="text" value="human" label="Organism name" help="e.g. mouse, human (-org)" />
+        <param name="db" type="text" value="hg19" label="The genome build" help="(-db)"/>
     </inputs>
     <outputs>
         <data name="output" format="html" />
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="linksBed1.bed" ftype="bed" />
+            <param name="basename" value="http://genome.ucsc.edu" />
+            <param name="org" value="" />
+            <param name="db" value="" />
+            <output name="output" file="linksBed_result1.html" lines_diff="2" ftype="html" />
+        </test>
+        <test>
+            <param name="input" value="linksBed1.bed" ftype="bed" />
+            <param name="basename" value="http://genome.ucsc.edu" />
+            <param name="org" value="mouse" />
+            <param name="db" value="mm9" />
+            <output name="output" file="linksBed_result2.html" lines_diff="2" ftype="html" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Creates an HTML file with links to an instance of the UCSC Genome Browser for all features / intervals in a file. This is useful for cases when one wants to manually inspect through a large set of annotations or features.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 macros.xml
--- a/macros.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/macros.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -1,11 +1,12 @@
 <macros>
     <xml name="requirements">
         <requirements>
-            <requirement type="package" version="2.19.1">bedtools</requirement>
+            <requirement type="package" version="2.22">bedtools</requirement>
+            <yield/>
         </requirements>
         <version_command>bedtools --version</version_command>
     </xml>
-    <token name="@WRAPPER_VERSION@">2.19</token>
+    <token name="@WRAPPER_VERSION@">2.22</token>
     <xml name="stdio">
         <stdio>
             <!-- Anything other than zero is an error -->
@@ -16,9 +17,13 @@
             <regex match="Exception:" />
         </stdio>
     </xml>
-
+    <xml name="reciprocal">
+        <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue=""
+            label="Require that the fraction of overlap be reciprocal for A and B"
+            help="In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B. (-r)" />
+    </xml>
     <xml name="overlap">
-        <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" />
+        <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" help="Default is 1E-9, i.e. 1bp. (-f)"/>
     </xml>
     <xml name="strand2">
         <param name="strand" type="select" label="Calculation based on strandedness?">
@@ -29,19 +34,24 @@
     </xml>
     <xml name="seed">
         <conditional name="seed">
-            <param name="choose" type="boolean" label="Choose Seed?" selected="False" truevalue="True" falsevalue="False" />
+            <param name="seed_choose" type="select" label="Choose Seed?" help="(-seed)">
+                <option value="False" selected="True">Random Shuffling</option>
+                <option value="True">Choose fixed seed</option>
+            </param>
             <when value="True">
                 <param name="seed" type="integer" value="12345" label="Enter Seed" />
             </when>
+            <when value="False" />
         </conditional>
     </xml>
     <xml name="split">
-        <param name="split" type="boolean" checked="true" truevalue="-split" falsevalue="" 
+        <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" 
             label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." 
-            help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." />
+            help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data. (-split)" />
     </xml>
     <xml name="genome">
-        <param format="bed,vcf,gff,gff3" name="genome" type="data" label="Genome file" />
+        <param format="tabular" name="genome" type="data" label="Genome file" />
+        <!--TODO: make use of: ${chromInfo} -->
     </xml>
     <xml name="addition">
         <conditional name="addition">
@@ -50,30 +60,61 @@
                 <option value="lr">Increase by Start Coordinate and End Coordinate</option>
             </param>
             <when value="b">
-                <param name="b" label="Give Value" type="integer" value="0"  />
+                <param name="b" value="1" label="Number of base pairs" type="integer" />
             </when>
             <when value="lr">
-                <param name="l" label="The number of base pairs to subtract from the start coordinate" type="integer" value="0" />
-                <param name="r" label="The number of base pairs to add to the end coordinate" type="integer" value="0" />
+                <param name="l" type="integer" value="0" label="The number of base pairs to subtract from the start coordinate" />
+                <param name="r" type="integer" value="0" label="The number of base pairs to add to the end coordinate" />
             </when>
         </conditional>
     </xml>
+    <xml name="print_header">
+        <param name="header" type="boolean" checked="False" truevalue="-header" falsevalue=""
+            label="Print the header from the A file prior to results" help="(-header)" />
+    </xml>
+    <!-- TODO this is currently not used, but we should make use of it -->
+    <xml name="genome_validator">
+        <validator type="unspecified_build" />
+        <validator type="dataset_metadata_in_data_table" table_name="fasta_indexes" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." />
+    </xml>
+
+    <!-- ToDo column_picker -->
+    <xml name="choose_columns">
+        <param name="cols" type="text" value=""
+            label="Specify the column(s) (comma separated) that should be summarized"
+            help="(-c)">
+            <sanitizer invalid_char="">
+                <valid initial="string.digits"><add value=","/></valid>
+            </sanitizer>
+        </param>
+    </xml>
+
+    <xml name="choose_operations">
+        <param name="operation" type="select" label="Specify the operation">
+            <yield />
+        </param>
+    </xml>
+
     <xml name="math_options">
-            <option value="min">Min - numeric only</option>
-            <option value="max">Max - numeric only</option>
-             <option value="mean">Mean - numeric only</option>
-            <option value="median">Median - numeric only</option>
-            <option value="mode">Mode - numeric only</option>
-            <option value="antimode">Antimode - numeric only</option>
-            <option value="collapse">collapse (i.e., print a comma separated list) - numeric or text</option>
-       </xml>
+        <option value="sum" selected="True">Sum - numeric only</option>
+        <option value="min">Min - numeric only</option>
+        <option value="max">Max - numeric only</option>
+        <option value="absmin">AbsMin - numeric only</option>
+        <option value="absmax">AbsMax - numeric only</option>
+        <option value="mean">Mean - numeric only</option>
+        <option value="median">Median - numeric only</option>
+        <option value="mode">Mode - numeric only</option>
+        <option value="antimode">Antimode - numeric only</option>
+        <option value="collapse">collapse (i.e., print a comma separated list) - numeric or text</option>
+    </xml>
     <xml name="additional_math_options">
-            <option value="count">Count - numeric or text</option>
-            <option value="count_disctinct">Count Distinct - numeric or text</option>
-            <option value="distinct">distinct (i.e., print a comma separated list) - numeric or text</option>
-            <option value="concat">concat (i.e., print a comma separated list) - numeric or text</option>
+        <option value="count">Count - numeric or text</option>
+        <option value="count_disctinct">Count Distinct - numeric or text</option>
+        <option value="distinct">distinct (i.e., print a comma separated list) - numeric or text</option>
+        <option value="concat">concat (i.e., print a comma separated list) - numeric or text</option>
     </xml>
     <token name="@REFERENCES@">
+<![CDATA[
 ------
 
 This tool is part of the `bedtools package`_ from the `Quinlan laboratory`_.
@@ -81,10 +122,18 @@
 .. _bedtools package: https://github.com/arq5x/bedtools2
 .. _Quinlan laboratory: http://cphg.virginia.edu/quinlan/
 
+
+**Citation**
+
+If you use this tool in Galaxy, please cite:
+
+Bjoern A. Gruening (2014), `Galaxy wrapper <https://github.com/bgruening/galaxytools>`_
+]]>
     </token>
     <xml name="citations">
         <citations>
             <citation type="doi">10.1093/bioinformatics/btq033</citation>
+            <yield />
         </citations>
     </xml>
 </macros>
diff -r b8348686a0b9 -r 82aac94b06c3 makeWindowsBed.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/makeWindowsBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,125 @@
+<tool id="bedtools_makewindowsbed" name="MakeWindowsBed" version="@WRAPPER_VERSION@.0">
+    <description></description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+        bedtools makewindows
+        #if $type.type_select == 'genome':
+            -g $type.genome
+        #else:
+            -b $type.input
+        #end if
+        #if $action.action_select == 'windowsize':
+            -w $action.windowsize
+            #if $action.step_size.step_size_select == 'yes':
+                -s $action.step_size.step_size
+            #end if
+        #else:
+            -n $action.number
+            -s $action.step_size
+        #end if
+        $sourcename
+        > $output
+]]>
+    </command>
+    <inputs>
+         <conditional name="type">
+            <param name="type_select" type="select" label="Work with">
+                <option value="bed" selected="True">Bed File</option>
+                <option value="genome">Genome File</option>
+            </param>
+            <when value="bed">
+                <param  name="input" format="bed,vcf,gff,gff3" type="data" label="BED/VCF/GFF file"/>
+            </when>
+            <when value="genome">
+                <expand macro="genome" />
+            </when>
+        </conditional>
+        <conditional name="action">
+            <param name="action_select" type="select" label="Work with">
+                <option value="windowsize" selected="True">Set WindowSize</option>
+                <option value="number">Give Number of Windows</option>
+            </param>
+            <when value="windowsize">
+                <param name="windowsize" type="integer" value="1"
+                    label="Divide each input interval (either a chromosome or a BED interval) to fixed-sized windows"
+                    help="i.e. same number of nucleotide in each window" />
+                 <conditional name="step_size">
+                    <param name="step_size_select" type="select"
+                        label="Specify Step size? i.e. how many base pairs to step before creating a new window"
+                        help="Used to create 'sliding' windows. Defaults to window size (non-sliding windows).">
+                        <option value="yes">Yes</option>
+                        <option value="no" selected="True">No</option>
+                    </param>
+                    <when value="yes">
+                        <param name="step_size" type="integer" value="100" label="Specify it" />
+                    </when>
+                    <when value="no" />
+                 </conditional>
+            </when>
+            <when value="number">
+                <param name="number" type="integer" value="1"
+                    label="Divide each input interval (either a chromosome or a BED interval) to fixed number of windows"
+                    help="i.e. same number of windows, with varying window sizes" />
+                <param name="step_size" type="integer" value="100" label="Specify it" />
+            </when>
+        </conditional>
+        <param name="sourcename" type="select" label="ID Naming Options">
+            <option value="" selected="True">Default</option>
+            <option value="-i src">use the source interval's name</option>
+            <option value="-i winnum">use the window number as the ID (e.g. 1,2,3,4...)</option>
+            <option value="-i srcwinnum">use the source interval's name with the window number.</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="output" format="bed" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="type_select" value="genome" />
+            <param name="genome" value="mm9_chr1.len" ftype="tabular" />
+            <param name="action_select" value="windowsize" />
+            <param name="windowsize" value="1000000" />
+            <output name="output" file="makeWindowBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="type_select" value="genome" />
+            <param name="genome" value="mm9_chr1.len" ftype="tabular" />
+            <param name="action_select" value="windowsize" />
+            <param name="windowsize" value="1000000" />
+            <param name="step_size_select" value="yes" />
+            <param name="step_size" value="50000" />
+            <output name="output" file="makeWindowBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="type_select" value="genome" />
+            <param name="genome" value="mm9_chr1.len" ftype="tabular" />
+            <param name="action_select" value="number" />
+            <param name="number" value="100" />
+            <param name="step_size" value="10000" />
+            <output name="output" file="makeWindowBed_result3.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="type_select" value="bed" />
+            <param name="input" value="makeWindowBed1.bed" ftype="bed" />
+            <param name="action_select" value="number" />
+            <param name="number" value="15" />
+            <param name="step_size" value="100" />
+            <output name="output" file="makeWindowBed_result4.bed" ftype="bed" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+Makes adjacent or sliding windows across a genome or BED file.
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 makewindowsBed.xml
--- a/makewindowsBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,79 +0,0 @@
-<tool id="bedtools_makewindowsbed" name="MakeWindowsBed" version="@WRAPPER_VERSION@.0">
-    <description></description>
-    <macros>
-        <import>macros.xml</import>
-    </macros>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
-    <command>
-        bedtools makewindows
-        #if $type.type_select == 'genome':
-            -g $type.genome
-        #else:
-            -i $type.inputA
-        #end if
-        #if $action.action_select == 'windowsize':
-            -w $action.windowsize
-            #if $action.step_size.step_size_select == 'yes':
-                -s $action.step_size.step_size
-            #end if
-        #else:
-            -n $action.number
-        #end if
-        $sourcename
-        &gt; $output
-    </command>
-    <inputs>
-         <conditional name="type">
-            <param name="type_select" type="select" label="Work with">
-                <option value="bed" selected="True">Bed File</option>
-                <option value="genome">Genome File</option>
-            </param>
-            <when value="bed">
-                <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-            </when>
-            <when value="genome">
-                <expand macro="genome" />
-            </when>
-        </conditional>
-        <conditional name="action">
-            <param name="action_select" type="select" label="Work with">
-                <option value="windowsize" selected="True">Set WindowSize</option>
-                <option value="number">Give Number of Windows</option>
-            </param>
-            <when value="windowsize">
-                <param name="windowsize" type="integer" value="1" label="Divide each input interval (either a chromosome or a BED interval) to fixed-sized windows (i.e. same number of nucleotide in each window)." />
-                 <conditional name="step_size">
-                    <param name="step_size_select" type="select" label="Specify Step size? i.e. how many base pairs to step before creating a new window. Used to create 'sliding' windows. Defaults to window size (non-sliding windows).">
-                        <option value="yes">Yes</option>
-                        <option value="no" selected="True">No</option>
-                    </param>
-                    <when value="yes">
-                        <param name="step_size" type="integer" value="100" label="Specify it" />
-                    </when>
-                 </conditional>
-            </when>
-            <when value="number">
-                <param name="number" type="integer" value="1" label="Divide each input interval (either a chromosome or a BED interval) to fixed number of windows (i.e. same number of windows, with varying window sizes)." />
-            </when>
-        </conditional>
-        <param name="sourcename" type="select" label="ID Naming Options">
-            <option value="" selected="True">Default</option>
-            <option value="-i src">use the source interval's name</option>
-            <option value="-i winnum">use the window number as the ID (e.g. 1,2,3,4...)</option>
-            <option value="-i srcwinnum">use the source interval's name with the window number.</option>
-        </param>
-    </inputs>
-    <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label=""/>
-    </outputs>
-    <help>
-
-**What it does**
-
-Makes adjacent or sliding windows across a genome or BED file.
-
-@REFERENCES@
-    </help>
-    <expand macro="citations" />
-</tool>
diff -r b8348686a0b9 -r 82aac94b06c3 mapBed.xml
--- a/mapBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/mapBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,39 +6,41 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools map
-        -a $inputA
-        -b $inputB
+        -a "${inputA}"
+        -b "${inputB}"
         $strand
         -o $operation
-        -c $col
+        -c "${cols}"
         -f $overlap
         $reciprocal
         $split
         $header
         #if $genome.genome_choose == "-g" :
             -g $genome.genome
-        #end if 
-        &gt; $output
+        #end if
+        > "${output}"
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file A"/>
-        <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file B"/>
-        <param name="col" type="integer" value="5" label="Specify the column from the B file to map onto intervals in A" />
+        <param format="bam,bed,vcf,gff,gff3" name="inputA" type="data" label="File A (BAM/BED/VCF/GFF)" />
+        <param format="bam,bed,gff,vcf,gff3" name="inputB" type="data" label="File B (BAM/BED/VCF/GFF)" />
+        <expand macro="choose_columns" /> 
         <expand macro="overlap" />
-        <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Require reciprocal overlap." help="If set, the overlap between the BAM alignment and the BED interval must affect the above fraction of both the alignment and the BED interval." />
+        <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" 
+            label="Require reciprocal overlap"
+            help="If set, the overlap between the BAM alignment and the BED interval must affect the above fraction of both the alignment and the BED interval. (-r)" />
         <expand macro="strand2" />
-        <param name="operation" type="select" label="Specify the operation">
-            <option value="sum">Sum - numeric only</option>
-            <option value="absmin">AbsMin - numeric only</option>
-            <option value="absmax">AbsMax - numeric only</option>
+        <expand macro="choose_operations">
             <expand macro="math_options" />
             <expand macro="additional_math_options" />
-        </param>
-        <param name="split" type="boolean" checked="true" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." />
-        <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results." />
+        </expand>
+        <expand macro="split" />
+        <expand macro="print_header" />
         <conditional name="genome">
-            <param name="genome_choose" type="boolean" checked="false" truevalue="-g" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="" />
+            <param name="genome_choose" type="boolean" checked="false" truevalue="-g" falsevalue=""
+                label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="(-g)" />
             <when value="-g">
                 <expand macro="genome" />
             </when>
@@ -47,8 +49,40 @@
     <outputs>
         <data format_source="inputA" name="output" metadata_source="inputA" label="Mapping of ${inputB.name} into ${inputA.name}"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="mapBed1.bed" ftype="bed" />
+            <param name="inputB" value="mapBed2.bed" ftype="bed" />
+            <param name="cols" value="5" />
+            <param name="operation" value="mean" />
+            <output name="output" file="mapBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="mapBed1.bed" ftype="bed" />
+            <param name="inputB" value="mapBed2.bed" ftype="bed" />
+            <param name="cols" value="5" />
+            <param name="operation" value="collapse" />
+            <output name="output" file="mapBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="mapBed1.bed" ftype="bed" />
+            <param name="inputB" value="mapBed2.bed" ftype="bed" />
+            <param name="cols" value="5" />
+            <param name="operation" value="collapse" />
+            <param name="strand" value="-S" />
+            <output name="output" file="mapBed_result3.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="mapBed1.bed" ftype="bed" />
+            <param name="inputB" value="mapBed2.bed" ftype="bed" />
+            <param name="cols" value="5" />
+            <param name="operation" value="collapse" />
+            <param name="strand" value="-s" />
+            <output name="output" file="mapBed_result4.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools map allows one to map overlapping features in a B file onto features in an A file and apply statistics and/or summary operations on those features.
@@ -64,7 +98,7 @@
 The map tool is substantially faster in versions 2.19.0 and later. The plot below demonstrates the increased speed when, for example, counting the number of exome alignments that align to each exon. The bedtools times are compared to the bedops bedmap utility as a point of reference.
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 maskFastaBed.xml
--- a/maskFastaBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/maskFastaBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,25 +6,44 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools maskfasta
-        $soft
-        -mc $mc
-        -fi $fasta 
-        -bed $inputA
-        -fo $output
+            $soft
+            -mc "${mc}"
+            -fi "${fasta}"
+            -bed "${input}"
+            -fo "${output}"
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
         <param format="fasta" name="fasta" type="data" label="Fasta file"/>
-
-        <param name="soft" type="boolean" checked="false" truevalue="-name" falsevalue="" label="Soft-mask (that is, convert to lower-case bases) the FASTA sequence. By default, hard-masking (that is, conversion to Ns) is performed" />
-        <param name="mc" type="text"  value="N" length="1" falsevalue="" label="Replace masking character. That is, instead of masking with Ns, use another character." />
+        <param name="soft" type="boolean" checked="false" truevalue="-soft" falsevalue=""
+            label="Soft-mask (that is, convert to lower-case bases) the FASTA sequence"
+            help="By default, hard-masking (that is, conversion to Ns) is performed. (-soft)" />
+        <param name="mc" type="text"  value="N" length="1"
+            label="Replace masking character"
+            help="That is, instead of masking with Ns, use another character. (-mc)" />
     </inputs>
     <outputs>
         <data format="fasta" name="output" />
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="soft" value="False" />
+            <output name="output" file="maskFastaBed_result1.bed" ftype="fasta" />
+        </test>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="soft" value="True" />
+            <output name="output" file="maskFastaBed_result2.bed" ftype="fasta" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools maskfasta masks sequences in a FASTA file based on intervals defined in a feature file. The headers in the input FASTA file must exactly match the chromosome column in the feature file. This may be useful fro creating your own masked genome file based on custom annotations or for masking all but your target regions when aligning sequence data from a targeted capture experiment.
@@ -32,6 +51,7 @@
 .. image:: $PATH_TO_IMAGES/maskfasta-glyph.png
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 mergeBed.xml
--- a/mergeBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/mergeBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,60 +6,59 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        mergeBed 
-            -i $input
-            $strandedness
-            $report_number
+<![CDATA[
+        mergeBed
+            -i "${input}"
+            $strand
             -d $distance
-            $nms
-            #if str($scores) != 'none'
-                -scores $scores
-            #end if
-            &gt; $output
+            $header
+            > "${output}"
+]]>
     </command>
     <inputs>
-        <param  name="input" format="bed,gff,vcf" type="data" label="Sort the following BED/VCF/GFF file"/>
-        <param name="strandedness" type="boolean" label="Force strandedness." truevalue="-s" falsevalue="" checked="false" 
-            help="That is, only merge features that are the same strand."/>
-        <param name="report_number" type="boolean" label="Report the number of BED entries that were merged." truevalue="-n" falsevalue="" checked="false" 
-            help="1 is reported if no merging occurred."/>
-        <param name="nms" type="boolean" label="Report the names of the merged features separated by commas." truevalue="-nms" falsevalue="" checked="false" 
-            help="1 is reported if no merging occurred."/>
-
-        <param name="distance" type="integer" value="0" label="Maximum distance between features allowed for features to be merged." 
-            help="That is, overlapping and/or book-ended features are merged."/>
-        <param name="scores" type="select" label="Report the scores of the merged features as">
-            <option value="none" selected="True">Do not report at all</option>
-            <option value="sum">Sum</option>
+        <param  name="input" format="bam,bed,gff,vcf" type="data" label="Sort the following BAM/BED/VCF/GFF file"/>
+        <param name="strand" type="select" label="Calculation based on strandedness?">
+            <option value="" selected="True">Overlaps on either strand</option>
+            <option value="-s">Force strandedness. That is, only merge features that are the same strand.</option>
+            <option value="-S +">Force merge for forward strand only.</option>
+            <option value="-S -">Force merge for reverse strand only.</option>
+        </param>
+        <param name="distance" type="integer" value="0"
+            label="Maximum distance between features allowed for features to be merged"
+            help="That is, overlapping and/or book-ended features are merged. (-d)"/>
+        <expand macro="print_header" />
+        <expand macro="choose_columns" />
+        <expand macro="choose_operations">
             <expand macro="math_options" />
-        </param>
+            <expand macro="additional_math_options" />
+        </expand>
     </inputs>
     <outputs>
         <data format="bed" name="output" metadata_source="input" label="Merged ${input.name}"/>
     </outputs>
     <tests>
         <test>
-            <param name="input" value="0.bed" ftype="bed" />
-            <output name="output" file="0_result.bed" ftype="bed" />
+            <param name="input" value="mergedBed1.bed" ftype="bed" />
+            <output name="output" file="mergedBed_result1.bed" ftype="bed" />
         </test>
         <test>
-            <param name="input" value="1.bed" ftype="bed" />
+            <param name="input" value="mergedBed2.bed" ftype="bed" />
             <param name="strandedness" value="-s" />
-            <output name="output" file="1_result.bed" ftype="bed" />
+            <output name="output" file="mergedBed_result2.bed" ftype="bed" />
         </test>
         <test>
-            <param name="input" value="2.bed" ftype="bed" />
+            <param name="input" value="mergedBed3.bed" ftype="bed" />
             <param name="report_number" value="-n" />
-            <output name="output" file="2_result.bed" ftype="bed" />
+            <output name="output" file="mergedBed_result3.bed" ftype="bed" />
         </test>
         <test>
-            <param name="input" value="3.bed" ftype="bed" />
+            <param name="input" value="mergedBed4.bed" ftype="bed" />
             <param name="distance" value="1000" />
-            <output name="output" file="3_result.bed" ftype="bed" />
+            <output name="output" file="mergedBed_result4.bed" ftype="bed" />
         </test>
     </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools merge combines overlapping or "book-ended" features in an interval file into a single feature which spans all of the combined features.
@@ -197,8 +196,8 @@
   $ bedtools merge -i A.bed -scores collapse
   chr1  100  500  1,2,3
 
-
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 multiCov.xml
--- a/multiCov.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/multiCov.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,53 +6,70 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        bedtools multicov
-        -bed $input1
-        -bam 
-        #for $bam in $bams:
-            $bam.input
+<![CDATA[
+        #for $i, $bam in enumerate( $bams ):
+            ln -s -f $bam ${i}.bam &&
+            ln -s -f $bam.metadata.bam_index ${i}.bam.bai &&
         #end for
-        $strand
-        -f $overlap
-        $reciprocal
-        $split
-        -q $mapq
-        $duplicate
-        $failed
-        $proper
-        &gt; $output
+
+        bedtools multicov
+            -bed $input
+            -bams
+            #for $i, $bam in enumerate( $bams ):
+                ${i}.bam
+            #end for
+            $strand
+            -f $overlap
+            $reciprocal
+            $split
+            -q $q
+            $duplicate
+            $failed
+            $proper
+            > $output
+]]>
     </command>
     <inputs>
-        <param name="input1" format="bed" type="data" label="First sorted BED file" />
+        <param name="input" format="bed" type="data" label="Sorted BED file" />
         <!-- Additional files, if the user needs more -->
-        <repeat name="bams" title="Add BAM files" >
-            <param name="input" format="bam" type="data" label="BAM file" />
-        </repeat>
+        <param name="bams" format="bam" type="data" multiple="True" label="BAM file" />
+
         <expand macro="strand2" />
         <expand macro="overlap" />
-        <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Require that the fraction overlap be reciprocal for A and B. In other words, if -f is 0.90 and -r is used, this requires that B overlap 90% of A and A _also_ overlaps 90% of B." />
+        <expand macro="reciprocal" />
         <expand macro="split" />
-
-        <param name="duplicate" type="boolean" checked="false" truevalue="-D" falsevalue="" label="Include duplicate reads. Default counts non-duplicates only" />
-        <param name="failed" type="boolean" checked="false" truevalue="-F" falsevalue="" label=" 	Include failed-QC reads. Default counts pass-QC reads only" />
-        <param name="proper" type="boolean" checked="false" truevalue="-p" falsevalue="" label="Only count proper pairs. Default counts all alignments with MAPQ > -q argument, regardless of the BAM FLAG field." />
+        <param name="q" type="integer" value="0" label="Minimum mapping quality (MAPQ) allowed" help="(-q)" />
+        <param name="duplicate" type="boolean" checked="False" truevalue="-D" falsevalue=""
+            label="Include duplicate reads"
+            help="Default counts non-duplicates only. (-D)" />
+        <param name="failed" type="boolean" checked="false" truevalue="-F" falsevalue=""
+            label="Include failed-QC reads" 
+            help="Default counts pass-QC reads only (-F)"/>
+        <param name="proper" type="boolean" checked="false" truevalue="-p" falsevalue=""
+            label="Only count proper pairs"
+            help="Default counts all alignments with MAPQ > -q argument, regardless of the BAM FLAG field. (-p)" />
     </inputs>
-
     <outputs>
-        <data format="bed" name="output" label="" />
+        <data name="output" metadata_source="input" format_source="input" />
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="multiCov1.bed" ftype="bed" />
+            <param name="bams" value="srma_in3.bam,srma_in3.bam" ftpye="bam"/>
+            <param name="q" value="1"/>
+            <param name="split" value="False"/>
+            <output name="output" file="multiCovBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-    
+<![CDATA[
 **What it does**
 
 bedtools multicov, reports the count of alignments from multiple position-sorted and indexed BAM files that overlap intervals in a BED file. Specifically, for each BED interval provided, it reports a separate count of overlapping alignments from each BAM file.
 
