changeset 0:ef4b5ce71745 draft default tip

planemo upload for repository https://github.com/bgruening/iuc/tree/master/tools/biscot commit cce7b9b092030d3bb23a706ca3bf2dece9c20b5f
author iuc
date Fri, 06 Jan 2023 22:10:44 +0000 (2023-01-06)
parents
children
files biscot.xml macros.xml test-data/bionano_key_file.txt test-data/query_cmap_file.cmap test-data/reference_cmap_file.cmap test-data/small.fasta.gz test-data/xml_configuration_file.xmap
diffstat 7 files changed, 1344 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/biscot.xml	