-.. class:: infomark
-
-bedtools multicov depends upon index BAM files in order to count the number of overlaps in each BAM file. As such, each BAM file should be position sorted (samtool sort aln.bam aln.sort) and indexed (samtools index aln.sort.bam) with either samtools or bamtools.
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 multiIntersectBed.xml
--- a/multiIntersectBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/multiIntersectBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,108 +6,92 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        multiIntersectBed
+<![CDATA[
+        bedtools multiinter
         $header
+        $cluster
+        -filler "${filler}"
         #if $zero.value == True:
             -empty
-            -g ${chromInfo}
-        #end if
-        
-        -i '$input1'
-        '$input2'
-        #for $q in $beds
-            '${q.input}'
-        #end for
-
-        -names
-        #if $name1.choice == "tag":
-            '${input1.name}'
-        #else
-            '${name1.custom_name}'
+            -g $genome
         #end if
 
-        #if $name2.choice == "tag":
-            '${input2.name}'
-        #else
-            '${name2.custom_name}'
+        #if str($tag.tag_select) == "tag":
+            #set files = '" "'.join( [ str( $file ) for $file in $tag.inputs ] )
+            -i "${files}"
+        #else:
+            -i
+            #for $file in $tag.beds:
+                "${file.input}"
+            #end for
+            -names
+            #for $file in $tag.beds:
+                "{$file.custom_name}"
+            #end for
         #end if
 
-        #for $q in $beds
-            #if $q.name.choice == "tag":
-                '${q.input.name}'
-            #else
-                '${q.input.custom_name}'
-            #end if
-        #end for
-        &gt; '$output'
+        > '$output'
+]]>
     </command>
-    
     <inputs>
-        <!-- Make it easy for the user, first two input files are always shown -->
-        <!-- INPUT 1 -->
-        <param name="input1" format="bed" type="data" label="First sorted BED file" />
-        
-        <conditional name="name1">
-            <param name="choice" type="select" label="Sample name">
+        <conditional name="tag">
+            <param name="tag_select" type="select" label="Sample name">
                 <option value="tag" selected="true">Use input's tag</option>
-                <option value="custom">Enter custom table name</option>
+                <option value="custom">Enter custom name per file</option>
             </param>
             <when value="tag">
+                <param name="inputs" format="bed" type="data" multiple="True" label="BED files" />
             </when>
             <when value="custom">
-                <param name="custom_name" type="text" area="false" label="Custom sample name"/>
-            </when>
-        </conditional>
-
-        <!-- INPUT 2 -->
-        <param name="input2" format="bed" type="data" label="Second sorted BED file" />
-        
-        <conditional name="name2">
-            <param name="choice" type="select" label="Sample name">
-                <option value="tag" selected="true">Use input's tag</option>
-                <option value="custom">Enter custom table name</option>
-            </param>
-            <when value="tag">
-            </when>
-            <when value="custom">
-                <param name="custom_name" type="text" area="false" label="Custom sample name"/>
+                <repeat name="beds" title="Add BED files" min="2" >
+                    <param name="input" format="bed" type="data" multiple="True" label="BED file" />
+                    <param name="custom_name" type="text" area="false" label="Custom sample name"/>
+                </repeat>
             </when>
         </conditional>
-
-        <!-- Additional files, if the user needs more -->
-        <repeat name="beds" title="Add'l sorted BED files" >
-            <param name="input" format="bed" type="data" label="BED file" />
-
-            <conditional name="name">
-                <param name="choice" type="select" label="Sample name">
-                    <option value="tag" selected="true">Use input's tag</option>
-                    <option value="custom">Enter custom table name</option>
-                </param>
-                <when value="tag">
-                </when>
-                <when value="custom">
-                    <param name="custom_name" type="text" area="false" label="Custom sample name"/>
-                </when>
-            </conditional>
-        </repeat>
-
-        <param name="header" type="boolean" checked="true" truevalue="-header" falsevalue="" label="Print header line" help="The first line will include the name of each sample." />
-
-        <param name="zero" type="boolean" checked="true" label="Report regions that are not covered by any of the files" help="If set, regions that are not overlapped by any file will also be reported. Requires a valid organism key for all input datasets" />
+        <expand macro="genome" />
+        <param name="cluster" type="boolean" checked="false" truevalue="-cluster" falsevalue="" 
+            label="Invoke Ryan Layers's clustering algorithm"
+            help="(-cluster)" />
+        <param name="zero" type="boolean" checked="true"
+            label="Report regions that are not covered by any of the files"
+            help="If set, regions that are not overlapped by any file will also be reported. Requires a valid organism key for all input datasets" />
+        <param name="filler" type="text" value="N/A"
+            label="Text to use for no-coverage value"
+            help="Can be 0.0, N/A, - or any other value. (-filler)" />
+        <expand macro="print_header" />
 
     </inputs>
-
     <outputs>
-        <data format="tabular" name="output"  metadata_source="input1" label="Common intervals identified from among ${input1.name}, ${input2.name} and so on." />
+        <data format="bed" name="output" />
     </outputs>
+    <tests>
+        <test>
+            <param name="tag_select" value="tag"/>
+            <param name="inputs" value="multiIntersectBed1.bed,multiIntersectBed2.bed,multiIntersectBed3.bed" ftype="bed" />
+            <param name="zero" value="False"/>
+            <output name="output" file="multiIntersectBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="tag_select" value="tag"/>
+            <param name="inputs" value="multiIntersectBed1.bed,multiIntersectBed2.bed,multiIntersectBed3.bed" ftype="bed" />
+            <param name="header" value="True"/>
+            <param name="zero" value="False"/>
+            <output name="output" file="multiIntersectBed_result2.bed" lines_diff="2" ftype="bed" />
+        </test>
+        <test>
+            <param name="tag_select" value="tag"/>
+            <param name="inputs" value="multiIntersectBed1.bed,multiIntersectBed2.bed,multiIntersectBed3.bed" ftype="bed" />
+            <param name="zero" value="True"/>
+            <param name="genome" value="multiIntersectBed1.len"/>
+            <output name="output" file="multiIntersectBed_result3.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-    
+<![CDATA[
 **What it does**
 
-This tool identifies common intervals among multiple, sorted BED files. Intervals can be common among 0 to N of the N input BED files. The pictorial and raw data examples below illustrate the behavior of this tool more clearly.
-
-
-.. image:: http://people.virginia.edu/~arq5x/files/bedtools-galaxy/mbi.png
+This tool identifies common intervals among multiple, sorted BED files. Intervals can be common among 0 to N of the N input BED files.
 
 
 .. class:: warningmark
@@ -131,7 +115,7 @@
 **Example input**::
 
     # a.bed
-    chr1  6   12
+    chr1  6   12bed
     chr1  10  20
     chr1  22  27
     chr1  24  30
@@ -190,7 +174,7 @@
 
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 nucBed.xml
--- a/nucBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/nucBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,34 +6,54 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools nuc
         $strand
         $seq
         $pattern
         $case
-        -fi $fasta 
-        -bed $inputA
-        &gt; $output
+        -fi $fasta
+        -bed $input
+        > $output
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <param format="fasta" name="fasta" type="data" label="Fasta file"/>
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
+        <param format="fasta" name="fasta" type="data" label="FASTA file"/>
 
-        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Profile the sequence according to strand." />
-        <param name="seq" type="boolean" checked="false" truevalue="-seq" falsevalue="" label="Print the extracted sequence." />
-        <param name="pattern" type="boolean" checked="false" truevalue="-pattern" falsevalue="" label="Report the number of times a user-defined sequence is observed (case-sensitive)." />
-        <param name="case" type="boolean" checked="false" truevalue="-C" falsevalue="" label="Igore case when matching -pattern." />
+        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue=""
+            label="Profile the sequence according to strand" help="(-s)"/>
+        <param name="seq" type="boolean" checked="false" truevalue="-seq" falsevalue=""
+            label="Print the extracted sequence" help="(-seq)"/>
+        <param name="pattern" type="boolean" checked="false" truevalue="-pattern" falsevalue=""
+            label="Report the number of times a user-defined sequence is observed" help="case-sensitive (-pattern)" />
+        <param name="case" type="boolean" checked="false" truevalue="-C" falsevalue=""
+            label="Igore case when matching -pattern" help="(-C)"/>
     </inputs>
     <outputs>
-        <data format="fasta" name="output" />
+        <data format="tabular" name="output" />
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <output name="output" file="nucBed_result1.bed" ftype="tabular" />
+        </test>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="seq" value="True" />
+            <output name="output" file="nucBed_result2.bed" ftype="tabular" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Profiles the nucleotide content of intervals in a fasta file.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 overlapBed.xml
--- a/overlapBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/overlapBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,25 +6,37 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        overlap
-        -i $inputA
+<![CDATA[
+        bedtools overlap
+        -i $input
         -cols $cols
-        &gt; $output
+        > $output
+]]>
     </command>
     <inputs>
-        <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
-        <param name="cols" type="text" value="" area="True" size="20x10" label="Specify the columns (1-based) for the starts and ends of the features for which you’d like to compute the overlap/distance. The columns must be listed in the following order: start1,end1,start2,end2" />
+        <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/>
+        <param name="cols" type="data_column" multiple="True" data_ref="input"
+            label="Specify the columns for the starts and ends of the features for which you’d like to compute the overlap/distance"
+            help="The columns must be listed in the following order: start1,end1,start2,end2" />
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label="Overlap of ${inputA.name}"/>
+        <data format_source="input" name="output" metadata_source="input" label="Overlap of ${input.name}"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="input" value="windowBed_result1.bed" ftype="bed" />
+            <param name="cols" value="2,3,5,6" />
+            <output name="output" file="overlapBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 overlap computes the amount of overlap (in the case of positive values) or distance (in the case of negative values) between feature coordinates occurring on the same input line and reports the result at the end of the same line. In this way, it is a useful method for computing custom overlap scores from the output of other BEDTools.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 randomBed.xml
--- a/randomBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/randomBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,30 +6,44 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools random
         -g $genome
         -l $length
         -n $intervals
-        #if $seed.choose:
-        -seed $seed.seed
+        #if $seed.seed_choose:
+            -seed $seed.seed
         #end if
+        > "$output"
+]]>
     </command>
     <inputs>
         <expand macro="genome" />
-        <param name="length" type="integer" value="100" label="The length of the intervals to generate." />
-        <param name="intervals" type="integer" value="1000000" label="The number of intervals to generate." />
+        <param name="length" type="integer" value="100" label="The length of the intervals to generate" help="(-l)" />
+        <param name="intervals" type="integer" value="1000000" label="The number of intervals to generate" help="(-n)" />
         <expand macro="seed" />
     </inputs>
     <outputs>
         <data format="bed" name="output" />
     </outputs>
+    <tests>
+        <test>
+            <param name="genome" value="mm9_chr1.len" />
+            <param name="seed_choose" value="True" />
+            <param name="seed" value="1" />
+            <param name="length" value="5" />
+            <param name="intervals" value="3" />
+            <output name="output" file="randomBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools random will generate a random set of intervals in BED6 format. One can specify both the number (-n) and the size (-l) of the intervals that should be generated.
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 reldist.xml
--- a/reldist.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/reldist.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,31 +6,44 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools reldist
         -a $inputA
         -b $inputB
         $detail
+        > "$output"
+]]>
     </command>
     <inputs>
         <param format="bed,bam,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF/BAM file"/>
         <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/>
-        <param name="detail" type="boolean" checked="false" truevalue="-detail" falsevalue="" label="Instead of a summary, report the relative distance for each interval in A" help="" />
+        <param name="detail" type="boolean" checked="false" truevalue="-detail" falsevalue=""
+            label="Instead of a summary, report the relative distance for each interval in A" help="(-detail)" />
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}"/>
+        <data format_source="inputA" name="output" metadata_source="inputA" label="Relalative distance of ${inputA.name} and ${inputB.name}"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="windowBed_result1.bed" ftype="bed" />
+            <param name="inputB" value="windowBed_result1.bed" ftype="bed" />
+            <output name="output" file="reldistBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
-Traditional approaches to summarizing the similarity between two sets of genomic intervals are based upon the number or proportion of intersecting intervals. However, such measures are largely blind to spatial correlations between the two sets where, dpesite consistent spacing or proximity, intersections are rare (for example, enhancers and transcription start sites rarely overlap, yet they are much closer to one another than two sets of random intervals). Favorov et al [1] proposed a relative distance metric that describes distribution of relative distances between each interval in one set nd the two closest intervals in another set (see figure above). If there is no spatial correlation between the two sets, one would expect the relative distances to be uniformaly distributed among the relative distances ranging from 0 to 0.5. If, however, the intervals tend to be much closer than expected by chance, the distribution of observed relative distances would be shifted towards low relative distance values (e.g., the figure below).
+Traditional approaches to summarizing the similarity between two sets of genomic intervals are based upon the number or proportion of intersecting intervals. However, such measures are largely blind to spatial correlations between the two sets where, dpesite consistent spacing or proximity, intersections are rare (for example, enhancers and transcription start sites rarely overlap, yet they are much closer to one another than two sets of random intervals). Favorov et al proposed a relative distance metric that describes distribution of relative distances between each interval in one set nd the two closest intervals in another set (see figure above). If there is no spatial correlation between the two sets, one would expect the relative distances to be uniformaly distributed among the relative distances ranging from 0 to 0.5. If, however, the intervals tend to be much closer than expected by chance, the distribution of observed relative distances would be shifted towards low relative distance values (e.g., the figure below).
 
 .. image:: $PATH_TO_IMAGES/reldist-glyph.png
 
 .. class:: infomark
 
 @REFERENCES@
-
+]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations">
+        <citation type="doi">10.1371/journal.pcbi.1002529</citation>
+    </expand>
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 shuffleBed.xml
--- a/shuffleBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/shuffleBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,63 +6,107 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools shuffle
         -g $genome
         -i $inputA
         $bedpe
-        #if $seed.choose:
-        -seed $seed.seed
+        #if str($seed.seed_choose) == "True":
+            -seed $seed.seed
         #end if
-        #if $excl.choose:
-        -excl $excl.excl
-        -f $overlap
-        #end if
-         #if $incl.choose:
-        -incl $incl.incl
+        #if str($add_bed.add_bed_select) == "not_be":
+            -excl $add_bed_select.excl
+            -f $add_bed_select.overlap
+        #elif str($add_bed.add_bed_select) == "be":
+            -incl $add_bed_select.incl
         #end if
         $chrom
         $chromfirst
-        $nooverlap
-        $allowBeyond
+        $no_overlap
+        $allow_beyond
         -maxTries $maxtries
-        &gt; $output
+        > $output
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
         <param name="bedpe" type="boolean" label="The file is in BEDPE format" selected="False" truevalue="-bedpe" falsevalue="" />
         <expand macro="genome" />
-        <param name="chrom" type="boolean" label="Keep features in the input file on the same chromosome. Solely permute their location on the chromosome. By default, both the chromosome and position are randomly chosen" selected="False" truevalue="-chrom" falsevalue="" />
+        <param name="chrom" type="boolean" selected="False" truevalue="-chrom" falsevalue=""
+            label="Keep features in the input file on the same chromosome"
+            help="Solely permute their location on the chromosome. By default, both the chromosome and position are randomly chosen. (-chrom)" />
         <expand macro="seed" />
-        <conditional name="excl">
-            <param name="choose" type="boolean" label="Choose a BED file of coordinates in which features from -i should not be placed?" selected="False" truevalue="True" falsevalue="False" />
-            <when value="True">
+        <conditional name="add_bed">
+            <param name="add_bed_select" type="select" label="Choose an additional BED file">
+                <option value="no" selected="True">No additional BED file</option>
+                <option value="not_be">Coordinates in which features from -i should not be placed?</option>
+                <option value="be">coordinates in which features from -i should be placed?</option>
+            </param>
+            <when value="not_be">
                 <param name="excl" type="data" format="bed" label="Choose File" />
                 <expand macro="overlap" />
             </when>
-        </conditional>
-        <conditional name="incl">
-            <param name="choose" type="boolean" label="Choose a BED file of coordinates in which features from -i should be placed?" selected="False" truevalue="True" falsevalue="False" />
-            <when value="True">
+            <when value="be">
                 <param name="incl" type="data" format="bed" label="Choose File" />
             </when>
         </conditional>
-        
         <param name="chromfirst" type="boolean" selected="False" truevalue="-chromFirst" falsevalue="" 
-            label="Instead of choosing a position randomly among the entire genome (the default), first choose a chrom randomly, and then choose a random start coordinate on that chrom. This leads to features being ~uniformly distributed among the chroms, as opposed to features being distribute as a function of chrom size" />
-        <param name="maxtries" type="integer" value="1000" label="Max. number of attempts to find a home for a shuffled interval in the presence of -incl or -excl" />
-        <param name="nooverlap" type="boolean" selected="False" truevalue="-noOverlapping" falsevalue="" label="Don’t allow shuffled intervals to overlap" />
-        <param name="allowBeyond" type="boolean" selected="False" truevalue="-allowBeyondChromEnd" falsevalue="" label="Allow the original the length of the original records to extebd beyond the length of the chromosome." />
+            label="Choose chromosome first"
+            help="Instead of choosing a position randomly among the entire genome (the default), first choose a chrom randomly, and then choose a random start coordinate on that chrom. This leads to features being ~uniformly distributed among the chroms, as opposed to features being distribute as a function of chrom size. (-chromFirst)" />
+        <param name="maxtries" type="integer" value="1000"
+            label="Max. number of attempts to find a home for a shuffled interval in the presence of -incl or -excl" help="(-maxTries)" />
+        <param name="no_overlap" type="boolean" selected="False" truevalue="-noOverlapping" falsevalue=""
+            label="Don’t allow shuffled intervals to overlap" help="(-noOverlapping)" />
+        <param name="allow_beyond" type="boolean" selected="False" truevalue="-allowBeyondChromEnd" falsevalue=""
+            label="Allow the original the length of the original records to extebd beyond the length of the chromosome" help="(-allowBeyondChromEnd)" />
     </inputs>
     <outputs>
         <data format="bed" name="output" />
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="shuffleBed1.bed" ftype="bed" />
+            <param name="genome" value="shuffleBed.len" ftype="tabular" />
+            <param name="chrom" value="" />
+            <param name="seed_choose" value="True" />
+            <param name="seed" value="1" />
+            <output name="output" file="shuffleBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="shuffleBed1.bed" ftype="bed" />
+            <param name="genome" value="shuffleBed.len" ftype="tabular" />
+            <param name="chrom" value="True" />
+            <param name="seed_choose" value="True" />
+            <param name="seed" value="1" />
+            <output name="output" file="shuffleBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="shuffleBed1.bed" ftype="bed" />
+            <param name="genome" value="shuffleBed.len" ftype="tabular" />
+            <param name="excl" value="shuffleBed2.bed" ftype="bed" />
+            <param name="seed_choose" value="True" />
+            <param name="seed" value="1" />
+            <output name="output" file="shuffleBed_result3.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="shuffleBed1.bed" ftype="bed" />
+            <param name="genome" value="shuffleBed.len" ftype="bed" />
+            <param name="allow_beyond" value="True" />
+            <param name="seed_choose" value="True" />
+            <param name="seed" value="1" />
+            <output name="output" file="shuffleBed_result4.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools shuffle will randomly permute the genomic locations of a feature file among a genome defined in a genome file. One can also provide an “exclusions” BED/GFF/VCF file that lists regions where you do not want the permuted features to be placed. For example, one might want to prevent features from being placed in known genome gaps. shuffle is useful as a null basis against which to test the significance of associations of one feature with another.
+
 .. image:: $PATH_TO_IMAGES/shuffle-glyph.png
+
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 slopBed.xml
--- a/slopBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/slopBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,34 +6,56 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools slop
         $pct
         $strand
         -g $genome
         -i $inputA
         #if $addition.addition_select == 'b':
-        -b $addition.b
+            -b $addition.b
         #else:
-        -l $addition.l
-        -r $addition.r
+            -l $addition.l
+            -r $addition.r
         #end if
         $header
-
-        &gt; $output
+        > $output
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
         <expand macro="genome" />
-        <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue="" label="Define -l and -r as a fraction of the feature’s length" help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" />
-        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Define -l and -r based on strand" help="For example. if used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" />
+        <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue=""
+            label="Define -l and -r as a fraction of the feature’s length"
+            help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" />
+        <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue=""
+            label="Define -l and -r based on strand"
+            help="If used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" />
         <expand macro="addition" />
-        <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the input file prior to results." />
+        <expand macro="print_header" />
     </inputs>
     <outputs>
-        <data format="bed" name="output" label=""/>
+        <data format="bed" name="output"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="a.bed" ftype="bed" />
+            <param name="genome" value="mm9_chr1.len" ftype="bed" />
+            <param name="addition_select" value="b" />
+            <param name="b" value="5" />
+            <output name="output" file="slopBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="a.bed" ftype="bed" />
+            <param name="genome" value="mm9_chr1.len" ftype="bed" />
+            <param name="addition_select" value="lr" />
+            <param name="l" value="2" />
+            <param name="r" value="3" />
+            <output name="output" file="slopBed_result2.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools slop will increase the size of each feature in a feature file by a user-defined number of bases. While something like this could be done with an awk '{OFS="\t" print $1,$2-&lt;slop>,$3+&lt;slop>}', bedtools slop will restrict the resizing to the size of the chromosome (i.e. no start &lt; 0 and no end > chromosome size).
@@ -44,6 +66,7 @@
 
 In order to prevent the extension of intervals beyond chromosome boundaries, bedtools slop requires a genome file defining the length of each chromosome or contig.
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 sortBed.xml
--- a/sortBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/sortBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,7 +6,12 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
-        sortBed -i $input $option &gt; $output
+<![CDATA[
+        sortBed 
+            -i $input 
+            $option 
+            > $output
+]]>
     </command>
     <inputs>
         <param format="bed" name="input" type="data" label="Sort the following BED file"/>
@@ -21,13 +26,18 @@
             <option value="-chrThenScoreD">chromosome, then by score (desc).</option>
         </param>
     </inputs>
-
     <outputs>
         <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED)"/>
     </outputs>
-
+    <tests>
+        <test>
+            <param name="input" value="sortBed1.bed" ftype="bed" />
+            <param name="option" value="" />
+            <output name="output" file="sortBed_result1.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Sorts a feature file by chromosome and other criteria.
@@ -40,7 +50,7 @@
 by chromosome then by start position in the following manner: sort -k 1,1 -k2,2 -n a.bed
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 static/images/closest-glyph.png
Binary file static/images/closest-glyph.png has changed
diff -r b8348686a0b9 -r 82aac94b06c3 subtractBed.xml
--- a/subtractBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/subtractBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,37 +6,51 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools subtract
         $strand
         -a $inputA
         -b $inputB
         -f $overlap
         $removeIfOverlap
-        &gt; $output
+        > $output
+]]>
     </command>
     <inputs>
         <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/>
         <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/>
         <expand macro="strand2" />
         <expand macro="overlap" />
-
-        <param name="strand" type="select" label="Calculation based on strandedness?">
-            <option value="" selected="True">Overlaps on either strand</option>
-            <option value="-s">Only overlaps occurring on the **same** strand.</option>
-            <option value="-S">Only overlaps occurring on the **opposite** strand.</option>
-        </param>
-
         <param name="removeIfOverlap" type="select" label="Calculation based on strandedness?">
             <option value="" selected="True">Dont Remove entire feature on overlap</option>
-            <option value="-A">Remove entire feature if any overlap. That is, by default, only subtract the portion of A that overlaps B. Here, if any overlap is found (or -f amount), the entire feature is removed.</option>
-            <option value="-N">Same as -A except when used with -f, the amount is the sum of all features (not any single feature).</option>
+            <option value="-A">Remove entire feature if any overlap. That is, by default, only subtract the portion of A that overlaps B. Here, if any overlap is found (or -f amount), the entire feature is removed</option>
+            <option value="-N">Same as -A except when used with -f, the amount is the sum of all features (not any single feature)</option>
         </param>
     </inputs>
     <outputs>
-        <data format_source="inputA" name="output" metadata_source="inputA" label=""/>
+        <data format_source="inputA" name="output" metadata_source="inputA"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="subtractBed1.bed" ftype="bed" />
+            <param name="inputB" value="subtractBed2.bed" ftype="bed" />
+            <output name="output" file="subtractBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="subtractBed1.bed" ftype="bed" />
+            <param name="inputB" value="subtractBed2.bed" ftype="bed" />
+            <param name="overlap" value="0.80" />
+            <output name="output" file="subtractBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="subtractBed1.bed" ftype="bed" />
+            <param name="inputB" value="subtractBed2.bed" ftype="bed" />
+            <param name="removeIfOverlap" value="-A" />
+            <output name="output" file="subtractBed_result3.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 bedtools subtract searches for features in B that overlap A. If an overlapping feature is found in B, the overlapping portion is removed from A and the remaining portion of A is reported. If a feature in B overlaps all of a feature in A, the A feature will not be reported.
@@ -44,6 +58,7 @@
 .. image:: $PATH_TO_IMAGES/subtract-glyph.png
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 tagBed.xml
--- a/tagBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/tagBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,46 +6,50 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
+        #set files = '" "'.join( [ str( $file ) for $file in $inputB ] )
         bedtools tag
-        -i $inputA
-        -files 
-        #for $bed in beds:
-            $bed.input
-        #end for
+        -i "${inputA}"
+        -files "${files}"
         -f $overlap
         $strand
-        -tag $tag
+        -tag "${tag}"
         $field
-        &gt; $output
+        > "${output}"
+]]>
     </command>
     <inputs>
-        <param format="bam" name="inputA" type="data" label="BAM file"/>
-
-        <repeat name="beds" title="Add files" >
-            <param name="input" format="bed,gff,vcf" type="data" label="BED/VCF/GFF file" />
-        </repeat>
+        <param name="inputA" format="bam" type="data" label="BAM file"/>
+        <param name="inputB" format="bed,gff,vcf" multiple="True" type="data" label="BED/VCF/GFF file" />
         <expand macro="strand2" />
         <expand macro="overlap" />
-        
-        <param name="tag" type="text" value="YB" label="Dictate what the tag should be." />
-        <param name="field" type="select" label="Use which field from the annotation files to populate tags?">
-            <option value="-labels" selected="True">labels</option>
+        <param name="tag" type="text" value="YB" label="Specify the tag to use" />
+        <param name="field" type="select" label="Field from the annotation files to populate tags?">
+            <option value="-labels" selected="True">Labels</option>
             <option value="-scores">Scores</option>
             <option value="-names">Names</option>
             <option value="-labels -intervals">Intervals</option>
         </param>
     </inputs>
     <outputs>
-        <data format="bed" name="output" label="" />
+        <data format="bam" name="output"/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="srma_in3.bam" ftype="bam" />
+            <param name="inputB" value="tagBed1.bed" ftype="bed" />
+            <param name="field" value="-names" />
+            <output name="output" file="tagBed_result1.bam" ftype="bam" />
+        </test>
+    </tests>
     <help>
-    
+<![CDATA[
 **What it does**
 
 Annotates a BAM file based on overlaps with multiple BED/GFF/VCF files on the intervals in an input bam file
 
 @REFERENCES@
-
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/0.bed
--- a/test-data/0.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4 +0,0 @@
-chr1	100	200
-chr1	180	250
-chr1	250	500
-chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/0_result.bed
--- a/test-data/0_result.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-chr1	100	500
-chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/1.bed
--- a/test-data/1.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4 +0,0 @@
-chr1	100	200	a1	1	+
-chr1	180	250	a2	2	+
-chr1	250	500	a3	3	-
-chr1	501	1000	a4	4	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/1_result.bed
--- a/test-data/1_result.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,3 +0,0 @@
-chr1	100	250	+
-chr1	501	1000	+
-chr1	250	500	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/2.bed
--- a/test-data/2.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4 +0,0 @@
-chr1	100	200
-chr1	180	250
-chr1	250	500
-chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/2_result.bed
--- a/test-data/2_result.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-chr1	100	500	3
-chr1	501	1000	1
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/3.bed
--- a/test-data/3.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-chr1	100	200
-chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/3_result_1000.bed
--- a/test-data/3_result_1000.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-chr1	100	200	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/A.bed
--- a/test-data/A.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,5 +0,0 @@
-chr1	100	200
-chr1	180	250
-chr1	250	500
-chr1	501	1000
-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/a.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	100	200
+chr1	180	250
+chr1	250	500
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/annotateBed_result.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotateBed_result.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	100	200	nasty	1	-	0.500000	1.000000	0.300000
+chr2	500	1000	ugly	2	+	0.000000	0.600000	1.000000
+chr3	1000	5000	big	3	-	1.000000	0.250000	0.000000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bamToBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamToBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+dummy_chr	1278	1354	GA5:3:2:1710:1301#0	18	+
+dummy_chr	128881	128957	GA5:3:24:462:583#0	37	+
+dummy_chr	5591012	5591088	GA5:3:29:1241:1653#0	37	+
+dummy_chr	11880047	11880123	GA5:3:33:1591:303#0	37	+
+dummy_chr	11880930	11881006	GA5:3:31:677:1537#0	37	-
+dummy_chr	11913867	11913943	GA5:3:49:1480:1116#0	37	-
+dummy_chr	13030395	13030471	GA5:3:61:213:1812#0	37	-
+dummy_chr	15055983	15056059	GA5:3:116:1581:552#0	37	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bamToBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamToBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+dummy_chr	1278	1354	GA5:3:2:1710:1301#0	0	+
+dummy_chr	128881	128957	GA5:3:24:462:583#0	3	+
+dummy_chr	5591012	5591088	GA5:3:29:1241:1653#0	1	+
+dummy_chr	11880047	11880123	GA5:3:33:1591:303#0	0	+
+dummy_chr	11880930	11881006	GA5:3:31:677:1537#0	0	-
+dummy_chr	11913867	11913943	GA5:3:49:1480:1116#0	1	-
+dummy_chr	13030395	13030471	GA5:3:61:213:1812#0	1	-
+dummy_chr	15055983	15056059	GA5:3:116:1581:552#0	0	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bed12.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bed12.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	14756	15038	JUNC00000001	294	-	14756	15038	255,0,0	2	73,69	0,213
+chr1	14969	15836	JUNC00000002	144	-	14969	15836	255,0,0	2	69,41	0,826
+chr1	15905	16677	JUNC00000003	12	-	15905	16677	255,0,0	2	42,71	0,701
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bed12ToBed6_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bed12ToBed6_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+chr1	14756	14829	JUNC00000001	294	-
+chr1	14969	15038	JUNC00000001	294	-
+chr1	14969	15038	JUNC00000002	144	-
+chr1	15795	15836	JUNC00000002	144	-
+chr1	15905	15947	JUNC00000003	12	-
+chr1	16606	16677	JUNC00000003	12	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bedToBam1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bedToBam1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,5 @@
+chr1	100	200	foo
+chr1	180	250	bar
+chr1	250	500	world
+chr1	501	1000	peace
+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bedToBam_result.bam
Binary file test-data/bedToBam_result.bam has changed
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bedpeToBamBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bedpeToBamBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	200	chr5	5000	5100	bedpe_example1	30	+	-
+chr9	1000	5000	chr9	3000	3800	bedpe_example2	100	+	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/bedpeToBam_result1.bam
Binary file test-data/bedpeToBam_result1.bam has changed
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_a.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_a.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	10	20	a1	1	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_b1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_b1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	5	6	b1.1	1	-
+chr1	30	40	b1.2	2	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_b2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_b2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	0	1	b2.1	1	-
+chr1	21	22	b2.2	2	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_c.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_c.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	10	20	a1	1	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_d.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_d.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	7	8	b1	1	+
+chr1	22	23	b2	2	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	100	200	chr1	500	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	10	20	a1	1	-	1	chr1	5	6	b1.1	1	-	5
+chr1	10	20	a1	1	-	2	chr1	21	22	b2.2	2	+	2
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	10	20	a1	1	-	2	chr1	21	22	b2.2	2	+	2
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_result4.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_result4.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	10	20	a1	1	+	chr1	7	8	b1	1	+	-3
+chr1	10	20	a1	1	+	chr1	22	23	b2	2	-	3
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/closestBed_result5.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/closestBed_result5.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	10	20	a1	1	+	chr1	7	8	b1	1	+	-3
+chr1	10	20	a1	1	+	chr1	22	23	b2	2	-	3
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/clusterBed_result.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/clusterBed_result.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	100	200	1
+chr1	180	250	1
+chr1	250	500	1
+chr1	501	1000	2
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/complementBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/complementBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	0	100
+chr1	500	501
+chr1	1000	197195432
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/coverageBedA.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/coverageBedA.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	10	20
+chr1	20	30
+chr1	30	40
+chr1	100	200
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/coverageBedB.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/coverageBedB.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	0	100
+chr1	100	200
+chr2	0	100
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/coverageBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/coverageBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	10	20	1	10	10	1.0000000
+chr1	20	30	1	10	10	1.0000000
+chr1	30	40	1	10	10	1.0000000
+chr1	100	200	1	100	100	1.0000000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/expandBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/expandBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	10	20	1,2,3	10,20,30
+chr1	40	50	4,5,6	40,50,60
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/expandBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/expandBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+chr1	10	20	1,2,3	10
+chr1	10	20	1,2,3	20
+chr1	10	20	1,2,3	30
+chr1	40	50	4,5,6	40
+chr1	40	50	4,5,6	50
+chr1	40	50	4,5,6	60
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/expandBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/expandBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+chr1	10	20	1	10
+chr1	10	20	2	20
+chr1	10	20	3	30
+chr1	40	50	4	40
+chr1	40	50	5	50
+chr1	40	50	6	60
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/fisherBed.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fisherBed.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	500
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/fisherBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fisherBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20
+chr1	30	40
+chr1	51	52
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/fisherBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fisherBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	15	25
+chr1	51	52
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/fisherBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fisherBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,14 @@
+# Number of query intervals: 3
+# Number of db intervals: 2
+# Number of overlaps: 2
+# Number of possible intervals (estimated): 34
+# phyper(2 - 1, 3, 34 - 3, 2, lower.tail=F)
+# Contingency Table Of Counts
+#_________________________________________
+#           |  in -b       | not in -b    |
+#     in -a | 2            | 1            |
+# not in -a | 0            | 31           |
+#_________________________________________
+# p-values for fisher's exact test
+left	right	two-tail	ratio
+1	0.0053476	0.0053476	inf
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/flankBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/flankBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+chr1	95	100
+chr1	200	205
+chr1	175	180
+chr1	250	255
+chr1	245	250
+chr1	500	505
+chr1	496	501
+chr1	1000	1005
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/flankBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/flankBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+chr1	98	100
+chr1	200	203
+chr1	178	180
+chr1	250	253
+chr1	248	250
+chr1	500	503
+chr1	499	501
+chr1	1000	1003
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/genomeCoverageBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/genomeCoverageBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20
+chr1	20	30
+chr2	0	500
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/genomeCoverageBed1.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/genomeCoverageBed1.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	1000
+chr2	500
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/genomeCoverageBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/genomeCoverageBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	0	1000	1000	1
+chr2	0	500	500	1
+genome	0	1500	1500	1
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/getfastaBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/getfastaBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+>chr1:10-100
+TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/getfastaBed_result2.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/getfastaBed_result2.tabular	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1:10-100	TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/groupbyBed.bed
--- a/test-data/groupbyBed.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,14 +0,0 @@
-chr21	9719758	9729320	variant1	chr21	9719768	9721892	ALR/Alpha	1004	+
-chr21	9719758	9729320	variant1	chr21	9721905	9725582	ALR/Alpha	1010	+
-chr21	9719758	9729320	variant1	chr21	9725582	9725977	L1PA3	3288	+
-chr21	9719758	9729320	variant1	chr21	9726021	9729309	ALR/Alpha	1051	+
-chr21	9729310	9757478	variant2	chr21	9729320	9729809	L1PA3	3897	-
-chr21	9729310	9757478	variant2	chr21	9729809	9730866	L1P1	8367	+
-chr21	9729310	9757478	variant2	chr21	9730866	9734026	ALR/Alpha	1036	-
-chr21	9729310	9757478	variant2	chr21	9734037	9757471	ALR/Alpha	1182	-
-chr21	9795588	9796685	variant3	chr21	9795589	9795713	(GAATG)n	308	+
-chr21	9795588	9796685	variant3	chr21	9795736	9795894	(GAATG)n	683	+
-chr21	9795588	9796685	variant3	chr21	9795911	9796007	(GAATG)n	345	+
-chr21	9795588	9796685	variant3	chr21	9796028	9796187	(GAATG)n	756	+
-chr21	9795588	9796685	variant3	chr21	9796202	9796615	(GAATG)n	891	+
-chr21	9795588	9796685	variant3	chr21	9796637	9796824	(GAATG)n	621	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/groupbyBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/groupbyBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,14 @@
+chr21	9719758	9729320	variant1	chr21	9719768	9721892	ALR/Alpha	1004	+
+chr21	9719758	9729320	variant1	chr21	9721905	9725582	ALR/Alpha	1010	+
+chr21	9719758	9729320	variant1	chr21	9725582	9725977	L1PA3	3288	+
+chr21	9719758	9729320	variant1	chr21	9726021	9729309	ALR/Alpha	1051	+
+chr21	9729310	9757478	variant2	chr21	9729320	9729809	L1PA3	3897	-
+chr21	9729310	9757478	variant2	chr21	9729809	9730866	L1P1	8367	+
+chr21	9729310	9757478	variant2	chr21	9730866	9734026	ALR/Alpha	1036	-
+chr21	9729310	9757478	variant2	chr21	9734037	9757471	ALR/Alpha	1182	-
+chr21	9795588	9796685	variant3	chr21	9795589	9795713	(GAATG)n	308	+
+chr21	9795588	9796685	variant3	chr21	9795736	9795894	(GAATG)n	683	+
+chr21	9795588	9796685	variant3	chr21	9795911	9796007	(GAATG)n	345	+
+chr21	9795588	9796685	variant3	chr21	9796028	9796187	(GAATG)n	756	+
+chr21	9795588	9796685	variant3	chr21	9796202	9796615	(GAATG)n	891	+
+chr21	9795588	9796685	variant3	chr21	9796637	9796824	(GAATG)n	621	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/groupbyBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/groupbyBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr21	9719758	9729320	6353
+chr21	9729310	9757478	14482
+chr21	9795588	9796685	3604
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/groupbyBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/groupbyBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr21	9719758	9729320	1004
+chr21	9729310	9757478	1036
+chr21	9795588	9796685	308
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/groupbyBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/groupbyBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr21	9719758	9729320	variant1	1030.5
+chr21	9729310	9757478	variant2	2539.5
+chr21	9795588	9796685	variant3	652
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/groupbyinput.bed
--- a/test-data/groupbyinput.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,14 +0,0 @@
-chr21	9719758	9729320	variant1	chr21	9719768	9721892	ALR/Alpha	1004	+
-chr21	9719758	9729320	variant1	chr21	9721905	9725582	ALR/Alpha	1010	+
-chr21	9719758	9729320	variant1	chr21	9725582	9725977	L1PA3	3288	+
-chr21	9719758	9729320	variant1	chr21	9726021	9729309	ALR/Alpha	1051	+
-chr21	9729310	9757478	variant2	chr21	9729320	9729809	L1PA3	3897	-
-chr21	9729310	9757478	variant2	chr21	9729809	9730866	L1P1	8367	+
-chr21	9729310	9757478	variant2	chr21	9730866	9734026	ALR/Alpha	1036	-
-chr21	9729310	9757478	variant2	chr21	9734037	9757471	ALR/Alpha	1182	-
-chr21	9795588	9796685	variant3	chr21	9795589	9795713	(GAATG)n	308	+
-chr21	9795588	9796685	variant3	chr21	9795736	9795894	(GAATG)n	683	+
-chr21	9795588	9796685	variant3	chr21	9795911	9796007	(GAATG)n	345	+
-chr21	9795588	9796685	variant3	chr21	9796028	9796187	(GAATG)n	756	+
-chr21	9795588	9796685	variant3	chr21	9796202	9796615	(GAATG)n	891	+
-chr21	9795588	9796685	variant3	chr21	9796637	9796824	(GAATG)n	621	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/intersectBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/intersectBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	10	20
+chr1	30	40
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/intersectBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/intersectBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	15	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/intersectBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/intersectBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	10	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/intersectBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/intersectBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	10	20	chr1	15	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/intersectBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/intersectBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	30	40
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/jaccardBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/jaccardBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	10	20
+chr1	30	40
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/jaccardBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/jaccardBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	15	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/jaccardBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/jaccardBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+intersection	union-intersection	jaccard	n_intersections
+5	20	0.25	1
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/jaccardBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/jaccardBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+intersection	union-intersection	jaccard	n_intersections
+5	20	0.25	1
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/linksBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/linksBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr21	9928613	10012791	uc002yip.1 0	-
+chr21	9928613	10012791	uc002yiq.1 0	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/linksBed_result1.html
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/linksBed_result1.html	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,33 @@
+<html>
+	<body>
+<title>/tmp/tmp5hihJcfiles/000/dataset_1.dat</title>
+<br>Firefox users: Press and hold the "apple" or "alt" key and click link to open in new tab.
+<p style="font-family:courier">
+<table border="0" align="justify"
+<h3>BED Entries from: stdin </h3>
+<tr>
+	<td>
+		<a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=&db=&position=chr21:9928613-10012791>chr21:9928614-10012791</a>
+	</td>
+	<td>
+uc002yip.1 0
+	</td>
+	<td>
+-
+	</td>
+</tr>
+<tr>
+	<td>
+		<a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=&db=&position=chr21:9928613-10012791>chr21:9928614-10012791</a>
+	</td>
+	<td>
+uc002yiq.1 0
+	</td>
+	<td>
+-
+	</td>
+</tr>
+</table>
+</p>
+	</body>
+</html>
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/linksBed_result2.html
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/linksBed_result2.html	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,33 @@
+<html>
+	<body>
+<title>/tmp/tmp5hihJcfiles/000/dataset_3.dat</title>
+<br>Firefox users: Press and hold the "apple" or "alt" key and click link to open in new tab.
+<p style="font-family:courier">
+<table border="0" align="justify"
+<h3>BED Entries from: stdin </h3>
+<tr>
+	<td>
+		<a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=mouse&db=mm9&position=chr21:9928613-10012791>chr21:9928614-10012791</a>
+	</td>
+	<td>
+uc002yip.1 0
+	</td>
+	<td>
+-
+	</td>
+</tr>
+<tr>
+	<td>
+		<a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=mouse&db=mm9&position=chr21:9928613-10012791>chr21:9928614-10012791</a>
+	</td>
+	<td>
+uc002yiq.1 0
+	</td>
+	<td>
+-
+	</td>
+</tr>
+</table>
+</p>
+	</body>
+</html>
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/makeWindowBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/makeWindowBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr5	60000	70000
+chr5	73000	90000
+chr5	100000	101000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/makeWindowBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/makeWindowBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,198 @@
+chr1	0	1000000
+chr1	1000000	2000000
+chr1	2000000	3000000
+chr1	3000000	4000000
+chr1	4000000	5000000
+chr1	5000000	6000000
+chr1	6000000	7000000
+chr1	7000000	8000000
+chr1	8000000	9000000
+chr1	9000000	10000000
+chr1	10000000	11000000
+chr1	11000000	12000000
+chr1	12000000	13000000
+chr1	13000000	14000000
+chr1	14000000	15000000
+chr1	15000000	16000000
+chr1	16000000	17000000
+chr1	17000000	18000000
+chr1	18000000	19000000
+chr1	19000000	20000000
+chr1	20000000	21000000
+chr1	21000000	22000000
+chr1	22000000	23000000
+chr1	23000000	24000000
+chr1	24000000	25000000
+chr1	25000000	26000000
+chr1	26000000	27000000
+chr1	27000000	28000000
+chr1	28000000	29000000
+chr1	29000000	30000000
+chr1	30000000	31000000
+chr1	31000000	32000000
+chr1	32000000	33000000
+chr1	33000000	34000000
+chr1	34000000	35000000
+chr1	35000000	36000000
+chr1	36000000	37000000
+chr1	37000000	38000000
+chr1	38000000	39000000
+chr1	39000000	40000000
+chr1	40000000	41000000
+chr1	41000000	42000000
+chr1	42000000	43000000
+chr1	43000000	44000000
+chr1	44000000	45000000
+chr1	45000000	46000000
+chr1	46000000	47000000
+chr1	47000000	48000000
+chr1	48000000	49000000
+chr1	49000000	50000000
+chr1	50000000	51000000
+chr1	51000000	52000000
+chr1	52000000	53000000
+chr1	53000000	54000000
+chr1	54000000	55000000
+chr1	55000000	56000000
+chr1	56000000	57000000
+chr1	57000000	58000000
+chr1	58000000	59000000
+chr1	59000000	60000000
+chr1	60000000	61000000
+chr1	61000000	62000000
+chr1	62000000	63000000
+chr1	63000000	64000000
+chr1	64000000	65000000
+chr1	65000000	66000000
+chr1	66000000	67000000
+chr1	67000000	68000000
+chr1	68000000	69000000
+chr1	69000000	70000000
+chr1	70000000	71000000
+chr1	71000000	72000000
+chr1	72000000	73000000
+chr1	73000000	74000000
+chr1	74000000	75000000
+chr1	75000000	76000000
+chr1	76000000	77000000
+chr1	77000000	78000000
+chr1	78000000	79000000
+chr1	79000000	80000000
+chr1	80000000	81000000
+chr1	81000000	82000000
+chr1	82000000	83000000
+chr1	83000000	84000000
+chr1	84000000	85000000
+chr1	85000000	86000000
+chr1	86000000	87000000
+chr1	87000000	88000000
+chr1	88000000	89000000
+chr1	89000000	90000000
+chr1	90000000	91000000
+chr1	91000000	92000000
+chr1	92000000	93000000
+chr1	93000000	94000000
+chr1	94000000	95000000
+chr1	95000000	96000000
+chr1	96000000	97000000
+chr1	97000000	98000000
+chr1	98000000	99000000
+chr1	99000000	100000000
+chr1	100000000	101000000
+chr1	101000000	102000000
+chr1	102000000	103000000
+chr1	103000000	104000000
+chr1	104000000	105000000
+chr1	105000000	106000000
+chr1	106000000	107000000
+chr1	107000000	108000000
+chr1	108000000	109000000
+chr1	109000000	110000000
+chr1	110000000	111000000
+chr1	111000000	112000000
+chr1	112000000	113000000
+chr1	113000000	114000000
+chr1	114000000	115000000
+chr1	115000000	116000000
+chr1	116000000	117000000
+chr1	117000000	118000000
+chr1	118000000	119000000
+chr1	119000000	120000000
+chr1	120000000	121000000
+chr1	121000000	122000000
+chr1	122000000	123000000
+chr1	123000000	124000000
+chr1	124000000	125000000
+chr1	125000000	126000000
+chr1	126000000	127000000
+chr1	127000000	128000000
+chr1	128000000	129000000
+chr1	129000000	130000000
+chr1	130000000	131000000
+chr1	131000000	132000000
+chr1	132000000	133000000
+chr1	133000000	134000000
+chr1	134000000	135000000
+chr1	135000000	136000000
+chr1	136000000	137000000
+chr1	137000000	138000000
+chr1	138000000	139000000
+chr1	139000000	140000000
+chr1	140000000	141000000
+chr1	141000000	142000000
+chr1	142000000	143000000
+chr1	143000000	144000000
+chr1	144000000	145000000
+chr1	145000000	146000000
+chr1	146000000	147000000
+chr1	147000000	148000000
+chr1	148000000	149000000
+chr1	149000000	150000000
+chr1	150000000	151000000
+chr1	151000000	152000000
+chr1	152000000	153000000
+chr1	153000000	154000000
+chr1	154000000	155000000
+chr1	155000000	156000000
+chr1	156000000	157000000
+chr1	157000000	158000000
+chr1	158000000	159000000
+chr1	159000000	160000000
+chr1	160000000	161000000
+chr1	161000000	162000000
+chr1	162000000	163000000
+chr1	163000000	164000000
+chr1	164000000	165000000
+chr1	165000000	166000000
+chr1	166000000	167000000
+chr1	167000000	168000000
+chr1	168000000	169000000
+chr1	169000000	170000000
+chr1	170000000	171000000
+chr1	171000000	172000000
+chr1	172000000	173000000
+chr1	173000000	174000000
+chr1	174000000	175000000
+chr1	175000000	176000000
+chr1	176000000	177000000
+chr1	177000000	178000000
+chr1	178000000	179000000
+chr1	179000000	180000000
+chr1	180000000	181000000
+chr1	181000000	182000000
+chr1	182000000	183000000
+chr1	183000000	184000000
+chr1	184000000	185000000
+chr1	185000000	186000000
+chr1	186000000	187000000
+chr1	187000000	188000000
+chr1	188000000	189000000
+chr1	189000000	190000000
+chr1	190000000	191000000
+chr1	191000000	192000000
+chr1	192000000	193000000
+chr1	193000000	194000000
+chr1	194000000	195000000
+chr1	195000000	196000000
+chr1	196000000	197000000
+chr1	197000000	197195432
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/makeWindowBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/makeWindowBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3944 @@
+chr1	0	1000000
+chr1	50000	1050000
+chr1	100000	1100000
+chr1	150000	1150000
+chr1	200000	1200000
+chr1	250000	1250000
+chr1	300000	1300000
+chr1	350000	1350000
+chr1	400000	1400000
+chr1	450000	1450000
+chr1	500000	1500000
+chr1	550000	1550000
+chr1	600000	1600000
+chr1	650000	1650000
+chr1	700000	1700000
+chr1	750000	1750000
+chr1	800000	1800000
+chr1	850000	1850000
+chr1	900000	1900000
+chr1	950000	1950000
+chr1	1000000	2000000
+chr1	1050000	2050000
+chr1	1100000	2100000
+chr1	1150000	2150000
+chr1	1200000	2200000
+chr1	1250000	2250000
+chr1	1300000	2300000
+chr1	1350000	2350000
+chr1	1400000	2400000
+chr1	1450000	2450000
+chr1	1500000	2500000
+chr1	1550000	2550000
+chr1	1600000	2600000
+chr1	1650000	2650000
+chr1	1700000	2700000
+chr1	1750000	2750000
+chr1	1800000	2800000
+chr1	1850000	2850000
+chr1	1900000	2900000
+chr1	1950000	2950000
+chr1	2000000	3000000
+chr1	2050000	3050000
+chr1	2100000	3100000
+chr1	2150000	3150000
+chr1	2200000	3200000
+chr1	2250000	3250000
+chr1	2300000	3300000
+chr1	2350000	3350000
+chr1	2400000	3400000
+chr1	2450000	3450000
+chr1	2500000	3500000
+chr1	2550000	3550000
+chr1	2600000	3600000
+chr1	2650000	3650000
+chr1	2700000	3700000
+chr1	2750000	3750000
+chr1	2800000	3800000
+chr1	2850000	3850000
+chr1	2900000	3900000
+chr1	2950000	3950000
+chr1	3000000	4000000
+chr1	3050000	4050000
+chr1	3100000	4100000
+chr1	3150000	4150000
+chr1	3200000	4200000
+chr1	3250000	4250000
+chr1	3300000	4300000
+chr1	3350000	4350000
+chr1	3400000	4400000
+chr1	3450000	4450000
+chr1	3500000	4500000
+chr1	3550000	4550000
+chr1	3600000	4600000
+chr1	3650000	4650000
+chr1	3700000	4700000
+chr1	3750000	4750000
+chr1	3800000	4800000
+chr1	3850000	4850000
+chr1	3900000	4900000
+chr1	3950000	4950000
+chr1	4000000	5000000
+chr1	4050000	5050000
+chr1	4100000	5100000
+chr1	4150000	5150000
+chr1	4200000	5200000
+chr1	4250000	5250000
+chr1	4300000	5300000
+chr1	4350000	5350000
+chr1	4400000	5400000
+chr1	4450000	5450000
+chr1	4500000	5500000
+chr1	4550000	5550000
+chr1	4600000	5600000
+chr1	4650000	5650000
+chr1	4700000	5700000
+chr1	4750000	5750000
+chr1	4800000	5800000
+chr1	4850000	5850000
+chr1	4900000	5900000
+chr1	4950000	5950000
+chr1	5000000	6000000
+chr1	5050000	6050000
+chr1	5100000	6100000
+chr1	5150000	6150000
+chr1	5200000	6200000
+chr1	5250000	6250000
+chr1	5300000	6300000
+chr1	5350000	6350000
+chr1	5400000	6400000
+chr1	5450000	6450000
+chr1	5500000	6500000
+chr1	5550000	6550000
+chr1	5600000	6600000
+chr1	5650000	6650000
+chr1	5700000	6700000
+chr1	5750000	6750000
+chr1	5800000	6800000
+chr1	5850000	6850000
+chr1	5900000	6900000
+chr1	5950000	6950000
+chr1	6000000	7000000
+chr1	6050000	7050000
+chr1	6100000	7100000
+chr1	6150000	7150000
+chr1	6200000	7200000
+chr1	6250000	7250000
+chr1	6300000	7300000
+chr1	6350000	7350000
+chr1	6400000	7400000
+chr1	6450000	7450000
+chr1	6500000	7500000
+chr1	6550000	7550000
+chr1	6600000	7600000
+chr1	6650000	7650000
+chr1	6700000	7700000
+chr1	6750000	7750000
+chr1	6800000	7800000
+chr1	6850000	7850000
+chr1	6900000	7900000
+chr1	6950000	7950000
+chr1	7000000	8000000
+chr1	7050000	8050000
+chr1	7100000	8100000
+chr1	7150000	8150000
+chr1	7200000	8200000
+chr1	7250000	8250000
+chr1	7300000	8300000
+chr1	7350000	8350000
+chr1	7400000	8400000
+chr1	7450000	8450000
+chr1	7500000	8500000
+chr1	7550000	8550000
+chr1	7600000	8600000
+chr1	7650000	8650000
+chr1	7700000	8700000
+chr1	7750000	8750000
+chr1	7800000	8800000
+chr1	7850000	8850000
+chr1	7900000	8900000
+chr1	7950000	8950000
+chr1	8000000	9000000
+chr1	8050000	9050000
+chr1	8100000	9100000
+chr1	8150000	9150000
+chr1	8200000	9200000
+chr1	8250000	9250000
+chr1	8300000	9300000
+chr1	8350000	9350000
+chr1	8400000	9400000
+chr1	8450000	9450000
+chr1	8500000	9500000
+chr1	8550000	9550000
+chr1	8600000	9600000
+chr1	8650000	9650000
+chr1	8700000	9700000
+chr1	8750000	9750000
+chr1	8800000	9800000
+chr1	8850000	9850000
+chr1	8900000	9900000
+chr1	8950000	9950000
+chr1	9000000	10000000
+chr1	9050000	10050000
+chr1	9100000	10100000
+chr1	9150000	10150000
+chr1	9200000	10200000
+chr1	9250000	10250000
+chr1	9300000	10300000
+chr1	9350000	10350000
+chr1	9400000	10400000
+chr1	9450000	10450000
+chr1	9500000	10500000
+chr1	9550000	10550000
+chr1	9600000	10600000
+chr1	9650000	10650000
+chr1	9700000	10700000
+chr1	9750000	10750000
+chr1	9800000	10800000
+chr1	9850000	10850000
+chr1	9900000	10900000
+chr1	9950000	10950000
+chr1	10000000	11000000
+chr1	10050000	11050000
+chr1	10100000	11100000
+chr1	10150000	11150000
+chr1	10200000	11200000
+chr1	10250000	11250000
+chr1	10300000	11300000
+chr1	10350000	11350000
+chr1	10400000	11400000
+chr1	10450000	11450000
+chr1	10500000	11500000
+chr1	10550000	11550000
+chr1	10600000	11600000
+chr1	10650000	11650000
+chr1	10700000	11700000
+chr1	10750000	11750000
+chr1	10800000	11800000
+chr1	10850000	11850000
+chr1	10900000	11900000
+chr1	10950000	11950000
+chr1	11000000	12000000
+chr1	11050000	12050000
+chr1	11100000	12100000
+chr1	11150000	12150000
+chr1	11200000	12200000
+chr1	11250000	12250000
+chr1	11300000	12300000
+chr1	11350000	12350000
+chr1	11400000	12400000
+chr1	11450000	12450000
+chr1	11500000	12500000
+chr1	11550000	12550000
+chr1	11600000	12600000
+chr1	11650000	12650000
+chr1	11700000	12700000
+chr1	11750000	12750000
+chr1	11800000	12800000
+chr1	11850000	12850000
+chr1	11900000	12900000
+chr1	11950000	12950000
+chr1	12000000	13000000
+chr1	12050000	13050000
+chr1	12100000	13100000
+chr1	12150000	13150000
+chr1	12200000	13200000
+chr1	12250000	13250000
+chr1	12300000	13300000
+chr1	12350000	13350000
+chr1	12400000	13400000
+chr1	12450000	13450000
+chr1	12500000	13500000
+chr1	12550000	13550000
+chr1	12600000	13600000
+chr1	12650000	13650000
+chr1	12700000	13700000
+chr1	12750000	13750000
+chr1	12800000	13800000
+chr1	12850000	13850000
+chr1	12900000	13900000
+chr1	12950000	13950000
+chr1	13000000	14000000
+chr1	13050000	14050000
+chr1	13100000	14100000
+chr1	13150000	14150000
+chr1	13200000	14200000
+chr1	13250000	14250000
+chr1	13300000	14300000
+chr1	13350000	14350000
+chr1	13400000	14400000
+chr1	13450000	14450000
+chr1	13500000	14500000
+chr1	13550000	14550000
+chr1	13600000	14600000
+chr1	13650000	14650000
+chr1	13700000	14700000
+chr1	13750000	14750000
+chr1	13800000	14800000
+chr1	13850000	14850000
+chr1	13900000	14900000
+chr1	13950000	14950000
+chr1	14000000	15000000
+chr1	14050000	15050000
+chr1	14100000	15100000
+chr1	14150000	15150000
+chr1	14200000	15200000
+chr1	14250000	15250000
+chr1	14300000	15300000
+chr1	14350000	15350000
+chr1	14400000	15400000
+chr1	14450000	15450000
+chr1	14500000	15500000
+chr1	14550000	15550000
+chr1	14600000	15600000
+chr1	14650000	15650000
+chr1	14700000	15700000
+chr1	14750000	15750000
+chr1	14800000	15800000
+chr1	14850000	15850000
+chr1	14900000	15900000
+chr1	14950000	15950000
+chr1	15000000	16000000
+chr1	15050000	16050000
+chr1	15100000	16100000
+chr1	15150000	16150000
+chr1	15200000	16200000
+chr1	15250000	16250000
+chr1	15300000	16300000
+chr1	15350000	16350000
+chr1	15400000	16400000
+chr1	15450000	16450000
+chr1	15500000	16500000
+chr1	15550000	16550000
+chr1	15600000	16600000
+chr1	15650000	16650000
+chr1	15700000	16700000
+chr1	15750000	16750000
+chr1	15800000	16800000
+chr1	15850000	16850000
+chr1	15900000	16900000
+chr1	15950000	16950000
+chr1	16000000	17000000
+chr1	16050000	17050000
+chr1	16100000	17100000
+chr1	16150000	17150000
+chr1	16200000	17200000
+chr1	16250000	17250000
+chr1	16300000	17300000
+chr1	16350000	17350000
+chr1	16400000	17400000
+chr1	16450000	17450000
+chr1	16500000	17500000
+chr1	16550000	17550000
+chr1	16600000	17600000
+chr1	16650000	17650000
+chr1	16700000	17700000
+chr1	16750000	17750000
+chr1	16800000	17800000
+chr1	16850000	17850000
+chr1	16900000	17900000
+chr1	16950000	17950000
+chr1	17000000	18000000
+chr1	17050000	18050000
+chr1	17100000	18100000
+chr1	17150000	18150000
+chr1	17200000	18200000
+chr1	17250000	18250000
+chr1	17300000	18300000
+chr1	17350000	18350000
+chr1	17400000	18400000
+chr1	17450000	18450000
+chr1	17500000	18500000
+chr1	17550000	18550000
+chr1	17600000	18600000
+chr1	17650000	18650000
+chr1	17700000	18700000
+chr1	17750000	18750000
+chr1	17800000	18800000
+chr1	17850000	18850000
+chr1	17900000	18900000
+chr1	17950000	18950000
+chr1	18000000	19000000
+chr1	18050000	19050000
+chr1	18100000	19100000
+chr1	18150000	19150000
+chr1	18200000	19200000
+chr1	18250000	19250000
+chr1	18300000	19300000
+chr1	18350000	19350000
+chr1	18400000	19400000
+chr1	18450000	19450000
+chr1	18500000	19500000
+chr1	18550000	19550000
+chr1	18600000	19600000
+chr1	18650000	19650000
+chr1	18700000	19700000
+chr1	18750000	19750000
+chr1	18800000	19800000
+chr1	18850000	19850000
+chr1	18900000	19900000
+chr1	18950000	19950000
+chr1	19000000	20000000
+chr1	19050000	20050000
+chr1	19100000	20100000
+chr1	19150000	20150000
+chr1	19200000	20200000
+chr1	19250000	20250000
+chr1	19300000	20300000
+chr1	19350000	20350000
+chr1	19400000	20400000
+chr1	19450000	20450000
+chr1	19500000	20500000
+chr1	19550000	20550000
+chr1	19600000	20600000
+chr1	19650000	20650000
+chr1	19700000	20700000
+chr1	19750000	20750000
+chr1	19800000	20800000
+chr1	19850000	20850000
+chr1	19900000	20900000
+chr1	19950000	20950000
+chr1	20000000	21000000
+chr1	20050000	21050000
+chr1	20100000	21100000
+chr1	20150000	21150000
+chr1	20200000	21200000
+chr1	20250000	21250000
+chr1	20300000	21300000
+chr1	20350000	21350000
+chr1	20400000	21400000
+chr1	20450000	21450000
+chr1	20500000	21500000
+chr1	20550000	21550000
+chr1	20600000	21600000
+chr1	20650000	21650000
+chr1	20700000	21700000
+chr1	20750000	21750000
+chr1	20800000	21800000
+chr1	20850000	21850000
+chr1	20900000	21900000
+chr1	20950000	21950000
+chr1	21000000	22000000
+chr1	21050000	22050000
+chr1	21100000	22100000
+chr1	21150000	22150000
+chr1	21200000	22200000
+chr1	21250000	22250000
+chr1	21300000	22300000
+chr1	21350000	22350000
+chr1	21400000	22400000
+chr1	21450000	22450000
+chr1	21500000	22500000
+chr1	21550000	22550000
+chr1	21600000	22600000
+chr1	21650000	22650000
+chr1	21700000	22700000
+chr1	21750000	22750000
+chr1	21800000	22800000
+chr1	21850000	22850000
+chr1	21900000	22900000
+chr1	21950000	22950000
+chr1	22000000	23000000
+chr1	22050000	23050000
+chr1	22100000	23100000
+chr1	22150000	23150000
+chr1	22200000	23200000
+chr1	22250000	23250000
+chr1	22300000	23300000
+chr1	22350000	23350000
+chr1	22400000	23400000
+chr1	22450000	23450000
+chr1	22500000	23500000
+chr1	22550000	23550000
+chr1	22600000	23600000
+chr1	22650000	23650000
+chr1	22700000	23700000
+chr1	22750000	23750000
+chr1	22800000	23800000
+chr1	22850000	23850000
+chr1	22900000	23900000
+chr1	22950000	23950000
+chr1	23000000	24000000
+chr1	23050000	24050000
+chr1	23100000	24100000
+chr1	23150000	24150000
+chr1	23200000	24200000
+chr1	23250000	24250000
+chr1	23300000	24300000
+chr1	23350000	24350000
+chr1	23400000	24400000
+chr1	23450000	24450000
+chr1	23500000	24500000
+chr1	23550000	24550000
+chr1	23600000	24600000
+chr1	23650000	24650000
+chr1	23700000	24700000
+chr1	23750000	24750000
+chr1	23800000	24800000
+chr1	23850000	24850000
+chr1	23900000	24900000
+chr1	23950000	24950000
+chr1	24000000	25000000
+chr1	24050000	25050000
+chr1	24100000	25100000
+chr1	24150000	25150000
+chr1	24200000	25200000
+chr1	24250000	25250000
+chr1	24300000	25300000
+chr1	24350000	25350000
+chr1	24400000	25400000
+chr1	24450000	25450000
+chr1	24500000	25500000
+chr1	24550000	25550000
+chr1	24600000	25600000
+chr1	24650000	25650000
+chr1	24700000	25700000
+chr1	24750000	25750000
+chr1	24800000	25800000
+chr1	24850000	25850000
+chr1	24900000	25900000
+chr1	24950000	25950000
+chr1	25000000	26000000
+chr1	25050000	26050000
+chr1	25100000	26100000
+chr1	25150000	26150000
+chr1	25200000	26200000
+chr1	25250000	26250000
+chr1	25300000	26300000
+chr1	25350000	26350000
+chr1	25400000	26400000
+chr1	25450000	26450000
+chr1	25500000	26500000
+chr1	25550000	26550000
+chr1	25600000	26600000
+chr1	25650000	26650000
+chr1	25700000	26700000
+chr1	25750000	26750000
+chr1	25800000	26800000
+chr1	25850000	26850000
+chr1	25900000	26900000
+chr1	25950000	26950000
+chr1	26000000	27000000
+chr1	26050000	27050000
+chr1	26100000	27100000
+chr1	26150000	27150000
+chr1	26200000	27200000
+chr1	26250000	27250000
+chr1	26300000	27300000
+chr1	26350000	27350000
+chr1	26400000	27400000
+chr1	26450000	27450000
+chr1	26500000	27500000
+chr1	26550000	27550000
+chr1	26600000	27600000
+chr1	26650000	27650000
+chr1	26700000	27700000
+chr1	26750000	27750000
+chr1	26800000	27800000
+chr1	26850000	27850000
+chr1	26900000	27900000
+chr1	26950000	27950000
+chr1	27000000	28000000
+chr1	27050000	28050000
+chr1	27100000	28100000
+chr1	27150000	28150000
+chr1	27200000	28200000
+chr1	27250000	28250000
+chr1	27300000	28300000
+chr1	27350000	28350000
+chr1	27400000	28400000
+chr1	27450000	28450000
+chr1	27500000	28500000
+chr1	27550000	28550000
+chr1	27600000	28600000
+chr1	27650000	28650000
+chr1	27700000	28700000
+chr1	27750000	28750000
+chr1	27800000	28800000
+chr1	27850000	28850000
+chr1	27900000	28900000
+chr1	27950000	28950000
+chr1	28000000	29000000
+chr1	28050000	29050000
+chr1	28100000	29100000
+chr1	28150000	29150000
+chr1	28200000	29200000
+chr1	28250000	29250000
+chr1	28300000	29300000
+chr1	28350000	29350000
+chr1	28400000	29400000
+chr1	28450000	29450000
+chr1	28500000	29500000
+chr1	28550000	29550000
+chr1	28600000	29600000
+chr1	28650000	29650000
+chr1	28700000	29700000
+chr1	28750000	29750000
+chr1	28800000	29800000
+chr1	28850000	29850000
+chr1	28900000	29900000
+chr1	28950000	29950000
+chr1	29000000	30000000
+chr1	29050000	30050000
+chr1	29100000	30100000
+chr1	29150000	30150000
+chr1	29200000	30200000
+chr1	29250000	30250000
+chr1	29300000	30300000
+chr1	29350000	30350000
+chr1	29400000	30400000
+chr1	29450000	30450000
+chr1	29500000	30500000
+chr1	29550000	30550000
+chr1	29600000	30600000
+chr1	29650000	30650000
+chr1	29700000	30700000
+chr1	29750000	30750000
+chr1	29800000	30800000
+chr1	29850000	30850000
+chr1	29900000	30900000
+chr1	29950000	30950000
+chr1	30000000	31000000
+chr1	30050000	31050000
+chr1	30100000	31100000
+chr1	30150000	31150000
+chr1	30200000	31200000
+chr1	30250000	31250000
+chr1	30300000	31300000
+chr1	30350000	31350000
+chr1	30400000	31400000
+chr1	30450000	31450000
+chr1	30500000	31500000
+chr1	30550000	31550000
+chr1	30600000	31600000
+chr1	30650000	31650000
+chr1	30700000	31700000
+chr1	30750000	31750000
+chr1	30800000	31800000
+chr1	30850000	31850000
+chr1	30900000	31900000
+chr1	30950000	31950000
+chr1	31000000	32000000
+chr1	31050000	32050000
+chr1	31100000	32100000
+chr1	31150000	32150000
+chr1	31200000	32200000
+chr1	31250000	32250000
+chr1	31300000	32300000
+chr1	31350000	32350000
+chr1	31400000	32400000
+chr1	31450000	32450000
+chr1	31500000	32500000
+chr1	31550000	32550000
+chr1	31600000	32600000
+chr1	31650000	32650000
+chr1	31700000	32700000
+chr1	31750000	32750000
+chr1	31800000	32800000
+chr1	31850000	32850000
+chr1	31900000	32900000
+chr1	31950000	32950000
+chr1	32000000	33000000
+chr1	32050000	33050000
+chr1	32100000	33100000
+chr1	32150000	33150000
+chr1	32200000	33200000
+chr1	32250000	33250000
+chr1	32300000	33300000
+chr1	32350000	33350000
+chr1	32400000	33400000
+chr1	32450000	33450000
+chr1	32500000	33500000
+chr1	32550000	33550000
+chr1	32600000	33600000
+chr1	32650000	33650000
+chr1	32700000	33700000
+chr1	32750000	33750000
+chr1	32800000	33800000
+chr1	32850000	33850000
+chr1	32900000	33900000
+chr1	32950000	33950000
+chr1	33000000	34000000
+chr1	33050000	34050000
+chr1	33100000	34100000
+chr1	33150000	34150000
+chr1	33200000	34200000
+chr1	33250000	34250000
+chr1	33300000	34300000
+chr1	33350000	34350000
+chr1	33400000	34400000
+chr1	33450000	34450000
+chr1	33500000	34500000
+chr1	33550000	34550000
+chr1	33600000	34600000
+chr1	33650000	34650000
+chr1	33700000	34700000
+chr1	33750000	34750000
+chr1	33800000	34800000
+chr1	33850000	34850000
+chr1	33900000	34900000
+chr1	33950000	34950000
+chr1	34000000	35000000
+chr1	34050000	35050000
+chr1	34100000	35100000
+chr1	34150000	35150000
+chr1	34200000	35200000
+chr1	34250000	35250000
+chr1	34300000	35300000
+chr1	34350000	35350000
+chr1	34400000	35400000
+chr1	34450000	35450000
+chr1	34500000	35500000
+chr1	34550000	35550000
+chr1	34600000	35600000
+chr1	34650000	35650000
+chr1	34700000	35700000
+chr1	34750000	35750000
+chr1	34800000	35800000
+chr1	34850000	35850000
+chr1	34900000	35900000
+chr1	34950000	35950000
+chr1	35000000	36000000
+chr1	35050000	36050000
+chr1	35100000	36100000
+chr1	35150000	36150000
+chr1	35200000	36200000
+chr1	35250000	36250000
+chr1	35300000	36300000
+chr1	35350000	36350000
+chr1	35400000	36400000
+chr1	35450000	36450000
+chr1	35500000	36500000
+chr1	35550000	36550000
+chr1	35600000	36600000
+chr1	35650000	36650000
+chr1	35700000	36700000
+chr1	35750000	36750000
+chr1	35800000	36800000
+chr1	35850000	36850000
+chr1	35900000	36900000
+chr1	35950000	36950000
+chr1	36000000	37000000
+chr1	36050000	37050000
+chr1	36100000	37100000
+chr1	36150000	37150000
+chr1	36200000	37200000
+chr1	36250000	37250000
+chr1	36300000	37300000
+chr1	36350000	37350000
+chr1	36400000	37400000
+chr1	36450000	37450000
+chr1	36500000	37500000
+chr1	36550000	37550000
+chr1	36600000	37600000
+chr1	36650000	37650000
+chr1	36700000	37700000
+chr1	36750000	37750000
+chr1	36800000	37800000
+chr1	36850000	37850000
+chr1	36900000	37900000
+chr1	36950000	37950000
+chr1	37000000	38000000
+chr1	37050000	38050000
+chr1	37100000	38100000
+chr1	37150000	38150000
+chr1	37200000	38200000
+chr1	37250000	38250000
+chr1	37300000	38300000
+chr1	37350000	38350000
+chr1	37400000	38400000
+chr1	37450000	38450000
+chr1	37500000	38500000
+chr1	37550000	38550000
+chr1	37600000	38600000
+chr1	37650000	38650000
+chr1	37700000	38700000
+chr1	37750000	38750000
+chr1	37800000	38800000
+chr1	37850000	38850000
+chr1	37900000	38900000
+chr1	37950000	38950000
+chr1	38000000	39000000
+chr1	38050000	39050000
+chr1	38100000	39100000
+chr1	38150000	39150000
+chr1	38200000	39200000
+chr1	38250000	39250000
+chr1	38300000	39300000
+chr1	38350000	39350000
+chr1	38400000	39400000
+chr1	38450000	39450000
+chr1	38500000	39500000
+chr1	38550000	39550000
+chr1	38600000	39600000
+chr1	38650000	39650000
+chr1	38700000	39700000
+chr1	38750000	39750000
+chr1	38800000	39800000
+chr1	38850000	39850000
+chr1	38900000	39900000
+chr1	38950000	39950000
+chr1	39000000	40000000
+chr1	39050000	40050000
+chr1	39100000	40100000
+chr1	39150000	40150000
+chr1	39200000	40200000
+chr1	39250000	40250000
+chr1	39300000	40300000
+chr1	39350000	40350000
+chr1	39400000	40400000
+chr1	39450000	40450000
+chr1	39500000	40500000
+chr1	39550000	40550000
+chr1	39600000	40600000
+chr1	39650000	40650000
+chr1	39700000	40700000
+chr1	39750000	40750000
+chr1	39800000	40800000
+chr1	39850000	40850000
+chr1	39900000	40900000
+chr1	39950000	40950000
+chr1	40000000	41000000
+chr1	40050000	41050000
+chr1	40100000	41100000
+chr1	40150000	41150000
+chr1	40200000	41200000
+chr1	40250000	41250000
+chr1	40300000	41300000
+chr1	40350000	41350000
+chr1	40400000	41400000
+chr1	40450000	41450000
+chr1	40500000	41500000
+chr1	40550000	41550000
+chr1	40600000	41600000
+chr1	40650000	41650000
+chr1	40700000	41700000
+chr1	40750000	41750000
+chr1	40800000	41800000
+chr1	40850000	41850000
+chr1	40900000	41900000
+chr1	40950000	41950000
+chr1	41000000	42000000
+chr1	41050000	42050000
+chr1	41100000	42100000
+chr1	41150000	42150000
+chr1	41200000	42200000
+chr1	41250000	42250000
+chr1	41300000	42300000
+chr1	41350000	42350000
+chr1	41400000	42400000
+chr1	41450000	42450000
+chr1	41500000	42500000
+chr1	41550000	42550000
+chr1	41600000	42600000
+chr1	41650000	42650000
+chr1	41700000	42700000
+chr1	41750000	42750000
+chr1	41800000	42800000
+chr1	41850000	42850000
+chr1	41900000	42900000
+chr1	41950000	42950000
+chr1	42000000	43000000
+chr1	42050000	43050000
+chr1	42100000	43100000
+chr1	42150000	43150000
+chr1	42200000	43200000
+chr1	42250000	43250000
+chr1	42300000	43300000
+chr1	42350000	43350000
+chr1	42400000	43400000
+chr1	42450000	43450000
+chr1	42500000	43500000
+chr1	42550000	43550000
+chr1	42600000	43600000
+chr1	42650000	43650000
+chr1	42700000	43700000
+chr1	42750000	43750000
+chr1	42800000	43800000
+chr1	42850000	43850000
+chr1	42900000	43900000
+chr1	42950000	43950000
+chr1	43000000	44000000
+chr1	43050000	44050000
+chr1	43100000	44100000
+chr1	43150000	44150000
+chr1	43200000	44200000
+chr1	43250000	44250000
+chr1	43300000	44300000
+chr1	43350000	44350000
+chr1	43400000	44400000
+chr1	43450000	44450000
+chr1	43500000	44500000
+chr1	43550000	44550000
+chr1	43600000	44600000
+chr1	43650000	44650000
+chr1	43700000	44700000
+chr1	43750000	44750000
+chr1	43800000	44800000
+chr1	43850000	44850000
+chr1	43900000	44900000
+chr1	43950000	44950000
+chr1	44000000	45000000
+chr1	44050000	45050000
+chr1	44100000	45100000
+chr1	44150000	45150000
+chr1	44200000	45200000
+chr1	44250000	45250000
+chr1	44300000	45300000
+chr1	44350000	45350000
+chr1	44400000	45400000
+chr1	44450000	45450000
+chr1	44500000	45500000
+chr1	44550000	45550000
+chr1	44600000	45600000
+chr1	44650000	45650000
+chr1	44700000	45700000
+chr1	44750000	45750000
+chr1	44800000	45800000
+chr1	44850000	45850000
+chr1	44900000	45900000
+chr1	44950000	45950000
+chr1	45000000	46000000
+chr1	45050000	46050000
+chr1	45100000	46100000
+chr1	45150000	46150000
+chr1	45200000	46200000
+chr1	45250000	46250000
+chr1	45300000	46300000
+chr1	45350000	46350000
+chr1	45400000	46400000
+chr1	45450000	46450000
+chr1	45500000	46500000
+chr1	45550000	46550000
+chr1	45600000	46600000
+chr1	45650000	46650000
+chr1	45700000	46700000
+chr1	45750000	46750000
+chr1	45800000	46800000
+chr1	45850000	46850000
+chr1	45900000	46900000
+chr1	45950000	46950000
+chr1	46000000	47000000
+chr1	46050000	47050000
+chr1	46100000	47100000
+chr1	46150000	47150000
+chr1	46200000	47200000
+chr1	46250000	47250000
+chr1	46300000	47300000
+chr1	46350000	47350000
+chr1	46400000	47400000
+chr1	46450000	47450000
+chr1	46500000	47500000
+chr1	46550000	47550000
+chr1	46600000	47600000
+chr1	46650000	47650000
+chr1	46700000	47700000
+chr1	46750000	47750000
+chr1	46800000	47800000
+chr1	46850000	47850000
+chr1	46900000	47900000
+chr1	46950000	47950000
+chr1	47000000	48000000
+chr1	47050000	48050000
+chr1	47100000	48100000
+chr1	47150000	48150000
+chr1	47200000	48200000
+chr1	47250000	48250000
+chr1	47300000	48300000
+chr1	47350000	48350000
+chr1	47400000	48400000
+chr1	47450000	48450000
+chr1	47500000	48500000
+chr1	47550000	48550000
+chr1	47600000	48600000
+chr1	47650000	48650000
+chr1	47700000	48700000
+chr1	47750000	48750000
+chr1	47800000	48800000
+chr1	47850000	48850000
+chr1	47900000	48900000
+chr1	47950000	48950000
+chr1	48000000	49000000
+chr1	48050000	49050000
+chr1	48100000	49100000
+chr1	48150000	49150000
+chr1	48200000	49200000
+chr1	48250000	49250000
+chr1	48300000	49300000
+chr1	48350000	49350000
+chr1	48400000	49400000
+chr1	48450000	49450000
+chr1	48500000	49500000
+chr1	48550000	49550000
+chr1	48600000	49600000
+chr1	48650000	49650000
+chr1	48700000	49700000
+chr1	48750000	49750000
+chr1	48800000	49800000
+chr1	48850000	49850000
+chr1	48900000	49900000
+chr1	48950000	49950000
+chr1	49000000	50000000
+chr1	49050000	50050000
+chr1	49100000	50100000
+chr1	49150000	50150000
+chr1	49200000	50200000
+chr1	49250000	50250000
+chr1	49300000	50300000
+chr1	49350000	50350000
+chr1	49400000	50400000
+chr1	49450000	50450000
+chr1	49500000	50500000
+chr1	49550000	50550000
+chr1	49600000	50600000
+chr1	49650000	50650000
+chr1	49700000	50700000
+chr1	49750000	50750000
+chr1	49800000	50800000
+chr1	49850000	50850000
+chr1	49900000	50900000
+chr1	49950000	50950000
+chr1	50000000	51000000
+chr1	50050000	51050000
+chr1	50100000	51100000
+chr1	50150000	51150000
+chr1	50200000	51200000
+chr1	50250000	51250000
+chr1	50300000	51300000
+chr1	50350000	51350000
+chr1	50400000	51400000
+chr1	50450000	51450000
+chr1	50500000	51500000
+chr1	50550000	51550000
+chr1	50600000	51600000
+chr1	50650000	51650000
+chr1	50700000	51700000
+chr1	50750000	51750000
+chr1	50800000	51800000
+chr1	50850000	51850000
+chr1	50900000	51900000
+chr1	50950000	51950000
+chr1	51000000	52000000
+chr1	51050000	52050000
+chr1	51100000	52100000
+chr1	51150000	52150000
+chr1	51200000	52200000
+chr1	51250000	52250000
+chr1	51300000	52300000
+chr1	51350000	52350000
+chr1	51400000	52400000
+chr1	51450000	52450000
+chr1	51500000	52500000
+chr1	51550000	52550000
+chr1	51600000	52600000
+chr1	51650000	52650000
+chr1	51700000	52700000
+chr1	51750000	52750000
+chr1	51800000	52800000
+chr1	51850000	52850000
+chr1	51900000	52900000
+chr1	51950000	52950000
+chr1	52000000	53000000
+chr1	52050000	53050000
+chr1	52100000	53100000
+chr1	52150000	53150000
+chr1	52200000	53200000
+chr1	52250000	53250000
+chr1	52300000	53300000
+chr1	52350000	53350000
+chr1	52400000	53400000
+chr1	52450000	53450000
+chr1	52500000	53500000
+chr1	52550000	53550000
+chr1	52600000	53600000
+chr1	52650000	53650000
+chr1	52700000	53700000
+chr1	52750000	53750000
+chr1	52800000	53800000
+chr1	52850000	53850000
+chr1	52900000	53900000
+chr1	52950000	53950000
+chr1	53000000	54000000
+chr1	53050000	54050000
+chr1	53100000	54100000
+chr1	53150000	54150000
+chr1	53200000	54200000
+chr1	53250000	54250000
+chr1	53300000	54300000
+chr1	53350000	54350000
+chr1	53400000	54400000
+chr1	53450000	54450000
+chr1	53500000	54500000
+chr1	53550000	54550000
+chr1	53600000	54600000
+chr1	53650000	54650000
+chr1	53700000	54700000
+chr1	53750000	54750000
+chr1	53800000	54800000
+chr1	53850000	54850000
+chr1	53900000	54900000
+chr1	53950000	54950000
+chr1	54000000	55000000
+chr1	54050000	55050000
+chr1	54100000	55100000
+chr1	54150000	55150000
+chr1	54200000	55200000
+chr1	54250000	55250000
+chr1	54300000	55300000
+chr1	54350000	55350000
+chr1	54400000	55400000
+chr1	54450000	55450000
+chr1	54500000	55500000
+chr1	54550000	55550000
+chr1	54600000	55600000
+chr1	54650000	55650000
+chr1	54700000	55700000
+chr1	54750000	55750000
+chr1	54800000	55800000
+chr1	54850000	55850000
+chr1	54900000	55900000
+chr1	54950000	55950000
+chr1	55000000	56000000
+chr1	55050000	56050000
+chr1	55100000	56100000
+chr1	55150000	56150000
+chr1	55200000	56200000
+chr1	55250000	56250000
+chr1	55300000	56300000
+chr1	55350000	56350000
+chr1	55400000	56400000
+chr1	55450000	56450000
+chr1	55500000	56500000
+chr1	55550000	56550000
+chr1	55600000	56600000
+chr1	55650000	56650000
+chr1	55700000	56700000
+chr1	55750000	56750000
+chr1	55800000	56800000
+chr1	55850000	56850000
+chr1	55900000	56900000
+chr1	55950000	56950000
+chr1	56000000	57000000
+chr1	56050000	57050000
+chr1	56100000	57100000
+chr1	56150000	57150000
+chr1	56200000	57200000
+chr1	56250000	57250000
+chr1	56300000	57300000
+chr1	56350000	57350000
+chr1	56400000	57400000
+chr1	56450000	57450000
+chr1	56500000	57500000
+chr1	56550000	57550000
+chr1	56600000	57600000
+chr1	56650000	57650000
+chr1	56700000	57700000
+chr1	56750000	57750000
+chr1	56800000	57800000
+chr1	56850000	57850000
+chr1	56900000	57900000
+chr1	56950000	57950000
+chr1	57000000	58000000
+chr1	57050000	58050000
+chr1	57100000	58100000
+chr1	57150000	58150000
+chr1	57200000	58200000
+chr1	57250000	58250000
+chr1	57300000	58300000
+chr1	57350000	58350000
+chr1	57400000	58400000
+chr1	57450000	58450000
+chr1	57500000	58500000
+chr1	57550000	58550000
+chr1	57600000	58600000
+chr1	57650000	58650000
+chr1	57700000	58700000
+chr1	57750000	58750000
+chr1	57800000	58800000
+chr1	57850000	58850000
+chr1	57900000	58900000
+chr1	57950000	58950000
+chr1	58000000	59000000
+chr1	58050000	59050000
+chr1	58100000	59100000
+chr1	58150000	59150000
+chr1	58200000	59200000
+chr1	58250000	59250000
+chr1	58300000	59300000
+chr1	58350000	59350000
+chr1	58400000	59400000
+chr1	58450000	59450000
+chr1	58500000	59500000
+chr1	58550000	59550000
+chr1	58600000	59600000
+chr1	58650000	59650000
+chr1	58700000	59700000
+chr1	58750000	59750000
+chr1	58800000	59800000
+chr1	58850000	59850000
+chr1	58900000	59900000
+chr1	58950000	59950000
+chr1	59000000	60000000
+chr1	59050000	60050000
+chr1	59100000	60100000
+chr1	59150000	60150000
+chr1	59200000	60200000
+chr1	59250000	60250000
+chr1	59300000	60300000
+chr1	59350000	60350000
+chr1	59400000	60400000
+chr1	59450000	60450000
+chr1	59500000	60500000
+chr1	59550000	60550000
+chr1	59600000	60600000
+chr1	59650000	60650000
+chr1	59700000	60700000
+chr1	59750000	60750000
+chr1	59800000	60800000
+chr1	59850000	60850000
+chr1	59900000	60900000
+chr1	59950000	60950000
+chr1	60000000	61000000
+chr1	60050000	61050000
+chr1	60100000	61100000
+chr1	60150000	61150000
+chr1	60200000	61200000
+chr1	60250000	61250000
+chr1	60300000	61300000
+chr1	60350000	61350000
+chr1	60400000	61400000
+chr1	60450000	61450000
+chr1	60500000	61500000
+chr1	60550000	61550000
+chr1	60600000	61600000
+chr1	60650000	61650000
+chr1	60700000	61700000
+chr1	60750000	61750000
+chr1	60800000	61800000
+chr1	60850000	61850000
+chr1	60900000	61900000
+chr1	60950000	61950000
+chr1	61000000	62000000
+chr1	61050000	62050000
+chr1	61100000	62100000
+chr1	61150000	62150000
+chr1	61200000	62200000
+chr1	61250000	62250000
+chr1	61300000	62300000
+chr1	61350000	62350000
+chr1	61400000	62400000
+chr1	61450000	62450000
+chr1	61500000	62500000
+chr1	61550000	62550000
+chr1	61600000	62600000
+chr1	61650000	62650000
+chr1	61700000	62700000
+chr1	61750000	62750000
+chr1	61800000	62800000
+chr1	61850000	62850000
+chr1	61900000	62900000
+chr1	61950000	62950000
+chr1	62000000	63000000
+chr1	62050000	63050000
+chr1	62100000	63100000
+chr1	62150000	63150000
+chr1	62200000	63200000
+chr1	62250000	63250000
+chr1	62300000	63300000
+chr1	62350000	63350000
+chr1	62400000	63400000
+chr1	62450000	63450000
+chr1	62500000	63500000
+chr1	62550000	63550000
+chr1	62600000	63600000
+chr1	62650000	63650000
+chr1	62700000	63700000
+chr1	62750000	63750000
+chr1	62800000	63800000
+chr1	62850000	63850000
+chr1	62900000	63900000
+chr1	62950000	63950000
+chr1	63000000	64000000
+chr1	63050000	64050000
+chr1	63100000	64100000
+chr1	63150000	64150000
+chr1	63200000	64200000
+chr1	63250000	64250000
+chr1	63300000	64300000
+chr1	63350000	64350000
+chr1	63400000	64400000
+chr1	63450000	64450000
+chr1	63500000	64500000
+chr1	63550000	64550000
+chr1	63600000	64600000
+chr1	63650000	64650000
+chr1	63700000	64700000
+chr1	63750000	64750000
+chr1	63800000	64800000
+chr1	63850000	64850000
+chr1	63900000	64900000
+chr1	63950000	64950000
+chr1	64000000	65000000
+chr1	64050000	65050000
+chr1	64100000	65100000
+chr1	64150000	65150000
+chr1	64200000	65200000
+chr1	64250000	65250000
+chr1	64300000	65300000
+chr1	64350000	65350000
+chr1	64400000	65400000
+chr1	64450000	65450000
+chr1	64500000	65500000
+chr1	64550000	65550000
+chr1	64600000	65600000
+chr1	64650000	65650000
+chr1	64700000	65700000
+chr1	64750000	65750000
+chr1	64800000	65800000
+chr1	64850000	65850000
+chr1	64900000	65900000
+chr1	64950000	65950000
+chr1	65000000	66000000
+chr1	65050000	66050000
+chr1	65100000	66100000
+chr1	65150000	66150000
+chr1	65200000	66200000
+chr1	65250000	66250000
+chr1	65300000	66300000
+chr1	65350000	66350000
+chr1	65400000	66400000
+chr1	65450000	66450000
+chr1	65500000	66500000
+chr1	65550000	66550000
+chr1	65600000	66600000
+chr1	65650000	66650000
+chr1	65700000	66700000
+chr1	65750000	66750000
+chr1	65800000	66800000
+chr1	65850000	66850000
+chr1	65900000	66900000
+chr1	65950000	66950000
+chr1	66000000	67000000
+chr1	66050000	67050000
+chr1	66100000	67100000
+chr1	66150000	67150000
+chr1	66200000	67200000
+chr1	66250000	67250000
+chr1	66300000	67300000
+chr1	66350000	67350000
+chr1	66400000	67400000
+chr1	66450000	67450000
+chr1	66500000	67500000
+chr1	66550000	67550000
+chr1	66600000	67600000
+chr1	66650000	67650000
+chr1	66700000	67700000
+chr1	66750000	67750000
+chr1	66800000	67800000
+chr1	66850000	67850000
+chr1	66900000	67900000
+chr1	66950000	67950000
+chr1	67000000	68000000
+chr1	67050000	68050000
+chr1	67100000	68100000
+chr1	67150000	68150000
+chr1	67200000	68200000
+chr1	67250000	68250000
+chr1	67300000	68300000
+chr1	67350000	68350000
+chr1	67400000	68400000
+chr1	67450000	68450000
+chr1	67500000	68500000
+chr1	67550000	68550000
+chr1	67600000	68600000
+chr1	67650000	68650000
+chr1	67700000	68700000
+chr1	67750000	68750000
+chr1	67800000	68800000
+chr1	67850000	68850000
+chr1	67900000	68900000
+chr1	67950000	68950000
+chr1	68000000	69000000
+chr1	68050000	69050000
+chr1	68100000	69100000
+chr1	68150000	69150000
+chr1	68200000	69200000
+chr1	68250000	69250000
+chr1	68300000	69300000
+chr1	68350000	69350000
+chr1	68400000	69400000
+chr1	68450000	69450000
+chr1	68500000	69500000
+chr1	68550000	69550000
+chr1	68600000	69600000
+chr1	68650000	69650000
+chr1	68700000	69700000
+chr1	68750000	69750000
+chr1	68800000	69800000
+chr1	68850000	69850000
+chr1	68900000	69900000
+chr1	68950000	69950000
+chr1	69000000	70000000
+chr1	69050000	70050000
+chr1	69100000	70100000
+chr1	69150000	70150000
+chr1	69200000	70200000
+chr1	69250000	70250000
+chr1	69300000	70300000
+chr1	69350000	70350000
+chr1	69400000	70400000
+chr1	69450000	70450000
+chr1	69500000	70500000
+chr1	69550000	70550000
+chr1	69600000	70600000
+chr1	69650000	70650000
+chr1	69700000	70700000
+chr1	69750000	70750000
+chr1	69800000	70800000
+chr1	69850000	70850000
+chr1	69900000	70900000
+chr1	69950000	70950000
+chr1	70000000	71000000
+chr1	70050000	71050000
+chr1	70100000	71100000
+chr1	70150000	71150000
+chr1	70200000	71200000
+chr1	70250000	71250000
+chr1	70300000	71300000
+chr1	70350000	71350000
+chr1	70400000	71400000
+chr1	70450000	71450000
+chr1	70500000	71500000
+chr1	70550000	71550000
+chr1	70600000	71600000
+chr1	70650000	71650000
+chr1	70700000	71700000
+chr1	70750000	71750000
+chr1	70800000	71800000
+chr1	70850000	71850000
+chr1	70900000	71900000
+chr1	70950000	71950000
+chr1	71000000	72000000
+chr1	71050000	72050000
+chr1	71100000	72100000
+chr1	71150000	72150000
+chr1	71200000	72200000
+chr1	71250000	72250000
+chr1	71300000	72300000
+chr1	71350000	72350000
+chr1	71400000	72400000
+chr1	71450000	72450000
+chr1	71500000	72500000
+chr1	71550000	72550000
+chr1	71600000	72600000
+chr1	71650000	72650000
+chr1	71700000	72700000
+chr1	71750000	72750000
+chr1	71800000	72800000
+chr1	71850000	72850000
+chr1	71900000	72900000
+chr1	71950000	72950000
+chr1	72000000	73000000
+chr1	72050000	73050000
+chr1	72100000	73100000
+chr1	72150000	73150000
+chr1	72200000	73200000
+chr1	72250000	73250000
+chr1	72300000	73300000
+chr1	72350000	73350000
+chr1	72400000	73400000
+chr1	72450000	73450000
+chr1	72500000	73500000
+chr1	72550000	73550000
+chr1	72600000	73600000
+chr1	72650000	73650000
+chr1	72700000	73700000
+chr1	72750000	73750000
+chr1	72800000	73800000
+chr1	72850000	73850000
+chr1	72900000	73900000
+chr1	72950000	73950000
+chr1	73000000	74000000
+chr1	73050000	74050000
+chr1	73100000	74100000
+chr1	73150000	74150000
+chr1	73200000	74200000
+chr1	73250000	74250000
+chr1	73300000	74300000
+chr1	73350000	74350000
+chr1	73400000	74400000
+chr1	73450000	74450000
+chr1	73500000	74500000
+chr1	73550000	74550000
+chr1	73600000	74600000
+chr1	73650000	74650000
+chr1	73700000	74700000
+chr1	73750000	74750000
+chr1	73800000	74800000
+chr1	73850000	74850000
+chr1	73900000	74900000
+chr1	73950000	74950000
+chr1	74000000	75000000
+chr1	74050000	75050000
+chr1	74100000	75100000
+chr1	74150000	75150000
+chr1	74200000	75200000
+chr1	74250000	75250000
+chr1	74300000	75300000
+chr1	74350000	75350000
+chr1	74400000	75400000
+chr1	74450000	75450000
+chr1	74500000	75500000
+chr1	74550000	75550000
+chr1	74600000	75600000
+chr1	74650000	75650000
+chr1	74700000	75700000
+chr1	74750000	75750000
+chr1	74800000	75800000
+chr1	74850000	75850000
+chr1	74900000	75900000
+chr1	74950000	75950000
+chr1	75000000	76000000
+chr1	75050000	76050000
+chr1	75100000	76100000
+chr1	75150000	76150000
+chr1	75200000	76200000
+chr1	75250000	76250000
+chr1	75300000	76300000
+chr1	75350000	76350000
+chr1	75400000	76400000
+chr1	75450000	76450000
+chr1	75500000	76500000
+chr1	75550000	76550000
+chr1	75600000	76600000
+chr1	75650000	76650000
+chr1	75700000	76700000
+chr1	75750000	76750000
+chr1	75800000	76800000
+chr1	75850000	76850000
+chr1	75900000	76900000
+chr1	75950000	76950000
+chr1	76000000	77000000
+chr1	76050000	77050000
+chr1	76100000	77100000
+chr1	76150000	77150000
+chr1	76200000	77200000
+chr1	76250000	77250000
+chr1	76300000	77300000
+chr1	76350000	77350000
+chr1	76400000	77400000
+chr1	76450000	77450000
+chr1	76500000	77500000
+chr1	76550000	77550000
+chr1	76600000	77600000
+chr1	76650000	77650000
+chr1	76700000	77700000
+chr1	76750000	77750000
+chr1	76800000	77800000
+chr1	76850000	77850000
+chr1	76900000	77900000
+chr1	76950000	77950000
+chr1	77000000	78000000
+chr1	77050000	78050000
+chr1	77100000	78100000
+chr1	77150000	78150000
+chr1	77200000	78200000
+chr1	77250000	78250000
+chr1	77300000	78300000
+chr1	77350000	78350000
+chr1	77400000	78400000
+chr1	77450000	78450000
+chr1	77500000	78500000
+chr1	77550000	78550000
+chr1	77600000	78600000
+chr1	77650000	78650000
+chr1	77700000	78700000
+chr1	77750000	78750000
+chr1	77800000	78800000
+chr1	77850000	78850000
+chr1	77900000	78900000
+chr1	77950000	78950000
+chr1	78000000	79000000
+chr1	78050000	79050000
+chr1	78100000	79100000
+chr1	78150000	79150000
+chr1	78200000	79200000
+chr1	78250000	79250000
+chr1	78300000	79300000
+chr1	78350000	79350000
+chr1	78400000	79400000
+chr1	78450000	79450000
+chr1	78500000	79500000
+chr1	78550000	79550000
+chr1	78600000	79600000
+chr1	78650000	79650000
+chr1	78700000	79700000
+chr1	78750000	79750000
+chr1	78800000	79800000
+chr1	78850000	79850000
+chr1	78900000	79900000
+chr1	78950000	79950000
+chr1	79000000	80000000
+chr1	79050000	80050000
+chr1	79100000	80100000
+chr1	79150000	80150000
+chr1	79200000	80200000
+chr1	79250000	80250000
+chr1	79300000	80300000
+chr1	79350000	80350000
+chr1	79400000	80400000
+chr1	79450000	80450000
+chr1	79500000	80500000
+chr1	79550000	80550000
+chr1	79600000	80600000
+chr1	79650000	80650000
+chr1	79700000	80700000
+chr1	79750000	80750000
+chr1	79800000	80800000
+chr1	79850000	80850000
+chr1	79900000	80900000
+chr1	79950000	80950000
+chr1	80000000	81000000
+chr1	80050000	81050000
+chr1	80100000	81100000
+chr1	80150000	81150000
+chr1	80200000	81200000
+chr1	80250000	81250000
+chr1	80300000	81300000
+chr1	80350000	81350000
+chr1	80400000	81400000
+chr1	80450000	81450000
+chr1	80500000	81500000
+chr1	80550000	81550000
+chr1	80600000	81600000
+chr1	80650000	81650000
+chr1	80700000	81700000
+chr1	80750000	81750000
+chr1	80800000	81800000
+chr1	80850000	81850000
+chr1	80900000	81900000
+chr1	80950000	81950000
+chr1	81000000	82000000
+chr1	81050000	82050000
+chr1	81100000	82100000
+chr1	81150000	82150000
+chr1	81200000	82200000
+chr1	81250000	82250000
+chr1	81300000	82300000
+chr1	81350000	82350000
+chr1	81400000	82400000
+chr1	81450000	82450000
+chr1	81500000	82500000
+chr1	81550000	82550000
+chr1	81600000	82600000
+chr1	81650000	82650000
+chr1	81700000	82700000
+chr1	81750000	82750000
+chr1	81800000	82800000
+chr1	81850000	82850000
+chr1	81900000	82900000
+chr1	81950000	82950000
+chr1	82000000	83000000
+chr1	82050000	83050000
+chr1	82100000	83100000
+chr1	82150000	83150000
+chr1	82200000	83200000
+chr1	82250000	83250000
+chr1	82300000	83300000
+chr1	82350000	83350000
+chr1	82400000	83400000
+chr1	82450000	83450000
+chr1	82500000	83500000
+chr1	82550000	83550000
+chr1	82600000	83600000
+chr1	82650000	83650000
+chr1	82700000	83700000
+chr1	82750000	83750000
+chr1	82800000	83800000
+chr1	82850000	83850000
+chr1	82900000	83900000
+chr1	82950000	83950000
+chr1	83000000	84000000
+chr1	83050000	84050000
+chr1	83100000	84100000
+chr1	83150000	84150000
+chr1	83200000	84200000
+chr1	83250000	84250000
+chr1	83300000	84300000
+chr1	83350000	84350000
+chr1	83400000	84400000
+chr1	83450000	84450000
+chr1	83500000	84500000
+chr1	83550000	84550000
+chr1	83600000	84600000
+chr1	83650000	84650000
+chr1	83700000	84700000
+chr1	83750000	84750000
+chr1	83800000	84800000
+chr1	83850000	84850000
+chr1	83900000	84900000
+chr1	83950000	84950000
+chr1	84000000	85000000
+chr1	84050000	85050000
+chr1	84100000	85100000
+chr1	84150000	85150000
+chr1	84200000	85200000
+chr1	84250000	85250000
+chr1	84300000	85300000
+chr1	84350000	85350000
+chr1	84400000	85400000
+chr1	84450000	85450000
+chr1	84500000	85500000
+chr1	84550000	85550000
+chr1	84600000	85600000
+chr1	84650000	85650000
+chr1	84700000	85700000
+chr1	84750000	85750000
+chr1	84800000	85800000
+chr1	84850000	85850000
+chr1	84900000	85900000
+chr1	84950000	85950000
+chr1	85000000	86000000
+chr1	85050000	86050000
+chr1	85100000	86100000
+chr1	85150000	86150000
+chr1	85200000	86200000
+chr1	85250000	86250000
+chr1	85300000	86300000
+chr1	85350000	86350000
+chr1	85400000	86400000
+chr1	85450000	86450000
+chr1	85500000	86500000
+chr1	85550000	86550000
+chr1	85600000	86600000
+chr1	85650000	86650000
+chr1	85700000	86700000
+chr1	85750000	86750000
+chr1	85800000	86800000
+chr1	85850000	86850000
+chr1	85900000	86900000
+chr1	85950000	86950000
+chr1	86000000	87000000
+chr1	86050000	87050000
+chr1	86100000	87100000
+chr1	86150000	87150000
+chr1	86200000	87200000
+chr1	86250000	87250000
+chr1	86300000	87300000
+chr1	86350000	87350000
+chr1	86400000	87400000
+chr1	86450000	87450000
+chr1	86500000	87500000
+chr1	86550000	87550000
+chr1	86600000	87600000
+chr1	86650000	87650000
+chr1	86700000	87700000
+chr1	86750000	87750000
+chr1	86800000	87800000
+chr1	86850000	87850000
+chr1	86900000	87900000
+chr1	86950000	87950000
+chr1	87000000	88000000
+chr1	87050000	88050000
+chr1	87100000	88100000
+chr1	87150000	88150000
+chr1	87200000	88200000
+chr1	87250000	88250000
+chr1	87300000	88300000
+chr1	87350000	88350000
+chr1	87400000	88400000
+chr1	87450000	88450000
+chr1	87500000	88500000
+chr1	87550000	88550000
+chr1	87600000	88600000
+chr1	87650000	88650000
+chr1	87700000	88700000
+chr1	87750000	88750000
+chr1	87800000	88800000
+chr1	87850000	88850000
+chr1	87900000	88900000
+chr1	87950000	88950000
+chr1	88000000	89000000
+chr1	88050000	89050000
+chr1	88100000	89100000
+chr1	88150000	89150000
+chr1	88200000	89200000
+chr1	88250000	89250000
+chr1	88300000	89300000
+chr1	88350000	89350000
+chr1	88400000	89400000
+chr1	88450000	89450000
+chr1	88500000	89500000
+chr1	88550000	89550000
+chr1	88600000	89600000
+chr1	88650000	89650000
+chr1	88700000	89700000
+chr1	88750000	89750000
+chr1	88800000	89800000
+chr1	88850000	89850000
+chr1	88900000	89900000
+chr1	88950000	89950000
+chr1	89000000	90000000
+chr1	89050000	90050000
+chr1	89100000	90100000
+chr1	89150000	90150000
+chr1	89200000	90200000
+chr1	89250000	90250000
+chr1	89300000	90300000
+chr1	89350000	90350000
+chr1	89400000	90400000
+chr1	89450000	90450000
+chr1	89500000	90500000
+chr1	89550000	90550000
+chr1	89600000	90600000
+chr1	89650000	90650000
+chr1	89700000	90700000
+chr1	89750000	90750000
+chr1	89800000	90800000
+chr1	89850000	90850000
+chr1	89900000	90900000
+chr1	89950000	90950000
+chr1	90000000	91000000
+chr1	90050000	91050000
+chr1	90100000	91100000
+chr1	90150000	91150000
+chr1	90200000	91200000
+chr1	90250000	91250000
+chr1	90300000	91300000
+chr1	90350000	91350000
+chr1	90400000	91400000
+chr1	90450000	91450000
+chr1	90500000	91500000
+chr1	90550000	91550000
+chr1	90600000	91600000
+chr1	90650000	91650000
+chr1	90700000	91700000
+chr1	90750000	91750000
+chr1	90800000	91800000
+chr1	90850000	91850000
+chr1	90900000	91900000
+chr1	90950000	91950000
+chr1	91000000	92000000
+chr1	91050000	92050000
+chr1	91100000	92100000
+chr1	91150000	92150000
+chr1	91200000	92200000
+chr1	91250000	92250000
+chr1	91300000	92300000
+chr1	91350000	92350000
+chr1	91400000	92400000
+chr1	91450000	92450000
+chr1	91500000	92500000
+chr1	91550000	92550000
+chr1	91600000	92600000
+chr1	91650000	92650000
+chr1	91700000	92700000
+chr1	91750000	92750000
+chr1	91800000	92800000
+chr1	91850000	92850000
+chr1	91900000	92900000
+chr1	91950000	92950000
+chr1	92000000	93000000
+chr1	92050000	93050000
+chr1	92100000	93100000
+chr1	92150000	93150000
+chr1	92200000	93200000
+chr1	92250000	93250000
+chr1	92300000	93300000
+chr1	92350000	93350000
+chr1	92400000	93400000
+chr1	92450000	93450000
+chr1	92500000	93500000
+chr1	92550000	93550000
+chr1	92600000	93600000
+chr1	92650000	93650000
+chr1	92700000	93700000
+chr1	92750000	93750000
+chr1	92800000	93800000
+chr1	92850000	93850000
+chr1	92900000	93900000
+chr1	92950000	93950000
+chr1	93000000	94000000
+chr1	93050000	94050000
+chr1	93100000	94100000
+chr1	93150000	94150000
+chr1	93200000	94200000
+chr1	93250000	94250000
+chr1	93300000	94300000
+chr1	93350000	94350000
+chr1	93400000	94400000
+chr1	93450000	94450000
+chr1	93500000	94500000
+chr1	93550000	94550000
+chr1	93600000	94600000
+chr1	93650000	94650000
+chr1	93700000	94700000
+chr1	93750000	94750000
+chr1	93800000	94800000
+chr1	93850000	94850000
+chr1	93900000	94900000
+chr1	93950000	94950000
+chr1	94000000	95000000
+chr1	94050000	95050000
+chr1	94100000	95100000
+chr1	94150000	95150000
+chr1	94200000	95200000
+chr1	94250000	95250000
+chr1	94300000	95300000
+chr1	94350000	95350000
+chr1	94400000	95400000
+chr1	94450000	95450000
+chr1	94500000	95500000
+chr1	94550000	95550000
+chr1	94600000	95600000
+chr1	94650000	95650000
+chr1	94700000	95700000
+chr1	94750000	95750000
+chr1	94800000	95800000
+chr1	94850000	95850000
+chr1	94900000	95900000
+chr1	94950000	95950000
+chr1	95000000	96000000
+chr1	95050000	96050000
+chr1	95100000	96100000
+chr1	95150000	96150000
+chr1	95200000	96200000
+chr1	95250000	96250000
+chr1	95300000	96300000
+chr1	95350000	96350000
+chr1	95400000	96400000
+chr1	95450000	96450000
+chr1	95500000	96500000
+chr1	95550000	96550000
+chr1	95600000	96600000
+chr1	95650000	96650000
+chr1	95700000	96700000
+chr1	95750000	96750000
+chr1	95800000	96800000
+chr1	95850000	96850000
+chr1	95900000	96900000
+chr1	95950000	96950000
+chr1	96000000	97000000
+chr1	96050000	97050000
+chr1	96100000	97100000
+chr1	96150000	97150000
+chr1	96200000	97200000
+chr1	96250000	97250000
+chr1	96300000	97300000
+chr1	96350000	97350000
+chr1	96400000	97400000
+chr1	96450000	97450000
+chr1	96500000	97500000
+chr1	96550000	97550000
+chr1	96600000	97600000
+chr1	96650000	97650000
+chr1	96700000	97700000
+chr1	96750000	97750000
+chr1	96800000	97800000
+chr1	96850000	97850000
+chr1	96900000	97900000
+chr1	96950000	97950000
+chr1	97000000	98000000
+chr1	97050000	98050000
+chr1	97100000	98100000
+chr1	97150000	98150000
+chr1	97200000	98200000
+chr1	97250000	98250000
+chr1	97300000	98300000
+chr1	97350000	98350000
+chr1	97400000	98400000
+chr1	97450000	98450000
+chr1	97500000	98500000
+chr1	97550000	98550000
+chr1	97600000	98600000
+chr1	97650000	98650000
+chr1	97700000	98700000
+chr1	97750000	98750000
+chr1	97800000	98800000
+chr1	97850000	98850000
+chr1	97900000	98900000
+chr1	97950000	98950000
+chr1	98000000	99000000
+chr1	98050000	99050000
+chr1	98100000	99100000
+chr1	98150000	99150000
+chr1	98200000	99200000
+chr1	98250000	99250000
+chr1	98300000	99300000
+chr1	98350000	99350000
+chr1	98400000	99400000
+chr1	98450000	99450000
+chr1	98500000	99500000
+chr1	98550000	99550000
+chr1	98600000	99600000
+chr1	98650000	99650000
+chr1	98700000	99700000
+chr1	98750000	99750000
+chr1	98800000	99800000
+chr1	98850000	99850000
+chr1	98900000	99900000
+chr1	98950000	99950000
+chr1	99000000	100000000
+chr1	99050000	100050000
+chr1	99100000	100100000
+chr1	99150000	100150000
+chr1	99200000	100200000
+chr1	99250000	100250000
+chr1	99300000	100300000
+chr1	99350000	100350000
+chr1	99400000	100400000
+chr1	99450000	100450000
+chr1	99500000	100500000
+chr1	99550000	100550000
+chr1	99600000	100600000
+chr1	99650000	100650000
+chr1	99700000	100700000
+chr1	99750000	100750000
+chr1	99800000	100800000
+chr1	99850000	100850000
+chr1	99900000	100900000
+chr1	99950000	100950000
+chr1	100000000	101000000
+chr1	100050000	101050000
+chr1	100100000	101100000
+chr1	100150000	101150000
+chr1	100200000	101200000
+chr1	100250000	101250000
+chr1	100300000	101300000
+chr1	100350000	101350000
+chr1	100400000	101400000
+chr1	100450000	101450000
+chr1	100500000	101500000
+chr1	100550000	101550000
+chr1	100600000	101600000
+chr1	100650000	101650000
+chr1	100700000	101700000
+chr1	100750000	101750000
+chr1	100800000	101800000
+chr1	100850000	101850000
+chr1	100900000	101900000
+chr1	100950000	101950000
+chr1	101000000	102000000
+chr1	101050000	102050000
+chr1	101100000	102100000
+chr1	101150000	102150000
+chr1	101200000	102200000
+chr1	101250000	102250000
+chr1	101300000	102300000
+chr1	101350000	102350000
+chr1	101400000	102400000
+chr1	101450000	102450000
+chr1	101500000	102500000
+chr1	101550000	102550000
+chr1	101600000	102600000
+chr1	101650000	102650000
+chr1	101700000	102700000
+chr1	101750000	102750000
+chr1	101800000	102800000
+chr1	101850000	102850000
+chr1	101900000	102900000
+chr1	101950000	102950000
+chr1	102000000	103000000
+chr1	102050000	103050000
+chr1	102100000	103100000
+chr1	102150000	103150000
+chr1	102200000	103200000
+chr1	102250000	103250000
+chr1	102300000	103300000
+chr1	102350000	103350000
+chr1	102400000	103400000
+chr1	102450000	103450000
+chr1	102500000	103500000
+chr1	102550000	103550000
+chr1	102600000	103600000
+chr1	102650000	103650000
+chr1	102700000	103700000
+chr1	102750000	103750000
+chr1	102800000	103800000
+chr1	102850000	103850000
+chr1	102900000	103900000
+chr1	102950000	103950000
+chr1	103000000	104000000
+chr1	103050000	104050000
+chr1	103100000	104100000
+chr1	103150000	104150000
+chr1	103200000	104200000
+chr1	103250000	104250000
+chr1	103300000	104300000
+chr1	103350000	104350000
+chr1	103400000	104400000
+chr1	103450000	104450000
+chr1	103500000	104500000
+chr1	103550000	104550000
+chr1	103600000	104600000
+chr1	103650000	104650000
+chr1	103700000	104700000
+chr1	103750000	104750000
+chr1	103800000	104800000
+chr1	103850000	104850000
+chr1	103900000	104900000
+chr1	103950000	104950000
+chr1	104000000	105000000
+chr1	104050000	105050000
+chr1	104100000	105100000
+chr1	104150000	105150000
+chr1	104200000	105200000
+chr1	104250000	105250000
+chr1	104300000	105300000
+chr1	104350000	105350000
+chr1	104400000	105400000
+chr1	104450000	105450000
+chr1	104500000	105500000
+chr1	104550000	105550000
+chr1	104600000	105600000
+chr1	104650000	105650000
+chr1	104700000	105700000
+chr1	104750000	105750000
+chr1	104800000	105800000
+chr1	104850000	105850000
+chr1	104900000	105900000
+chr1	104950000	105950000
+chr1	105000000	106000000
+chr1	105050000	106050000
+chr1	105100000	106100000
+chr1	105150000	106150000
+chr1	105200000	106200000
+chr1	105250000	106250000
+chr1	105300000	106300000
+chr1	105350000	106350000
+chr1	105400000	106400000
+chr1	105450000	106450000
+chr1	105500000	106500000
+chr1	105550000	106550000
+chr1	105600000	106600000
+chr1	105650000	106650000
+chr1	105700000	106700000
+chr1	105750000	106750000
+chr1	105800000	106800000
+chr1	105850000	106850000
+chr1	105900000	106900000
+chr1	105950000	106950000
+chr1	106000000	107000000
+chr1	106050000	107050000
+chr1	106100000	107100000
+chr1	106150000	107150000
+chr1	106200000	107200000
+chr1	106250000	107250000
+chr1	106300000	107300000
+chr1	106350000	107350000
+chr1	106400000	107400000
+chr1	106450000	107450000
+chr1	106500000	107500000
+chr1	106550000	107550000
+chr1	106600000	107600000
+chr1	106650000	107650000
+chr1	106700000	107700000
+chr1	106750000	107750000
+chr1	106800000	107800000
+chr1	106850000	107850000
+chr1	106900000	107900000
+chr1	106950000	107950000
+chr1	107000000	108000000
+chr1	107050000	108050000
+chr1	107100000	108100000
+chr1	107150000	108150000
+chr1	107200000	108200000
+chr1	107250000	108250000
+chr1	107300000	108300000
+chr1	107350000	108350000
+chr1	107400000	108400000
+chr1	107450000	108450000
+chr1	107500000	108500000
+chr1	107550000	108550000
+chr1	107600000	108600000
+chr1	107650000	108650000
+chr1	107700000	108700000
+chr1	107750000	108750000
+chr1	107800000	108800000
+chr1	107850000	108850000
+chr1	107900000	108900000
+chr1	107950000	108950000
+chr1	108000000	109000000
+chr1	108050000	109050000
+chr1	108100000	109100000
+chr1	108150000	109150000
+chr1	108200000	109200000
+chr1	108250000	109250000
+chr1	108300000	109300000
+chr1	108350000	109350000
+chr1	108400000	109400000
+chr1	108450000	109450000
+chr1	108500000	109500000
+chr1	108550000	109550000
+chr1	108600000	109600000
+chr1	108650000	109650000
+chr1	108700000	109700000
+chr1	108750000	109750000
+chr1	108800000	109800000
+chr1	108850000	109850000
+chr1	108900000	109900000
+chr1	108950000	109950000
+chr1	109000000	110000000
+chr1	109050000	110050000
+chr1	109100000	110100000
+chr1	109150000	110150000
+chr1	109200000	110200000
+chr1	109250000	110250000
+chr1	109300000	110300000
+chr1	109350000	110350000
+chr1	109400000	110400000
+chr1	109450000	110450000
+chr1	109500000	110500000
+chr1	109550000	110550000
+chr1	109600000	110600000
+chr1	109650000	110650000
+chr1	109700000	110700000
+chr1	109750000	110750000
+chr1	109800000	110800000
+chr1	109850000	110850000
+chr1	109900000	110900000
+chr1	109950000	110950000
+chr1	110000000	111000000
+chr1	110050000	111050000
+chr1	110100000	111100000
+chr1	110150000	111150000
+chr1	110200000	111200000
+chr1	110250000	111250000
+chr1	110300000	111300000
+chr1	110350000	111350000
+chr1	110400000	111400000
+chr1	110450000	111450000
+chr1	110500000	111500000
+chr1	110550000	111550000
+chr1	110600000	111600000
+chr1	110650000	111650000
+chr1	110700000	111700000
+chr1	110750000	111750000
+chr1	110800000	111800000
+chr1	110850000	111850000
+chr1	110900000	111900000
+chr1	110950000	111950000
+chr1	111000000	112000000
+chr1	111050000	112050000
+chr1	111100000	112100000
+chr1	111150000	112150000
+chr1	111200000	112200000
+chr1	111250000	112250000
+chr1	111300000	112300000
+chr1	111350000	112350000
+chr1	111400000	112400000
+chr1	111450000	112450000
+chr1	111500000	112500000
+chr1	111550000	112550000
+chr1	111600000	112600000
+chr1	111650000	112650000
+chr1	111700000	112700000
+chr1	111750000	112750000
+chr1	111800000	112800000
+chr1	111850000	112850000
+chr1	111900000	112900000
+chr1	111950000	112950000
+chr1	112000000	113000000
+chr1	112050000	113050000
+chr1	112100000	113100000
+chr1	112150000	113150000
+chr1	112200000	113200000
+chr1	112250000	113250000
+chr1	112300000	113300000
+chr1	112350000	113350000
+chr1	112400000	113400000
+chr1	112450000	113450000
+chr1	112500000	113500000
+chr1	112550000	113550000
+chr1	112600000	113600000
+chr1	112650000	113650000
+chr1	112700000	113700000
+chr1	112750000	113750000
+chr1	112800000	113800000
+chr1	112850000	113850000
+chr1	112900000	113900000
+chr1	112950000	113950000
+chr1	113000000	114000000
+chr1	113050000	114050000
+chr1	113100000	114100000
+chr1	113150000	114150000
+chr1	113200000	114200000
+chr1	113250000	114250000
+chr1	113300000	114300000
+chr1	113350000	114350000
+chr1	113400000	114400000
+chr1	113450000	114450000
+chr1	113500000	114500000
+chr1	113550000	114550000
+chr1	113600000	114600000
+chr1	113650000	114650000
+chr1	113700000	114700000
+chr1	113750000	114750000
+chr1	113800000	114800000
+chr1	113850000	114850000
+chr1	113900000	114900000
+chr1	113950000	114950000
+chr1	114000000	115000000
+chr1	114050000	115050000
+chr1	114100000	115100000
+chr1	114150000	115150000
+chr1	114200000	115200000
+chr1	114250000	115250000
+chr1	114300000	115300000
+chr1	114350000	115350000
+chr1	114400000	115400000
+chr1	114450000	115450000
+chr1	114500000	115500000
+chr1	114550000	115550000
+chr1	114600000	115600000
+chr1	114650000	115650000
+chr1	114700000	115700000
+chr1	114750000	115750000
+chr1	114800000	115800000
+chr1	114850000	115850000
+chr1	114900000	115900000
+chr1	114950000	115950000
+chr1	115000000	116000000
+chr1	115050000	116050000
+chr1	115100000	116100000
+chr1	115150000	116150000
+chr1	115200000	116200000
+chr1	115250000	116250000
+chr1	115300000	116300000
+chr1	115350000	116350000
+chr1	115400000	116400000
+chr1	115450000	116450000
+chr1	115500000	116500000
+chr1	115550000	116550000
+chr1	115600000	116600000
+chr1	115650000	116650000
+chr1	115700000	116700000
+chr1	115750000	116750000
+chr1	115800000	116800000
+chr1	115850000	116850000
+chr1	115900000	116900000
+chr1	115950000	116950000
+chr1	116000000	117000000
+chr1	116050000	117050000
+chr1	116100000	117100000
+chr1	116150000	117150000
+chr1	116200000	117200000
+chr1	116250000	117250000
+chr1	116300000	117300000
+chr1	116350000	117350000
+chr1	116400000	117400000
+chr1	116450000	117450000
+chr1	116500000	117500000
+chr1	116550000	117550000
+chr1	116600000	117600000
+chr1	116650000	117650000
+chr1	116700000	117700000
+chr1	116750000	117750000
+chr1	116800000	117800000
+chr1	116850000	117850000
+chr1	116900000	117900000
+chr1	116950000	117950000
+chr1	117000000	118000000
+chr1	117050000	118050000
+chr1	117100000	118100000
+chr1	117150000	118150000
+chr1	117200000	118200000
+chr1	117250000	118250000
+chr1	117300000	118300000
+chr1	117350000	118350000
+chr1	117400000	118400000
+chr1	117450000	118450000
+chr1	117500000	118500000
+chr1	117550000	118550000
+chr1	117600000	118600000
+chr1	117650000	118650000
+chr1	117700000	118700000
+chr1	117750000	118750000
+chr1	117800000	118800000
+chr1	117850000	118850000
+chr1	117900000	118900000
+chr1	117950000	118950000
+chr1	118000000	119000000
+chr1	118050000	119050000
+chr1	118100000	119100000
+chr1	118150000	119150000
+chr1	118200000	119200000
+chr1	118250000	119250000
+chr1	118300000	119300000
+chr1	118350000	119350000
+chr1	118400000	119400000
+chr1	118450000	119450000
+chr1	118500000	119500000
+chr1	118550000	119550000
+chr1	118600000	119600000
+chr1	118650000	119650000
+chr1	118700000	119700000
+chr1	118750000	119750000
+chr1	118800000	119800000
+chr1	118850000	119850000
+chr1	118900000	119900000
+chr1	118950000	119950000
+chr1	119000000	120000000
+chr1	119050000	120050000
+chr1	119100000	120100000
+chr1	119150000	120150000
+chr1	119200000	120200000
+chr1	119250000	120250000
+chr1	119300000	120300000
+chr1	119350000	120350000
+chr1	119400000	120400000
+chr1	119450000	120450000
+chr1	119500000	120500000
+chr1	119550000	120550000
+chr1	119600000	120600000
+chr1	119650000	120650000
+chr1	119700000	120700000
+chr1	119750000	120750000
+chr1	119800000	120800000
+chr1	119850000	120850000
+chr1	119900000	120900000
+chr1	119950000	120950000
+chr1	120000000	121000000
+chr1	120050000	121050000
+chr1	120100000	121100000
+chr1	120150000	121150000
+chr1	120200000	121200000
+chr1	120250000	121250000
+chr1	120300000	121300000
+chr1	120350000	121350000
+chr1	120400000	121400000
+chr1	120450000	121450000
+chr1	120500000	121500000
+chr1	120550000	121550000
+chr1	120600000	121600000
+chr1	120650000	121650000
+chr1	120700000	121700000
+chr1	120750000	121750000
+chr1	120800000	121800000
+chr1	120850000	121850000
+chr1	120900000	121900000
+chr1	120950000	121950000
+chr1	121000000	122000000
+chr1	121050000	122050000
+chr1	121100000	122100000
+chr1	121150000	122150000
+chr1	121200000	122200000
+chr1	121250000	122250000
+chr1	121300000	122300000
+chr1	121350000	122350000
+chr1	121400000	122400000
+chr1	121450000	122450000
+chr1	121500000	122500000
+chr1	121550000	122550000
+chr1	121600000	122600000
+chr1	121650000	122650000
+chr1	121700000	122700000
+chr1	121750000	122750000
+chr1	121800000	122800000
+chr1	121850000	122850000
+chr1	121900000	122900000
+chr1	121950000	122950000
+chr1	122000000	123000000
+chr1	122050000	123050000
+chr1	122100000	123100000
+chr1	122150000	123150000
+chr1	122200000	123200000
+chr1	122250000	123250000
+chr1	122300000	123300000
+chr1	122350000	123350000
+chr1	122400000	123400000
+chr1	122450000	123450000
+chr1	122500000	123500000
+chr1	122550000	123550000
+chr1	122600000	123600000
+chr1	122650000	123650000
+chr1	122700000	123700000
+chr1	122750000	123750000
+chr1	122800000	123800000
+chr1	122850000	123850000
+chr1	122900000	123900000
+chr1	122950000	123950000
+chr1	123000000	124000000
+chr1	123050000	124050000
+chr1	123100000	124100000
+chr1	123150000	124150000
+chr1	123200000	124200000
+chr1	123250000	124250000
+chr1	123300000	124300000
+chr1	123350000	124350000
+chr1	123400000	124400000
+chr1	123450000	124450000
+chr1	123500000	124500000
+chr1	123550000	124550000
+chr1	123600000	124600000
+chr1	123650000	124650000
+chr1	123700000	124700000
+chr1	123750000	124750000
+chr1	123800000	124800000
+chr1	123850000	124850000
+chr1	123900000	124900000
+chr1	123950000	124950000
+chr1	124000000	125000000
+chr1	124050000	125050000
+chr1	124100000	125100000
+chr1	124150000	125150000
+chr1	124200000	125200000
+chr1	124250000	125250000
+chr1	124300000	125300000
+chr1	124350000	125350000
+chr1	124400000	125400000
+chr1	124450000	125450000
+chr1	124500000	125500000
+chr1	124550000	125550000
+chr1	124600000	125600000
+chr1	124650000	125650000
+chr1	124700000	125700000
+chr1	124750000	125750000
+chr1	124800000	125800000
+chr1	124850000	125850000
+chr1	124900000	125900000
+chr1	124950000	125950000
+chr1	125000000	126000000
+chr1	125050000	126050000
+chr1	125100000	126100000
+chr1	125150000	126150000
+chr1	125200000	126200000
+chr1	125250000	126250000
+chr1	125300000	126300000
+chr1	125350000	126350000
+chr1	125400000	126400000
+chr1	125450000	126450000
+chr1	125500000	126500000
+chr1	125550000	126550000
+chr1	125600000	126600000
+chr1	125650000	126650000
+chr1	125700000	126700000
+chr1	125750000	126750000
+chr1	125800000	126800000
+chr1	125850000	126850000
+chr1	125900000	126900000
+chr1	125950000	126950000
+chr1	126000000	127000000
+chr1	126050000	127050000
+chr1	126100000	127100000
+chr1	126150000	127150000
+chr1	126200000	127200000
+chr1	126250000	127250000
+chr1	126300000	127300000
+chr1	126350000	127350000
+chr1	126400000	127400000
+chr1	126450000	127450000
+chr1	126500000	127500000
+chr1	126550000	127550000
+chr1	126600000	127600000
+chr1	126650000	127650000
+chr1	126700000	127700000
+chr1	126750000	127750000
+chr1	126800000	127800000
+chr1	126850000	127850000
+chr1	126900000	127900000
+chr1	126950000	127950000
+chr1	127000000	128000000
+chr1	127050000	128050000
+chr1	127100000	128100000
+chr1	127150000	128150000
+chr1	127200000	128200000
+chr1	127250000	128250000
+chr1	127300000	128300000
+chr1	127350000	128350000
+chr1	127400000	128400000
+chr1	127450000	128450000
+chr1	127500000	128500000
+chr1	127550000	128550000
+chr1	127600000	128600000
+chr1	127650000	128650000
+chr1	127700000	128700000
+chr1	127750000	128750000
+chr1	127800000	128800000
+chr1	127850000	128850000
+chr1	127900000	128900000
+chr1	127950000	128950000
+chr1	128000000	129000000
+chr1	128050000	129050000
+chr1	128100000	129100000
+chr1	128150000	129150000
+chr1	128200000	129200000
+chr1	128250000	129250000
+chr1	128300000	129300000
+chr1	128350000	129350000
+chr1	128400000	129400000
+chr1	128450000	129450000
+chr1	128500000	129500000
+chr1	128550000	129550000
+chr1	128600000	129600000
+chr1	128650000	129650000
+chr1	128700000	129700000
+chr1	128750000	129750000
+chr1	128800000	129800000
+chr1	128850000	129850000
+chr1	128900000	129900000
+chr1	128950000	129950000
+chr1	129000000	130000000
+chr1	129050000	130050000
+chr1	129100000	130100000
+chr1	129150000	130150000
+chr1	129200000	130200000
+chr1	129250000	130250000
+chr1	129300000	130300000
+chr1	129350000	130350000
+chr1	129400000	130400000
+chr1	129450000	130450000
+chr1	129500000	130500000
+chr1	129550000	130550000
+chr1	129600000	130600000
+chr1	129650000	130650000
+chr1	129700000	130700000
+chr1	129750000	130750000
+chr1	129800000	130800000
+chr1	129850000	130850000
+chr1	129900000	130900000
+chr1	129950000	130950000
+chr1	130000000	131000000
+chr1	130050000	131050000
+chr1	130100000	131100000
+chr1	130150000	131150000
+chr1	130200000	131200000
+chr1	130250000	131250000
+chr1	130300000	131300000
+chr1	130350000	131350000
+chr1	130400000	131400000
+chr1	130450000	131450000
+chr1	130500000	131500000
+chr1	130550000	131550000
+chr1	130600000	131600000
+chr1	130650000	131650000
+chr1	130700000	131700000
+chr1	130750000	131750000
+chr1	130800000	131800000
+chr1	130850000	131850000
+chr1	130900000	131900000
+chr1	130950000	131950000
+chr1	131000000	132000000
+chr1	131050000	132050000
+chr1	131100000	132100000
+chr1	131150000	132150000
+chr1	131200000	132200000
+chr1	131250000	132250000
+chr1	131300000	132300000
+chr1	131350000	132350000
+chr1	131400000	132400000
+chr1	131450000	132450000
+chr1	131500000	132500000
+chr1	131550000	132550000
+chr1	131600000	132600000
+chr1	131650000	132650000
+chr1	131700000	132700000
+chr1	131750000	132750000
+chr1	131800000	132800000
+chr1	131850000	132850000
+chr1	131900000	132900000
+chr1	131950000	132950000
+chr1	132000000	133000000
+chr1	132050000	133050000
+chr1	132100000	133100000
+chr1	132150000	133150000
+chr1	132200000	133200000
+chr1	132250000	133250000
+chr1	132300000	133300000
+chr1	132350000	133350000
+chr1	132400000	133400000
+chr1	132450000	133450000
+chr1	132500000	133500000
+chr1	132550000	133550000
+chr1	132600000	133600000
+chr1	132650000	133650000
+chr1	132700000	133700000
+chr1	132750000	133750000
+chr1	132800000	133800000
+chr1	132850000	133850000
+chr1	132900000	133900000
+chr1	132950000	133950000
+chr1	133000000	134000000
+chr1	133050000	134050000
+chr1	133100000	134100000
+chr1	133150000	134150000
+chr1	133200000	134200000
+chr1	133250000	134250000
+chr1	133300000	134300000
+chr1	133350000	134350000
+chr1	133400000	134400000
+chr1	133450000	134450000
+chr1	133500000	134500000
+chr1	133550000	134550000
+chr1	133600000	134600000
+chr1	133650000	134650000
+chr1	133700000	134700000
+chr1	133750000	134750000
+chr1	133800000	134800000
+chr1	133850000	134850000
+chr1	133900000	134900000
+chr1	133950000	134950000
+chr1	134000000	135000000
+chr1	134050000	135050000
+chr1	134100000	135100000
+chr1	134150000	135150000
+chr1	134200000	135200000
+chr1	134250000	135250000
+chr1	134300000	135300000
+chr1	134350000	135350000
+chr1	134400000	135400000
+chr1	134450000	135450000
+chr1	134500000	135500000
+chr1	134550000	135550000
+chr1	134600000	135600000
+chr1	134650000	135650000
+chr1	134700000	135700000
+chr1	134750000	135750000
+chr1	134800000	135800000
+chr1	134850000	135850000
+chr1	134900000	135900000
+chr1	134950000	135950000
+chr1	135000000	136000000
+chr1	135050000	136050000
+chr1	135100000	136100000
+chr1	135150000	136150000
+chr1	135200000	136200000
+chr1	135250000	136250000
+chr1	135300000	136300000
+chr1	135350000	136350000
+chr1	135400000	136400000
+chr1	135450000	136450000
+chr1	135500000	136500000
+chr1	135550000	136550000
+chr1	135600000	136600000
+chr1	135650000	136650000
+chr1	135700000	136700000
+chr1	135750000	136750000
+chr1	135800000	136800000
+chr1	135850000	136850000
+chr1	135900000	136900000
+chr1	135950000	136950000
+chr1	136000000	137000000
+chr1	136050000	137050000
+chr1	136100000	137100000
+chr1	136150000	137150000
+chr1	136200000	137200000
+chr1	136250000	137250000
+chr1	136300000	137300000
+chr1	136350000	137350000
+chr1	136400000	137400000
+chr1	136450000	137450000
+chr1	136500000	137500000
+chr1	136550000	137550000
+chr1	136600000	137600000
+chr1	136650000	137650000
+chr1	136700000	137700000
+chr1	136750000	137750000
+chr1	136800000	137800000
+chr1	136850000	137850000
+chr1	136900000	137900000
+chr1	136950000	137950000
+chr1	137000000	138000000
+chr1	137050000	138050000
+chr1	137100000	138100000
+chr1	137150000	138150000
+chr1	137200000	138200000
+chr1	137250000	138250000
+chr1	137300000	138300000
+chr1	137350000	138350000
+chr1	137400000	138400000
+chr1	137450000	138450000
+chr1	137500000	138500000
+chr1	137550000	138550000
+chr1	137600000	138600000
+chr1	137650000	138650000
+chr1	137700000	138700000
+chr1	137750000	138750000
+chr1	137800000	138800000
+chr1	137850000	138850000
+chr1	137900000	138900000
+chr1	137950000	138950000
+chr1	138000000	139000000
+chr1	138050000	139050000
+chr1	138100000	139100000
+chr1	138150000	139150000
+chr1	138200000	139200000
+chr1	138250000	139250000
+chr1	138300000	139300000
+chr1	138350000	139350000
+chr1	138400000	139400000
+chr1	138450000	139450000
+chr1	138500000	139500000
+chr1	138550000	139550000
+chr1	138600000	139600000
+chr1	138650000	139650000
+chr1	138700000	139700000
+chr1	138750000	139750000
+chr1	138800000	139800000
+chr1	138850000	139850000
+chr1	138900000	139900000
+chr1	138950000	139950000
+chr1	139000000	140000000
+chr1	139050000	140050000
+chr1	139100000	140100000
+chr1	139150000	140150000
+chr1	139200000	140200000
+chr1	139250000	140250000
+chr1	139300000	140300000
+chr1	139350000	140350000
+chr1	139400000	140400000
+chr1	139450000	140450000
+chr1	139500000	140500000
+chr1	139550000	140550000
+chr1	139600000	140600000
+chr1	139650000	140650000
+chr1	139700000	140700000
+chr1	139750000	140750000
+chr1	139800000	140800000
+chr1	139850000	140850000
+chr1	139900000	140900000
+chr1	139950000	140950000
+chr1	140000000	141000000
+chr1	140050000	141050000
+chr1	140100000	141100000
+chr1	140150000	141150000
+chr1	140200000	141200000
+chr1	140250000	141250000
+chr1	140300000	141300000
+chr1	140350000	141350000
+chr1	140400000	141400000
+chr1	140450000	141450000
+chr1	140500000	141500000
+chr1	140550000	141550000
+chr1	140600000	141600000
+chr1	140650000	141650000
+chr1	140700000	141700000
+chr1	140750000	141750000
+chr1	140800000	141800000
+chr1	140850000	141850000
+chr1	140900000	141900000
+chr1	140950000	141950000
+chr1	141000000	142000000
+chr1	141050000	142050000
+chr1	141100000	142100000
+chr1	141150000	142150000
+chr1	141200000	142200000
+chr1	141250000	142250000
+chr1	141300000	142300000
+chr1	141350000	142350000
+chr1	141400000	142400000
+chr1	141450000	142450000
+chr1	141500000	142500000
+chr1	141550000	142550000
+chr1	141600000	142600000
+chr1	141650000	142650000
+chr1	141700000	142700000
+chr1	141750000	142750000
+chr1	141800000	142800000
+chr1	141850000	142850000
+chr1	141900000	142900000
+chr1	141950000	142950000
+chr1	142000000	143000000
+chr1	142050000	143050000
+chr1	142100000	143100000
+chr1	142150000	143150000
+chr1	142200000	143200000
+chr1	142250000	143250000
+chr1	142300000	143300000
+chr1	142350000	143350000
+chr1	142400000	143400000
+chr1	142450000	143450000
+chr1	142500000	143500000
+chr1	142550000	143550000
+chr1	142600000	143600000
+chr1	142650000	143650000
+chr1	142700000	143700000
+chr1	142750000	143750000
+chr1	142800000	143800000
+chr1	142850000	143850000
+chr1	142900000	143900000
+chr1	142950000	143950000
+chr1	143000000	144000000
+chr1	143050000	144050000
+chr1	143100000	144100000
+chr1	143150000	144150000
+chr1	143200000	144200000
+chr1	143250000	144250000
+chr1	143300000	144300000
+chr1	143350000	144350000
+chr1	143400000	144400000
+chr1	143450000	144450000
+chr1	143500000	144500000
+chr1	143550000	144550000
+chr1	143600000	144600000
+chr1	143650000	144650000
+chr1	143700000	144700000
+chr1	143750000	144750000
+chr1	143800000	144800000
+chr1	143850000	144850000
+chr1	143900000	144900000
+chr1	143950000	144950000
+chr1	144000000	145000000
+chr1	144050000	145050000
+chr1	144100000	145100000
+chr1	144150000	145150000
+chr1	144200000	145200000
+chr1	144250000	145250000
+chr1	144300000	145300000
+chr1	144350000	145350000
+chr1	144400000	145400000
+chr1	144450000	145450000
+chr1	144500000	145500000
+chr1	144550000	145550000
+chr1	144600000	145600000
+chr1	144650000	145650000
+chr1	144700000	145700000
+chr1	144750000	145750000
+chr1	144800000	145800000
+chr1	144850000	145850000
+chr1	144900000	145900000
+chr1	144950000	145950000
+chr1	145000000	146000000
+chr1	145050000	146050000
+chr1	145100000	146100000
+chr1	145150000	146150000
+chr1	145200000	146200000
+chr1	145250000	146250000
+chr1	145300000	146300000
+chr1	145350000	146350000
+chr1	145400000	146400000
+chr1	145450000	146450000
+chr1	145500000	146500000
+chr1	145550000	146550000
+chr1	145600000	146600000
+chr1	145650000	146650000
+chr1	145700000	146700000
+chr1	145750000	146750000
+chr1	145800000	146800000
+chr1	145850000	146850000
+chr1	145900000	146900000
+chr1	145950000	146950000
+chr1	146000000	147000000
+chr1	146050000	147050000
+chr1	146100000	147100000
+chr1	146150000	147150000
+chr1	146200000	147200000
+chr1	146250000	147250000
+chr1	146300000	147300000
+chr1	146350000	147350000
+chr1	146400000	147400000
+chr1	146450000	147450000
+chr1	146500000	147500000
+chr1	146550000	147550000
+chr1	146600000	147600000
+chr1	146650000	147650000
+chr1	146700000	147700000
+chr1	146750000	147750000
+chr1	146800000	147800000
+chr1	146850000	147850000
+chr1	146900000	147900000
+chr1	146950000	147950000
+chr1	147000000	148000000
+chr1	147050000	148050000
+chr1	147100000	148100000
+chr1	147150000	148150000
+chr1	147200000	148200000
+chr1	147250000	148250000
+chr1	147300000	148300000
+chr1	147350000	148350000
+chr1	147400000	148400000
+chr1	147450000	148450000
+chr1	147500000	148500000
+chr1	147550000	148550000
+chr1	147600000	148600000
+chr1	147650000	148650000
+chr1	147700000	148700000
+chr1	147750000	148750000
+chr1	147800000	148800000
+chr1	147850000	148850000
+chr1	147900000	148900000
+chr1	147950000	148950000
+chr1	148000000	149000000
+chr1	148050000	149050000
+chr1	148100000	149100000
+chr1	148150000	149150000
+chr1	148200000	149200000
+chr1	148250000	149250000
+chr1	148300000	149300000
+chr1	148350000	149350000
+chr1	148400000	149400000
+chr1	148450000	149450000
+chr1	148500000	149500000
+chr1	148550000	149550000
+chr1	148600000	149600000
+chr1	148650000	149650000
+chr1	148700000	149700000
+chr1	148750000	149750000
+chr1	148800000	149800000
+chr1	148850000	149850000
+chr1	148900000	149900000
+chr1	148950000	149950000
+chr1	149000000	150000000
+chr1	149050000	150050000
+chr1	149100000	150100000
+chr1	149150000	150150000
+chr1	149200000	150200000
+chr1	149250000	150250000
+chr1	149300000	150300000
+chr1	149350000	150350000
+chr1	149400000	150400000
+chr1	149450000	150450000
+chr1	149500000	150500000
+chr1	149550000	150550000
+chr1	149600000	150600000
+chr1	149650000	150650000
+chr1	149700000	150700000
+chr1	149750000	150750000
+chr1	149800000	150800000
+chr1	149850000	150850000
+chr1	149900000	150900000
+chr1	149950000	150950000
+chr1	150000000	151000000
+chr1	150050000	151050000
+chr1	150100000	151100000
+chr1	150150000	151150000
+chr1	150200000	151200000
+chr1	150250000	151250000
+chr1	150300000	151300000
+chr1	150350000	151350000
+chr1	150400000	151400000
+chr1	150450000	151450000
+chr1	150500000	151500000
+chr1	150550000	151550000
+chr1	150600000	151600000
+chr1	150650000	151650000
+chr1	150700000	151700000
+chr1	150750000	151750000
+chr1	150800000	151800000
+chr1	150850000	151850000
+chr1	150900000	151900000
+chr1	150950000	151950000
+chr1	151000000	152000000
+chr1	151050000	152050000
+chr1	151100000	152100000
+chr1	151150000	152150000
+chr1	151200000	152200000
+chr1	151250000	152250000
+chr1	151300000	152300000
+chr1	151350000	152350000
+chr1	151400000	152400000
+chr1	151450000	152450000
+chr1	151500000	152500000
+chr1	151550000	152550000
+chr1	151600000	152600000
+chr1	151650000	152650000
+chr1	151700000	152700000
+chr1	151750000	152750000
+chr1	151800000	152800000
+chr1	151850000	152850000
+chr1	151900000	152900000
+chr1	151950000	152950000
+chr1	152000000	153000000
+chr1	152050000	153050000
+chr1	152100000	153100000
+chr1	152150000	153150000
+chr1	152200000	153200000
+chr1	152250000	153250000
+chr1	152300000	153300000
+chr1	152350000	153350000
+chr1	152400000	153400000
+chr1	152450000	153450000
+chr1	152500000	153500000
+chr1	152550000	153550000
+chr1	152600000	153600000
+chr1	152650000	153650000
+chr1	152700000	153700000
+chr1	152750000	153750000
+chr1	152800000	153800000
+chr1	152850000	153850000
+chr1	152900000	153900000
+chr1	152950000	153950000
+chr1	153000000	154000000
+chr1	153050000	154050000
+chr1	153100000	154100000
+chr1	153150000	154150000
+chr1	153200000	154200000
+chr1	153250000	154250000
+chr1	153300000	154300000
+chr1	153350000	154350000
+chr1	153400000	154400000
+chr1	153450000	154450000
+chr1	153500000	154500000
+chr1	153550000	154550000
+chr1	153600000	154600000
+chr1	153650000	154650000
+chr1	153700000	154700000
+chr1	153750000	154750000
+chr1	153800000	154800000
+chr1	153850000	154850000
+chr1	153900000	154900000
+chr1	153950000	154950000
+chr1	154000000	155000000
+chr1	154050000	155050000
+chr1	154100000	155100000
+chr1	154150000	155150000
+chr1	154200000	155200000
+chr1	154250000	155250000
+chr1	154300000	155300000
+chr1	154350000	155350000
+chr1	154400000	155400000
+chr1	154450000	155450000
+chr1	154500000	155500000
+chr1	154550000	155550000
+chr1	154600000	155600000
+chr1	154650000	155650000
+chr1	154700000	155700000
+chr1	154750000	155750000
+chr1	154800000	155800000
+chr1	154850000	155850000
+chr1	154900000	155900000
+chr1	154950000	155950000
+chr1	155000000	156000000
+chr1	155050000	156050000
+chr1	155100000	156100000
+chr1	155150000	156150000
+chr1	155200000	156200000
+chr1	155250000	156250000
+chr1	155300000	156300000
+chr1	155350000	156350000
+chr1	155400000	156400000
+chr1	155450000	156450000
+chr1	155500000	156500000
+chr1	155550000	156550000
+chr1	155600000	156600000
+chr1	155650000	156650000
+chr1	155700000	156700000
+chr1	155750000	156750000
+chr1	155800000	156800000
+chr1	155850000	156850000
+chr1	155900000	156900000
+chr1	155950000	156950000
+chr1	156000000	157000000
+chr1	156050000	157050000
+chr1	156100000	157100000
+chr1	156150000	157150000
+chr1	156200000	157200000
+chr1	156250000	157250000
+chr1	156300000	157300000
+chr1	156350000	157350000
+chr1	156400000	157400000
+chr1	156450000	157450000
+chr1	156500000	157500000
+chr1	156550000	157550000
+chr1	156600000	157600000
+chr1	156650000	157650000
+chr1	156700000	157700000
+chr1	156750000	157750000
+chr1	156800000	157800000
+chr1	156850000	157850000
+chr1	156900000	157900000
+chr1	156950000	157950000
+chr1	157000000	158000000
+chr1	157050000	158050000
+chr1	157100000	158100000
+chr1	157150000	158150000
+chr1	157200000	158200000
+chr1	157250000	158250000
+chr1	157300000	158300000
+chr1	157350000	158350000
+chr1	157400000	158400000
+chr1	157450000	158450000
+chr1	157500000	158500000
+chr1	157550000	158550000
+chr1	157600000	158600000
+chr1	157650000	158650000
+chr1	157700000	158700000
+chr1	157750000	158750000
+chr1	157800000	158800000
+chr1	157850000	158850000
+chr1	157900000	158900000
+chr1	157950000	158950000
+chr1	158000000	159000000
+chr1	158050000	159050000
+chr1	158100000	159100000
+chr1	158150000	159150000
+chr1	158200000	159200000
+chr1	158250000	159250000
+chr1	158300000	159300000
+chr1	158350000	159350000
+chr1	158400000	159400000
+chr1	158450000	159450000
+chr1	158500000	159500000
+chr1	158550000	159550000
+chr1	158600000	159600000
+chr1	158650000	159650000
+chr1	158700000	159700000
+chr1	158750000	159750000
+chr1	158800000	159800000
+chr1	158850000	159850000
+chr1	158900000	159900000
+chr1	158950000	159950000
+chr1	159000000	160000000
+chr1	159050000	160050000
+chr1	159100000	160100000
+chr1	159150000	160150000
+chr1	159200000	160200000
+chr1	159250000	160250000
+chr1	159300000	160300000
+chr1	159350000	160350000
+chr1	159400000	160400000
+chr1	159450000	160450000
+chr1	159500000	160500000
+chr1	159550000	160550000
+chr1	159600000	160600000
+chr1	159650000	160650000
+chr1	159700000	160700000
+chr1	159750000	160750000
+chr1	159800000	160800000
+chr1	159850000	160850000
+chr1	159900000	160900000
+chr1	159950000	160950000
+chr1	160000000	161000000
+chr1	160050000	161050000
+chr1	160100000	161100000
+chr1	160150000	161150000
+chr1	160200000	161200000
+chr1	160250000	161250000
+chr1	160300000	161300000
+chr1	160350000	161350000
+chr1	160400000	161400000
+chr1	160450000	161450000
+chr1	160500000	161500000
+chr1	160550000	161550000
+chr1	160600000	161600000
+chr1	160650000	161650000
+chr1	160700000	161700000
+chr1	160750000	161750000
+chr1	160800000	161800000
+chr1	160850000	161850000
+chr1	160900000	161900000
+chr1	160950000	161950000
+chr1	161000000	162000000
+chr1	161050000	162050000
+chr1	161100000	162100000
+chr1	161150000	162150000
+chr1	161200000	162200000
+chr1	161250000	162250000
+chr1	161300000	162300000
+chr1	161350000	162350000
+chr1	161400000	162400000
+chr1	161450000	162450000
+chr1	161500000	162500000
+chr1	161550000	162550000
+chr1	161600000	162600000
+chr1	161650000	162650000
+chr1	161700000	162700000
+chr1	161750000	162750000
+chr1	161800000	162800000
+chr1	161850000	162850000
+chr1	161900000	162900000
+chr1	161950000	162950000
+chr1	162000000	163000000
+chr1	162050000	163050000
+chr1	162100000	163100000
+chr1	162150000	163150000
+chr1	162200000	163200000
+chr1	162250000	163250000
+chr1	162300000	163300000
+chr1	162350000	163350000
+chr1	162400000	163400000
+chr1	162450000	163450000
+chr1	162500000	163500000
+chr1	162550000	163550000
+chr1	162600000	163600000
+chr1	162650000	163650000
+chr1	162700000	163700000
+chr1	162750000	163750000
+chr1	162800000	163800000
+chr1	162850000	163850000
+chr1	162900000	163900000
+chr1	162950000	163950000
+chr1	163000000	164000000
+chr1	163050000	164050000
+chr1	163100000	164100000
+chr1	163150000	164150000
+chr1	163200000	164200000
+chr1	163250000	164250000
+chr1	163300000	164300000
+chr1	163350000	164350000
+chr1	163400000	164400000
+chr1	163450000	164450000
+chr1	163500000	164500000
+chr1	163550000	164550000
+chr1	163600000	164600000
+chr1	163650000	164650000
+chr1	163700000	164700000
+chr1	163750000	164750000
+chr1	163800000	164800000
+chr1	163850000	164850000
+chr1	163900000	164900000
+chr1	163950000	164950000
+chr1	164000000	165000000
+chr1	164050000	165050000
+chr1	164100000	165100000
+chr1	164150000	165150000
+chr1	164200000	165200000
+chr1	164250000	165250000
+chr1	164300000	165300000
+chr1	164350000	165350000
+chr1	164400000	165400000
+chr1	164450000	165450000
+chr1	164500000	165500000
+chr1	164550000	165550000
+chr1	164600000	165600000
+chr1	164650000	165650000
+chr1	164700000	165700000
+chr1	164750000	165750000
+chr1	164800000	165800000
+chr1	164850000	165850000
+chr1	164900000	165900000
+chr1	164950000	165950000
+chr1	165000000	166000000
+chr1	165050000	166050000
+chr1	165100000	166100000
+chr1	165150000	166150000
+chr1	165200000	166200000
+chr1	165250000	166250000
+chr1	165300000	166300000
+chr1	165350000	166350000
+chr1	165400000	166400000
+chr1	165450000	166450000
+chr1	165500000	166500000
+chr1	165550000	166550000
+chr1	165600000	166600000
+chr1	165650000	166650000
+chr1	165700000	166700000
+chr1	165750000	166750000
+chr1	165800000	166800000
+chr1	165850000	166850000
+chr1	165900000	166900000
+chr1	165950000	166950000
+chr1	166000000	167000000
+chr1	166050000	167050000
+chr1	166100000	167100000
+chr1	166150000	167150000
+chr1	166200000	167200000
+chr1	166250000	167250000
+chr1	166300000	167300000
+chr1	166350000	167350000
+chr1	166400000	167400000
+chr1	166450000	167450000
+chr1	166500000	167500000
+chr1	166550000	167550000
+chr1	166600000	167600000
+chr1	166650000	167650000
+chr1	166700000	167700000
+chr1	166750000	167750000
+chr1	166800000	167800000
+chr1	166850000	167850000
+chr1	166900000	167900000
+chr1	166950000	167950000
+chr1	167000000	168000000
+chr1	167050000	168050000
+chr1	167100000	168100000
+chr1	167150000	168150000
+chr1	167200000	168200000
+chr1	167250000	168250000
+chr1	167300000	168300000
+chr1	167350000	168350000
+chr1	167400000	168400000
+chr1	167450000	168450000
+chr1	167500000	168500000
+chr1	167550000	168550000
+chr1	167600000	168600000
+chr1	167650000	168650000
+chr1	167700000	168700000
+chr1	167750000	168750000
+chr1	167800000	168800000
+chr1	167850000	168850000
+chr1	167900000	168900000
+chr1	167950000	168950000
+chr1	168000000	169000000
+chr1	168050000	169050000
+chr1	168100000	169100000
+chr1	168150000	169150000
+chr1	168200000	169200000
+chr1	168250000	169250000
+chr1	168300000	169300000
+chr1	168350000	169350000
+chr1	168400000	169400000
+chr1	168450000	169450000
+chr1	168500000	169500000
+chr1	168550000	169550000
+chr1	168600000	169600000
+chr1	168650000	169650000
+chr1	168700000	169700000
+chr1	168750000	169750000
+chr1	168800000	169800000
+chr1	168850000	169850000
+chr1	168900000	169900000
+chr1	168950000	169950000
+chr1	169000000	170000000
+chr1	169050000	170050000
+chr1	169100000	170100000
+chr1	169150000	170150000
+chr1	169200000	170200000
+chr1	169250000	170250000
+chr1	169300000	170300000
+chr1	169350000	170350000
+chr1	169400000	170400000
+chr1	169450000	170450000
+chr1	169500000	170500000
+chr1	169550000	170550000
+chr1	169600000	170600000
+chr1	169650000	170650000
+chr1	169700000	170700000
+chr1	169750000	170750000
+chr1	169800000	170800000
+chr1	169850000	170850000
+chr1	169900000	170900000
+chr1	169950000	170950000
+chr1	170000000	171000000
+chr1	170050000	171050000
+chr1	170100000	171100000
+chr1	170150000	171150000
+chr1	170200000	171200000
+chr1	170250000	171250000
+chr1	170300000	171300000
+chr1	170350000	171350000
+chr1	170400000	171400000
+chr1	170450000	171450000
+chr1	170500000	171500000
+chr1	170550000	171550000
+chr1	170600000	171600000
+chr1	170650000	171650000
+chr1	170700000	171700000
+chr1	170750000	171750000
+chr1	170800000	171800000
+chr1	170850000	171850000
+chr1	170900000	171900000
+chr1	170950000	171950000
+chr1	171000000	172000000
+chr1	171050000	172050000
+chr1	171100000	172100000
+chr1	171150000	172150000
+chr1	171200000	172200000
+chr1	171250000	172250000
+chr1	171300000	172300000
+chr1	171350000	172350000
+chr1	171400000	172400000
+chr1	171450000	172450000
+chr1	171500000	172500000
+chr1	171550000	172550000
+chr1	171600000	172600000
+chr1	171650000	172650000
+chr1	171700000	172700000
+chr1	171750000	172750000
+chr1	171800000	172800000
+chr1	171850000	172850000
+chr1	171900000	172900000
+chr1	171950000	172950000
+chr1	172000000	173000000
+chr1	172050000	173050000
+chr1	172100000	173100000
+chr1	172150000	173150000
+chr1	172200000	173200000
+chr1	172250000	173250000
+chr1	172300000	173300000
+chr1	172350000	173350000
+chr1	172400000	173400000
+chr1	172450000	173450000
+chr1	172500000	173500000
+chr1	172550000	173550000
+chr1	172600000	173600000
+chr1	172650000	173650000
+chr1	172700000	173700000
+chr1	172750000	173750000
+chr1	172800000	173800000
+chr1	172850000	173850000
+chr1	172900000	173900000
+chr1	172950000	173950000
+chr1	173000000	174000000
+chr1	173050000	174050000
+chr1	173100000	174100000
+chr1	173150000	174150000
+chr1	173200000	174200000
+chr1	173250000	174250000
+chr1	173300000	174300000
+chr1	173350000	174350000
+chr1	173400000	174400000
+chr1	173450000	174450000
+chr1	173500000	174500000
+chr1	173550000	174550000
+chr1	173600000	174600000
+chr1	173650000	174650000
+chr1	173700000	174700000
+chr1	173750000	174750000
+chr1	173800000	174800000
+chr1	173850000	174850000
+chr1	173900000	174900000
+chr1	173950000	174950000
+chr1	174000000	175000000
+chr1	174050000	175050000
+chr1	174100000	175100000
+chr1	174150000	175150000
+chr1	174200000	175200000
+chr1	174250000	175250000
+chr1	174300000	175300000
+chr1	174350000	175350000
+chr1	174400000	175400000
+chr1	174450000	175450000
+chr1	174500000	175500000
+chr1	174550000	175550000
+chr1	174600000	175600000
+chr1	174650000	175650000
+chr1	174700000	175700000
+chr1	174750000	175750000
+chr1	174800000	175800000
+chr1	174850000	175850000
+chr1	174900000	175900000
+chr1	174950000	175950000
+chr1	175000000	176000000
+chr1	175050000	176050000
+chr1	175100000	176100000
+chr1	175150000	176150000
+chr1	175200000	176200000
+chr1	175250000	176250000
+chr1	175300000	176300000
+chr1	175350000	176350000
+chr1	175400000	176400000
+chr1	175450000	176450000
+chr1	175500000	176500000
+chr1	175550000	176550000
+chr1	175600000	176600000
+chr1	175650000	176650000
+chr1	175700000	176700000
+chr1	175750000	176750000
+chr1	175800000	176800000
+chr1	175850000	176850000
+chr1	175900000	176900000
+chr1	175950000	176950000
+chr1	176000000	177000000
+chr1	176050000	177050000
+chr1	176100000	177100000
+chr1	176150000	177150000
+chr1	176200000	177200000
+chr1	176250000	177250000
+chr1	176300000	177300000
+chr1	176350000	177350000
+chr1	176400000	177400000
+chr1	176450000	177450000
+chr1	176500000	177500000
+chr1	176550000	177550000
+chr1	176600000	177600000
+chr1	176650000	177650000
+chr1	176700000	177700000
+chr1	176750000	177750000
+chr1	176800000	177800000
+chr1	176850000	177850000
+chr1	176900000	177900000
+chr1	176950000	177950000
+chr1	177000000	178000000
+chr1	177050000	178050000
+chr1	177100000	178100000
+chr1	177150000	178150000
+chr1	177200000	178200000
+chr1	177250000	178250000
+chr1	177300000	178300000
+chr1	177350000	178350000
+chr1	177400000	178400000
+chr1	177450000	178450000
+chr1	177500000	178500000
+chr1	177550000	178550000
+chr1	177600000	178600000
+chr1	177650000	178650000
+chr1	177700000	178700000
+chr1	177750000	178750000
+chr1	177800000	178800000
+chr1	177850000	178850000
+chr1	177900000	178900000
+chr1	177950000	178950000
+chr1	178000000	179000000
+chr1	178050000	179050000
+chr1	178100000	179100000
+chr1	178150000	179150000
+chr1	178200000	179200000
+chr1	178250000	179250000
+chr1	178300000	179300000
+chr1	178350000	179350000
+chr1	178400000	179400000
+chr1	178450000	179450000
+chr1	178500000	179500000
+chr1	178550000	179550000
+chr1	178600000	179600000
+chr1	178650000	179650000
+chr1	178700000	179700000
+chr1	178750000	179750000
+chr1	178800000	179800000
+chr1	178850000	179850000
+chr1	178900000	179900000
+chr1	178950000	179950000
+chr1	179000000	180000000
+chr1	179050000	180050000
+chr1	179100000	180100000
+chr1	179150000	180150000
+chr1	179200000	180200000
+chr1	179250000	180250000
+chr1	179300000	180300000
+chr1	179350000	180350000
+chr1	179400000	180400000
+chr1	179450000	180450000
+chr1	179500000	180500000
+chr1	179550000	180550000
+chr1	179600000	180600000
+chr1	179650000	180650000
+chr1	179700000	180700000
+chr1	179750000	180750000
+chr1	179800000	180800000
+chr1	179850000	180850000
+chr1	179900000	180900000
+chr1	179950000	180950000
+chr1	180000000	181000000
+chr1	180050000	181050000
+chr1	180100000	181100000
+chr1	180150000	181150000
+chr1	180200000	181200000
+chr1	180250000	181250000
+chr1	180300000	181300000
+chr1	180350000	181350000
+chr1	180400000	181400000
+chr1	180450000	181450000
+chr1	180500000	181500000
+chr1	180550000	181550000
+chr1	180600000	181600000
+chr1	180650000	181650000
+chr1	180700000	181700000
+chr1	180750000	181750000
+chr1	180800000	181800000
+chr1	180850000	181850000
+chr1	180900000	181900000
+chr1	180950000	181950000
+chr1	181000000	182000000
+chr1	181050000	182050000
+chr1	181100000	182100000
+chr1	181150000	182150000
+chr1	181200000	182200000
+chr1	181250000	182250000
+chr1	181300000	182300000
+chr1	181350000	182350000
+chr1	181400000	182400000
+chr1	181450000	182450000
+chr1	181500000	182500000
+chr1	181550000	182550000
+chr1	181600000	182600000
+chr1	181650000	182650000
+chr1	181700000	182700000
+chr1	181750000	182750000
+chr1	181800000	182800000
+chr1	181850000	182850000
+chr1	181900000	182900000
+chr1	181950000	182950000
+chr1	182000000	183000000
+chr1	182050000	183050000
+chr1	182100000	183100000
+chr1	182150000	183150000
+chr1	182200000	183200000
+chr1	182250000	183250000
+chr1	182300000	183300000
+chr1	182350000	183350000
+chr1	182400000	183400000
+chr1	182450000	183450000
+chr1	182500000	183500000
+chr1	182550000	183550000
+chr1	182600000	183600000
+chr1	182650000	183650000
+chr1	182700000	183700000
+chr1	182750000	183750000
+chr1	182800000	183800000
+chr1	182850000	183850000
+chr1	182900000	183900000
+chr1	182950000	183950000
+chr1	183000000	184000000
+chr1	183050000	184050000
+chr1	183100000	184100000
+chr1	183150000	184150000
+chr1	183200000	184200000
+chr1	183250000	184250000
+chr1	183300000	184300000
+chr1	183350000	184350000
+chr1	183400000	184400000
+chr1	183450000	184450000
+chr1	183500000	184500000
+chr1	183550000	184550000
+chr1	183600000	184600000
+chr1	183650000	184650000
+chr1	183700000	184700000
+chr1	183750000	184750000
+chr1	183800000	184800000
+chr1	183850000	184850000
+chr1	183900000	184900000
+chr1	183950000	184950000
+chr1	184000000	185000000
+chr1	184050000	185050000
+chr1	184100000	185100000
+chr1	184150000	185150000
+chr1	184200000	185200000
+chr1	184250000	185250000
+chr1	184300000	185300000
+chr1	184350000	185350000
+chr1	184400000	185400000
+chr1	184450000	185450000
+chr1	184500000	185500000
+chr1	184550000	185550000
+chr1	184600000	185600000
+chr1	184650000	185650000
+chr1	184700000	185700000
+chr1	184750000	185750000
+chr1	184800000	185800000
+chr1	184850000	185850000
+chr1	184900000	185900000
+chr1	184950000	185950000
+chr1	185000000	186000000
+chr1	185050000	186050000
+chr1	185100000	186100000
+chr1	185150000	186150000
+chr1	185200000	186200000
+chr1	185250000	186250000
+chr1	185300000	186300000
+chr1	185350000	186350000
+chr1	185400000	186400000
+chr1	185450000	186450000
+chr1	185500000	186500000
+chr1	185550000	186550000
+chr1	185600000	186600000
+chr1	185650000	186650000
+chr1	185700000	186700000
+chr1	185750000	186750000
+chr1	185800000	186800000
+chr1	185850000	186850000
+chr1	185900000	186900000
+chr1	185950000	186950000
+chr1	186000000	187000000
+chr1	186050000	187050000
+chr1	186100000	187100000
+chr1	186150000	187150000
+chr1	186200000	187200000
+chr1	186250000	187250000
+chr1	186300000	187300000
+chr1	186350000	187350000
+chr1	186400000	187400000
+chr1	186450000	187450000
+chr1	186500000	187500000
+chr1	186550000	187550000
+chr1	186600000	187600000
+chr1	186650000	187650000
+chr1	186700000	187700000
+chr1	186750000	187750000
+chr1	186800000	187800000
+chr1	186850000	187850000
+chr1	186900000	187900000
+chr1	186950000	187950000
+chr1	187000000	188000000
+chr1	187050000	188050000
+chr1	187100000	188100000
+chr1	187150000	188150000
+chr1	187200000	188200000
+chr1	187250000	188250000
+chr1	187300000	188300000
+chr1	187350000	188350000
+chr1	187400000	188400000
+chr1	187450000	188450000
+chr1	187500000	188500000
+chr1	187550000	188550000
+chr1	187600000	188600000
+chr1	187650000	188650000
+chr1	187700000	188700000
+chr1	187750000	188750000
+chr1	187800000	188800000
+chr1	187850000	188850000
+chr1	187900000	188900000
+chr1	187950000	188950000
+chr1	188000000	189000000
+chr1	188050000	189050000
+chr1	188100000	189100000
+chr1	188150000	189150000
+chr1	188200000	189200000
+chr1	188250000	189250000
+chr1	188300000	189300000
+chr1	188350000	189350000
+chr1	188400000	189400000
+chr1	188450000	189450000
+chr1	188500000	189500000
+chr1	188550000	189550000
+chr1	188600000	189600000
+chr1	188650000	189650000
+chr1	188700000	189700000
+chr1	188750000	189750000
+chr1	188800000	189800000
+chr1	188850000	189850000
+chr1	188900000	189900000
+chr1	188950000	189950000
+chr1	189000000	190000000
+chr1	189050000	190050000
+chr1	189100000	190100000
+chr1	189150000	190150000
+chr1	189200000	190200000
+chr1	189250000	190250000
+chr1	189300000	190300000
+chr1	189350000	190350000
+chr1	189400000	190400000
+chr1	189450000	190450000
+chr1	189500000	190500000
+chr1	189550000	190550000
+chr1	189600000	190600000
+chr1	189650000	190650000
+chr1	189700000	190700000
+chr1	189750000	190750000
+chr1	189800000	190800000
+chr1	189850000	190850000
+chr1	189900000	190900000
+chr1	189950000	190950000
+chr1	190000000	191000000
+chr1	190050000	191050000
+chr1	190100000	191100000
+chr1	190150000	191150000
+chr1	190200000	191200000
+chr1	190250000	191250000
+chr1	190300000	191300000
+chr1	190350000	191350000
+chr1	190400000	191400000
+chr1	190450000	191450000
+chr1	190500000	191500000
+chr1	190550000	191550000
+chr1	190600000	191600000
+chr1	190650000	191650000
+chr1	190700000	191700000
+chr1	190750000	191750000
+chr1	190800000	191800000
+chr1	190850000	191850000
+chr1	190900000	191900000
+chr1	190950000	191950000
+chr1	191000000	192000000
+chr1	191050000	192050000
+chr1	191100000	192100000
+chr1	191150000	192150000
+chr1	191200000	192200000
+chr1	191250000	192250000
+chr1	191300000	192300000
+chr1	191350000	192350000
+chr1	191400000	192400000
+chr1	191450000	192450000
+chr1	191500000	192500000
+chr1	191550000	192550000
+chr1	191600000	192600000
+chr1	191650000	192650000
+chr1	191700000	192700000
+chr1	191750000	192750000
+chr1	191800000	192800000
+chr1	191850000	192850000
+chr1	191900000	192900000
+chr1	191950000	192950000
+chr1	192000000	193000000
+chr1	192050000	193050000
+chr1	192100000	193100000
+chr1	192150000	193150000
+chr1	192200000	193200000
+chr1	192250000	193250000
+chr1	192300000	193300000
+chr1	192350000	193350000
+chr1	192400000	193400000
+chr1	192450000	193450000
+chr1	192500000	193500000
+chr1	192550000	193550000
+chr1	192600000	193600000
+chr1	192650000	193650000
+chr1	192700000	193700000
+chr1	192750000	193750000
+chr1	192800000	193800000
+chr1	192850000	193850000
+chr1	192900000	193900000
+chr1	192950000	193950000
+chr1	193000000	194000000
+chr1	193050000	194050000
+chr1	193100000	194100000
+chr1	193150000	194150000
+chr1	193200000	194200000
+chr1	193250000	194250000
+chr1	193300000	194300000
+chr1	193350000	194350000
+chr1	193400000	194400000
+chr1	193450000	194450000
+chr1	193500000	194500000
+chr1	193550000	194550000
+chr1	193600000	194600000
+chr1	193650000	194650000
+chr1	193700000	194700000
+chr1	193750000	194750000
+chr1	193800000	194800000
+chr1	193850000	194850000
+chr1	193900000	194900000
+chr1	193950000	194950000
+chr1	194000000	195000000
+chr1	194050000	195050000
+chr1	194100000	195100000
+chr1	194150000	195150000
+chr1	194200000	195200000
+chr1	194250000	195250000
+chr1	194300000	195300000
+chr1	194350000	195350000
+chr1	194400000	195400000
+chr1	194450000	195450000
+chr1	194500000	195500000
+chr1	194550000	195550000
+chr1	194600000	195600000
+chr1	194650000	195650000
+chr1	194700000	195700000
+chr1	194750000	195750000
+chr1	194800000	195800000
+chr1	194850000	195850000
+chr1	194900000	195900000
+chr1	194950000	195950000
+chr1	195000000	196000000
+chr1	195050000	196050000
+chr1	195100000	196100000
+chr1	195150000	196150000
+chr1	195200000	196200000
+chr1	195250000	196250000
+chr1	195300000	196300000
+chr1	195350000	196350000
+chr1	195400000	196400000
+chr1	195450000	196450000
+chr1	195500000	196500000
+chr1	195550000	196550000
+chr1	195600000	196600000
+chr1	195650000	196650000
+chr1	195700000	196700000
+chr1	195750000	196750000
+chr1	195800000	196800000
+chr1	195850000	196850000
+chr1	195900000	196900000
+chr1	195950000	196950000
+chr1	196000000	197000000
+chr1	196050000	197050000
+chr1	196100000	197100000
+chr1	196150000	197150000
+chr1	196200000	197195432
+chr1	196250000	197195432
+chr1	196300000	197195432
+chr1	196350000	197195432
+chr1	196400000	197195432
+chr1	196450000	197195432
+chr1	196500000	197195432
+chr1	196550000	197195432
+chr1	196600000	197195432
+chr1	196650000	197195432
+chr1	196700000	197195432
+chr1	196750000	197195432
+chr1	196800000	197195432
+chr1	196850000	197195432
+chr1	196900000	197195432
+chr1	196950000	197195432
+chr1	197000000	197195432
+chr1	197050000	197195432
+chr1	197100000	197195432
+chr1	197150000	197195432
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/makeWindowBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/makeWindowBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,100 @@
+chr1	0	1971955
+chr1	1971955	3943910
+chr1	3943910	5915865
+chr1	5915865	7887820
+chr1	7887820	9859775
+chr1	9859775	11831730
+chr1	11831730	13803685
+chr1	13803685	15775640
+chr1	15775640	17747595
+chr1	17747595	19719550
+chr1	19719550	21691505
+chr1	21691505	23663460
+chr1	23663460	25635415
+chr1	25635415	27607370
+chr1	27607370	29579325
+chr1	29579325	31551280
+chr1	31551280	33523235
+chr1	33523235	35495190
+chr1	35495190	37467145
+chr1	37467145	39439100
+chr1	39439100	41411055
+chr1	41411055	43383010
+chr1	43383010	45354965
+chr1	45354965	47326920
+chr1	47326920	49298875
+chr1	49298875	51270830
+chr1	51270830	53242785
+chr1	53242785	55214740
+chr1	55214740	57186695
+chr1	57186695	59158650
+chr1	59158650	61130605
+chr1	61130605	63102560
+chr1	63102560	65074515
+chr1	65074515	67046470
+chr1	67046470	69018425
+chr1	69018425	70990380
+chr1	70990380	72962335
+chr1	72962335	74934290
+chr1	74934290	76906245
+chr1	76906245	78878200
+chr1	78878200	80850155
+chr1	80850155	82822110
+chr1	82822110	84794065
+chr1	84794065	86766020
+chr1	86766020	88737975
+chr1	88737975	90709930
+chr1	90709930	92681885
+chr1	92681885	94653840
+chr1	94653840	96625795
+chr1	96625795	98597750
+chr1	98597750	100569705
+chr1	100569705	102541660
+chr1	102541660	104513615
+chr1	104513615	106485570
+chr1	106485570	108457525
+chr1	108457525	110429480
+chr1	110429480	112401435
+chr1	112401435	114373390
+chr1	114373390	116345345
+chr1	116345345	118317300
+chr1	118317300	120289255
+chr1	120289255	122261210
+chr1	122261210	124233165
+chr1	124233165	126205120
+chr1	126205120	128177075
+chr1	128177075	130149030
+chr1	130149030	132120985
+chr1	132120985	134092940
+chr1	134092940	136064895
+chr1	136064895	138036850
+chr1	138036850	140008805
+chr1	140008805	141980760
+chr1	141980760	143952715
+chr1	143952715	145924670
+chr1	145924670	147896625
+chr1	147896625	149868580
+chr1	149868580	151840535
+chr1	151840535	153812490
+chr1	153812490	155784445
+chr1	155784445	157756400
+chr1	157756400	159728355
+chr1	159728355	161700310
+chr1	161700310	163672265
+chr1	163672265	165644220
+chr1	165644220	167616175
+chr1	167616175	169588130
+chr1	169588130	171560085
+chr1	171560085	173532040
+chr1	173532040	175503995
+chr1	175503995	177475950
+chr1	177475950	179447905
+chr1	179447905	181419860
+chr1	181419860	183391815
+chr1	183391815	185363770
+chr1	185363770	187335725
+chr1	187335725	189307680
+chr1	189307680	191279635
+chr1	191279635	193251590
+chr1	193251590	195223545
+chr1	195223545	197195432
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/makeWindowBed_result4.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/makeWindowBed_result4.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,45 @@
+chr5	60000	60667
+chr5	60667	61334
+chr5	61334	62001
+chr5	62001	62668
+chr5	62668	63335
+chr5	63335	64002
+chr5	64002	64669
+chr5	64669	65336
+chr5	65336	66003
+chr5	66003	66670
+chr5	66670	67337
+chr5	67337	68004
+chr5	68004	68671
+chr5	68671	69338
+chr5	69338	70000
+chr5	73000	74134
+chr5	74134	75268
+chr5	75268	76402
+chr5	76402	77536
+chr5	77536	78670
+chr5	78670	79804
+chr5	79804	80938
+chr5	80938	82072
+chr5	82072	83206
+chr5	83206	84340
+chr5	84340	85474
+chr5	85474	86608
+chr5	86608	87742
+chr5	87742	88876
+chr5	88876	90000
+chr5	100000	100067
+chr5	100067	100134
+chr5	100134	100201
+chr5	100201	100268
+chr5	100268	100335
+chr5	100335	100402
+chr5	100402	100469
+chr5	100469	100536
+chr5	100536	100603
+chr5	100603	100670
+chr5	100670	100737
+chr5	100737	100804
+chr5	100804	100871
+chr5	100871	100938
+chr5	100938	101000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mapBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20	a1	1	+
+chr1	50	60	a2	2	-
+chr1	80	90	a3	3	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mapBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,5 @@
+chr1	12	14	b1	2	+
+chr1	13	15	b2	5	-
+chr1	16	18	b3	5	+
+chr1	82	85	b4	2	-
+chr1	85	87	b5	3	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mapBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20	a1	1	+	4
+chr1	50	60	a2	2	-	.
+chr1	80	90	a3	3	-	2.5
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mapBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20	a1	1	+	2,5,5
+chr1	50	60	a2	2	-	.
+chr1	80	90	a3	3	-	2,3
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mapBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20	a1	1	+	5
+chr1	50	60	a2	2	-	.
+chr1	80	90	a3	3	-	3
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mapBed_result4.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapBed_result4.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20	a1	1	+	2,5
+chr1	50	60	a2	2	-	.
+chr1	80	90	a3	3	-	2
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/maskFastaBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/maskFastaBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+>chr1
+GACTCATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNAAACAAGTACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGTTTATGTTGGTTTCA
+TGGTTTTGTCTAACTTTATCGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCGGCTTGTTTACGAATTAAATCGAAG
+TGGACTGCTGGCGTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTTTTCTCACTTCTGTTACTCCAGCTTCTTCGGCA
+CCTGTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/maskFastaBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/maskFastaBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+>chr1
+GACTCATGATttcttacctattagtggttgaacatcgtgatatgtatgttgacggccataaggctgcttcttgttgtcga
+tagaacttcatgtgcctgtaAAACAAGTACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGTTTATGTTGGTTTCA
+TGGTTTTGTCTAACTTTATCGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCGGCTTGTTTACGAATTAAATCGAAG
+TGGACTGCTGGCGTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTTTTCTCACTTCTGTTACTCCAGCTTCTTCGGCA
+CCTGTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	100	200
+chr1	180	250
+chr1	250	500
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	100	200	a1	1	+
+chr1	180	250	a2	2	+
+chr1	250	500	a3	3	-
+chr1	501	1000	a4	4	+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	100	200
+chr1	180	250
+chr1	250	500
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed4.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed4.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	200
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed_result.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed_result.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	100	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	500
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	500
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	500
+chr1	501	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mergedBed_result4.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mergedBed_result4.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	100	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mm9.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mm9.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,36 @@
+chr1	197195432
+chr2	181748087
+chr3	159599783
+chr4	155630120
+chr5	152537259
+chr6	149517037
+chr7	152524553
+chr8	131738871
+chr9	124076172
+chr10	129993255
+chr11	121843856
+chr12	121257530
+chr13	120284312
+chr14	125194864
+chr15	103494974
+chr16	98319150
+chr17	95272651
+chr18	90772031
+chr19	61342430
+chrX	166650296
+chrY	15902555
+chrM	16299
+chr13_random	400311
+chr16_random	3994
+chr17_random	628739
+chr1_random	1231697
+chr3_random	41899
+chr4_random	160594
+chr5_random	357350
+chr7_random	362490
+chr8_random	849593
+chr9_random	449403
+chrUn_random	5900358
+chrX_random	1785075
+chrY_random	58682461
+
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mm9_chr1.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mm9_chr1.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	197195432
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiCov1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiCov1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+dummy_chr	1	100
+dummy_chr	1000	1000000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiCovBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiCovBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+dummy_chr	1	100	0	0
+dummy_chr	1000	1000000	2	2
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	6	12
+chr1	10	20
+chr1	22	27
+chr1	24	30
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed1.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed1.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	5000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	12	32
+chr1	14	30
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	8	15
+chr1	10	14
+chr1	32	34
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+chr1	6	8	1	1	1	0	0
+chr1	8	12	2	1,3	1	0	1
+chr1	12	15	3	1,2,3	1	1	1
+chr1	15	20	2	1,2	1	1	0
+chr1	20	22	1	2	0	1	0
+chr1	22	30	2	1,2	1	1	0
+chr1	30	32	1	2	0	1	0
+chr1	32	34	1	3	0	0	1
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,9 @@
+chrom	start	end	num	list	/tmp/tmpTVZ0hffiles/000/dataset_5.dat	/tmp/tmpTVZ0hffiles/000/dataset_6.dat	/tmp/tmpTVZ0hffiles/000/dataset_7.dat
+chr1	6	8	1	1	1	0	0
+chr1	8	12	2	1,3	1	0	1
+chr1	12	15	3	1,2,3	1	1	1
+chr1	15	20	2	1,2	1	1	0
+chr1	20	22	1	2	0	1	0
+chr1	22	30	2	1,2	1	1	0
+chr1	30	32	1	2	0	1	0
+chr1	32	34	1	3	0	0	1
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/multiIntersectBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiIntersectBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,10 @@
+chr1	0	6	0	none	0	0	0
+chr1	6	8	1	1	1	0	0
+chr1	8	12	2	1,3	1	0	1
+chr1	12	15	3	1,2,3	1	1	1
+chr1	15	20	2	1,2	1	1	0
+chr1	20	22	1	2	0	1	0
+chr1	22	30	2	1,2	1	1	0
+chr1	30	32	1	2	0	1	0
+chr1	32	34	1	3	0	0	1
+chr1	34	5000	0	none	0	0	0
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/mygenome.bed
--- a/test-data/mygenome.bed	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-chr1	1000
-chr2	800
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/nucBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nucBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	10	100
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/nucBed1.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nucBed1.fasta	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+>chr1
+GACTCATGATTTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGA
+TAGAACTTCATGTGCCTGTAAAACAAGTACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGTTTATGTTGGTTTCA
+TGGTTTTGTCTAACTTTATCGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCGGCTTGTTTACGAATTAAATCGAAG
+TGGACTGCTGGCGTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTTTTCTCACTTCTGTTACTCCAGCTTCTTCGGCA
+CCTGTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/nucBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nucBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+#1_usercol	2_usercol	3_usercol	4_pct_at	5_pct_gc	6_num_A	7_num_C	8_num_G	9_num_T	10_num_N	11_num_oth	12_seq_len
+chr1	10	100	0.588889	0.411111	19	16	21	34	0	0	90
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/nucBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nucBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+#1_usercol	2_usercol	3_usercol	4_pct_at	5_pct_gc	6_num_A	7_num_C	8_num_G	9_num_T	10_num_N	11_num_oth	12_seq_len	13_seq
+chr1	10	100	0.588889	0.411111	19	16	21	34	0	0	90	TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/overlapBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/overlapBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	100	200	chr1	500	1000	-300
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/randomBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/randomBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	115594142	115594147	1	5	+
+chr1	167415497	167415502	2	5	-
+chr1	191692404	191692409	3	5	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/reldistBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/reldistBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+reldist	count	total	fraction
+0.00	1	1	1.000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	10000
+chr2	8000
+chr3	5000
+chr4	2000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	0	100	a1	1	+
+chr1	0	1000	a2	2	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	0	100
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr2	5070	5170	a1	1	+
+chr1	2199	3199	a2	2	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	9383	9483	a1	1	+
+chr1	886	1886	a2	2	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr2	5070	5170	a1	1	+
+chr1	2199	3199	a2	2	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/shuffleBed_result4.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shuffleBed_result4.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr2	5070	5170	a1	1	+
+chr3	4411	5000	a2	2	-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/slopBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slopBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	95	205
+chr1	175	255
+chr1	245	505
+chr1	496	1005
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/slopBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slopBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	98	203
+chr1	178	253
+chr1	248	503
+chr1	499	1003
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/sortBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	800	1000
+chr1	80	180
+chr1	1	10
+chr1	750	10000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/sortBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,4 @@
+chr1	1	10
+chr1	80	180
+chr1	750	10000
+chr1	800	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/srma_in3.bam
Binary file test-data/srma_in3.bam has changed
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/subtractBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/subtractBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+chr1	10	20
+chr1	100	200
+chr1	301	400
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/subtractBed2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/subtractBed2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	0	30
+chr1	180	300
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/subtractBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/subtractBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	180
+chr1	301	400
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/subtractBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/subtractBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	200
+chr1	301	400
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/subtractBed_result3.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/subtractBed_result3.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	301	400
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/t
--- a/test-data/t	Tue Nov 04 01:45:04 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4 +0,0 @@
-chr1 100	200	nasty 1	-
-chr2 500	1000	ugly	2	+
-chr3 1000 5000	big	3	-
-
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/tagBed1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tagBed1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,3 @@
+dummy_chr	1100	1479	foo
+dummy_chr	120882	127882	bar
+dummy_chr	5590013	5596013	42
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/tagBed_result1.bam
Binary file test-data/tagBed_result1.bam has changed
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs1.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs1.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	1000	1500	10
+chr1	2000	2100	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs1.len
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs1.len	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	5000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs2.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs2.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	900 1600	60
+chr1	1700	2050	50
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs3.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs3.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	1980	2070	80
+chr1	2090	2100	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs_result1.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs_result1.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,5 @@
+chr1	1000	1500	10	N/A	N/A
+chr1	1980	2000	N/A	N/A	80
+chr1	2000	2070	20	N/A	80
+chr1	2070	2090	20	N/A	N/A
+chr1	2090	2100	20	N/A	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs_result2.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs_result2.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,6 @@
+chrom	start	end
+chr1	1000	1500	10	N/A	N/A
+chr1	1980	2000	N/A	N/A	80
+chr1	2000	2070	20	N/A	80
+chr1	2070	2090	20	N/A	N/A
+chr1	2090	2100	20	N/A	20
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs_result3.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs_result3.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+chr1	0	1000	N/A	N/A	N/A
+chr1	1000	1500	10	N/A	N/A
+chr1	1500	1980	N/A	N/A	N/A
+chr1	1980	2000	N/A	N/A	80
+chr1	2000	2070	20	N/A	80
+chr1	2070	2090	20	N/A	N/A
+chr1	2090	2100	20	N/A	20
+chr1	2100	5000	N/A	N/A	N/A
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/unionBedGraphs_result4.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/unionBedGraphs_result4.bg	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,8 @@
+chr1	0	1000	N/A	N/A	N/A
+chr1	1000	1500	10	N/A	N/A
+chr1	1500	1980	N/A	N/A	N/A
+chr1	1980	2000	N/A	N/A	80
+chr1	2000	2070	20	N/A	80
+chr1	2070	2090	20	N/A	N/A
+chr1	2090	2100	20	N/A	20
+chr1	2100	5000	N/A	N/A	N/A
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/windowBed_result1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/windowBed_result1.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,1 @@
+chr1	100	200	chr1	500	1000
diff -r b8348686a0b9 -r 82aac94b06c3 test-data/windowBed_result2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/windowBed_result2.bed	Thu Jan 08 14:25:51 2015 -0500
@@ -0,0 +1,2 @@
+chr1	100	200	chr1	500	1000
+chr1	100	200	chr1	1300	2000
diff -r b8348686a0b9 -r 82aac94b06c3 tool_dependencies.xml
--- a/tool_dependencies.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/tool_dependencies.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
-  <package name="bedtools" version="2.19.1">
-      <repository changeset_revision="fb3a854c7104" name="package_bedtools_2_19" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+    <package name="bedtools" version="2.22">
+        <repository changeset_revision="960f83563956" name="package_bedtools_2_22" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>
diff -r b8348686a0b9 -r 82aac94b06c3 unionBedGraphs.xml
--- a/unionBedGraphs.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/unionBedGraphs.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -1,106 +1,106 @@
-<tool id="bedtools_mergebedgraph" name="Merge BedGraph files" version="@WRAPPER_VERSION@.0">
+<tool id="bedtools_unionbedgraph" name="Merge BedGraph files" version="@WRAPPER_VERSION@.0">
     <description></description>
     <macros>
         <import>macros.xml</import>
     </macros>
     <expand macro="requirements" />
     <expand macro="stdio" />
-    <command>unionBedGraphs
+    <command>
+<![CDATA[
+    unionBedGraphs
         $header
-        -filler '$filler'
+        -filler "${filler}"
         #if $zero.value == True:
             -empty
-            -g ${chromInfo}
-        #end if
-        
-        -i '$input1'
-        '$input2'
-        #for $q in $bedgraphs
-            '${q.input}'
-        #end for
-
-        -names
-        #if $name1.choice == "tag":
-            '${input1.name}'
-        #else
-            '${name1.custom_name}'
+            -g $genome
         #end if
 
-        #if $name2.choice == "tag":
-            '${input2.name}'
-        #else
-            '${name2.custom_name}'
+        #if str($tag.tag_select) == "tag":
+            #set files = '" "'.join( [ str( $file ) for $file in $tag.inputs ] )
+            -i "${files}"
+        #else:
+            -i
+            #for $bg in $tag.bedgraphs:
+                "${bg.input}"
+            #end for
+            -names
+            #for $bg in $tag.bedgraphs:
+                "${bg.custom_name}"
+            #end for
         #end if
-
-        #for $q in $bedgraphs
-            #if $q.name.choice == "tag":
-                '${q.input.name}'
-            #else
-                '${q.input.custom_name}'
-            #end if
-        #end for
-        &gt; '$output'
+        > "${output}"
+]]>
     </command>
     <inputs>
-        <!-- Make it easy for the user, first two input files are always shown -->
-        <!-- INPUT 1 -->
-        <param name="input1" format="bedgraph" type="data" label="First BedGraph file" />
-        
-        <conditional name="name1">
-            <param name="choice" type="select" label="Sample name">
+        <conditional name="tag">
+            <param name="tag_select" type="select" label="Sample name">
                 <option value="tag" selected="true">Use input's tag</option>
-                <option value="custom">Enter custom table name</option>
+                <option value="custom">Enter custom name per file</option>
             </param>
             <when value="tag">
+                <param name="inputs" format="bedgraph" type="data" multiple="True" label="BedGraph files" />
             </when>
             <when value="custom">
-                <param name="custom_name" type="text" area="false" label="Custom sample name"/>
-            </when>
-        </conditional>
-
-        <!-- INPUT 2 -->
-        <param name="input2" format="bedgraph" type="data" label="Second BedGraph file" />
-        
-        <conditional name="name2">
-            <param name="choice" type="select" label="Sample name">
-                <option value="tag" selected="true">Use input's tag</option>
-                <option value="custom">Enter custom table name</option>
-            </param>
-            <when value="tag">
-            </when>
-            <when value="custom">
-                <param name="custom_name" type="text" area="false" label="Custom sample name"/>
+                <repeat name="bedgraphs" title="Add BedGraph files" min="2" >
+                    <param name="input" format="bedgraph" type="data" multiple="True" label="BedGraph file" />
+                    <param name="custom_name" type="text" area="false" label="Custom sample name"/>
+                </repeat>
             </when>
         </conditional>
-
-        <!-- Additional files, if the user needs more -->
-        <repeat name="bedgraphs" title="Add'l BedGraph files" >
-            <param name="input" format="bedgraph" type="data" label="BedGraph file" />
-            <conditional name="name">
-                <param name="choice" type="select" label="Sample name">
-                    <option value="tag" selected="true">Use input's tag</option>
-                    <option value="custom">Enter custom table name</option>
-                </param>
-                <when value="tag">
-                </when>
-                <when value="custom">
-                    <param name="custom_name" type="text" area="false" label="Custom sample name"/>
-                </when>
-            </conditional>
-        </repeat>
-
-        <param name="header" type="boolean" checked="true" truevalue="-header" falsevalue="" label="Print header line" help="The first line will include the name of each sample." />
-
-        <param name="zero" type="boolean" checked="true" label="Report regions with zero coverage" help="If set, regions without any coverage will also be reported. Requires a valid organism key for all input datasets" />
-
-        <param name="filler" type="text" value="0" label="Text to use for no-coverage value" help="Can be 0.0, N/A, - or any other value." />
+        <expand macro="genome" />
+        <param name="zero" type="boolean" checked="true"
+            label="Report regions with zero coverage"
+            help="If set, regions without any coverage will also be reported. Requires a valid organism key for all input datasets" />
+        <param name="filler" type="text" value="N/A"
+            label="Text to use for no-coverage value"
+            help="Can be 0.0, N/A, - or any other value. (-filler)" />
+        <expand macro="print_header" />
     </inputs>
-
     <outputs>
-        <data format="tabular" name="output"  metadata_source="input1" label="Merged BedGraphs of ${input1.name}, ${input2.name} and so on." />
+        <data name="output" format="bedgraph" />
     </outputs>
+    <tests>
+        <test>
+            <param name="tag_select" value="tag"/>
+            <param name="inputs" value="unionBedGraphs1.bg,unionBedGraphs2.bg,unionBedGraphs3.bg" ftype="bedgraph" />
+            <param name="zero" value="False"/>
+            <output name="output" file="unionBedGraphs_result1.bg" ftype="bedgraph" />
+        </test>
+        <test>
+            <param name="tag_select" value="tag"/>
+            <param name="inputs" value="unionBedGraphs1.bg,unionBedGraphs2.bg,unionBedGraphs3.bg" ftype="bedgraph" />
+            <param name="header" value="True"/>
+            <param name="zero" value="False"/>
+            <output name="output" file="unionBedGraphs_result2.bg" ftype="bedgraph" />
+        </test>
+        <test>
+            <param name="tag_select" value="tag"/>
+            <param name="inputs" value="unionBedGraphs1.bg,unionBedGraphs2.bg,unionBedGraphs3.bg" ftype="bedgraph" />
+            <param name="zero" value="True"/>
+            <param name="genome" value="unionBedGraphs1.len"/>
+            <output name="output" file="unionBedGraphs_result3.bg" ftype="bedgraph" />
+        </test>
+        <test>
+            <param name="tag_select" value="custom"/>
+            <repeat name="bedgraphs">
+                <param name="input" value="unionBedGraphs1.bg" />
+                <param name="custom_name" value="first" />
+            </repeat>
+            <repeat name="bedgraphs">
+                <param name="input" value="unionBedGraphs2.bg" />
+                <param name="custom_name" value="second" />
+            </repeat>
+            <repeat name="bedgraphs">
+                <param name="input" value="unionBedGraphs3.bg" />
+                <param name="custom_name" value="third" />
+            </repeat>
+            <param name="zero" value="True"/>
+            <param name="genome" value="unionBedGraphs1.len"/>
+            <output name="output" file="unionBedGraphs_result4.bg" ftype="bedgraph" />
+        </test>
+    </tests>
     <help>
-    
+<![CDATA[
 **What it does**
 
 This tool merges multiple BedGraph files, allowing direct and fine-scale coverage comparisons among many samples/files. The BedGraph files need not represent the same intervals; the tool will identify both common and file-specific intervals. In addition, the BedGraph values need not be numeric: one can use any text as the BedGraph value and the tool will compare the values from multiple files.
@@ -226,7 +226,7 @@
     chr1   600    700    0         0.43
 
 @REFERENCES@
- 
+]]>
     </help>
     <expand macro="citations" />
 </tool>
diff -r b8348686a0b9 -r 82aac94b06c3 windowBed.xml
--- a/windowBed.xml	Tue Nov 04 01:45:04 2014 -0500
+++ b/windowBed.xml	Thu Jan 08 14:25:51 2015 -0500
@@ -6,6 +6,7 @@
     <expand macro="requirements" />
     <expand macro="stdio" />
     <command>
+<![CDATA[
         bedtools window
         #if $inputA.ext == "bam":
             -abam $inputA
@@ -13,38 +14,42 @@
             -a $inputA
         #end if
         -b $inputB
-        $ubam
         $bed
         $strandB
-        #if $addition.addition_select == 'b':
-        -w $addition.b
+        #if $addition.addition_select == 'window':
+            -w $addition.w
         #elif $addition.addition_select == 'lr':
-        -l $addition.l
-        -r $addition.r
+            -l $addition.l
+            -r $addition.r
         #end if
         $original
         $number
         $nooverlaps
         $header
-        &gt; $output
+        > $output
+]]>
     </command>
     <inputs>
         <param format="bed,bam,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF/BAM file"/>
         <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/>
-        <param name="ubam" type="boolean" checked="false" truevalue="-ubam" falsevalue="" label="Write uncompressed BAM output" />
-        <param name="bed" type="boolean" checked="false" truevalue="bed" falsevalue="" label="When using BAM input, write output as BED. The default is to write output in BAM when using a bam file" />
+        <param name="bed" type="boolean" checked="false" truevalue="-bed" falsevalue=""
+            label="When using BAM input, write output as BED. The default is to write output in BAM when using a bam file"
+            help="(-bed)" />
         <conditional name="addition">
             <param name="addition_select" type="select" label="Choose what you want to do">
-                <option value="huhn" selected="True">Do not change added base pairs</option>
-                <option value="b">Add Base pairs for **both** upstream and downstream of each entry in A when searching for overlaps in B</option>
+                <option value="window">Add Base pairs for **both** upstream and downstream of each entry in A when searching for overlaps in B</option>
                 <option value="lr">Add Base pairs **separately** for upstream and downstream of each entry in A when searching for overlaps in B</option>
             </param>
-            <when value="b">
-                <param name="b" label="Give Value" type="integer" value="1000"  />
+            <when value="window">
+                <param name="w" type="integer" value="1000" label="Base pairs to add upstream and downstream" />
             </when>
             <when value="lr">
-                <param name="l" label="Base pairs added upstream (left of) of each entry in A when searching for overlaps in B. Allows one to create assymetrical “windows”. Default is 1000bp" type="integer" value="1000"  />
-                <param name="r" label="Base pairs added downstream (right of) of each entry in A when searching for overlaps in B. Allows one to create assymetrical “windows”. Default is 1000bp" type="integer" value="1000"  />
+                <param name="l" type="integer" value="1000"
+                    label="Base pairs added upstream (left) of each entry in A when searching for overlaps in B"
+                    help="Allows one to create assymetrical “windows”. Default is 1000bp. (-l)" />
+                <param name="r" type="integer" value="1000"
+                    label="Base pairs added downstream (right) of each entry in A when searching for overlaps in B"
+                    help="Allows one to create assymetrical “windows”. Default is 1000bp. (-r)" />
             </when>
         </conditional>
         <param name="strandB" type="select" label="Calculation based on strandedness?">
@@ -52,17 +57,43 @@
             <option value="-sm">Only report hits in B that overlap A on the **same** strand</option>
             <option value="-Sm">Only report hits in B that overlap A on the **opposite** strand</option>
         </param>
-        <param name="original" type="boolean" checked="false" truevalue="-u" falsevalue="" label="Write original A entry once if any overlaps found in B. In other words, just report the fact at least one overlap was found in B" />
-        <param name="number" type="boolean" checked="false" truevalue="-c" falsevalue="" label="For each entry in A, report the number of hits in B while restricting to -f. Reports 0 for A entries that have no overlap with B" />
-        <param name="nooverlaps" type="boolean" checked="false" truevalue="-v" falsevalue="" label="Only report those entries in A that have no overlaps with B" />
-        <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results" />
-
+        <param name="original" type="boolean" checked="false" truevalue="-u" falsevalue=""
+            label="Write original A entry once if any overlaps found in B"
+            help="In other words, just report the fact at least one overlap was found in B. (-u)" />
+        <param name="number" type="boolean" checked="false" truevalue="-c" falsevalue=""
+            label="For each entry in A, report the number of hits in B"
+            help="Reports 0 for A entries that have no overlap with B (-c)" />
+        <param name="nooverlaps" type="boolean" checked="false" truevalue="-v" falsevalue=""
+            label="Only report those entries in A that have no overlaps with B" help="(-v)" />
+        <expand macro="print_header" />
     </inputs>
     <outputs>
         <data format_source="inputA" name="output" metadata_source="inputA" label=""/>
     </outputs>
+    <tests>
+        <test>
+            <param name="inputA" value="windowBedA.bed" ftype="bed" />
+            <param name="inputB" value="windowBedB.bed" ftype="bed" />
+            <output name="output" file="windowBed_result1.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="windowBedA.bed" ftype="bed" />
+            <param name="inputB" value="windowBedB.bed" ftype="bed" />
+            <param name="addition_select" value="window" />
+            <param name="w" value="5000" />
+            <output name="output" file="windowBed_result2.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="inputA" value="windowBedA.bed" ftype="bed" />
+            <param name="inputB" value="windowBedB.bed" ftype="bed" />
+            <param name="addition_select" value="lr" />
+            <param name="l" value="200" />
+            <param name="r" value="20000" />
+            <output name="output" file="windowBed_result2.bed" ftype="bed" />
+        </test>
+    </tests>
     <help>
-
+<![CDATA[
 **What it does**
 
 Similar to bedtools intersect, window searches for overlapping features in A and B. However, window adds a specified number (1000, by default) of base pairs upstream and downstream of each feature in A. In effect, this allows features in B that are “near” features in A to be detected.
@@ -70,6 +101,7 @@
 .. image:: $PATH_TO_IMAGES/window-glyph.png
 
 @REFERENCES@
+]]>
     </help>
     <expand macro="citations" />
 </tool>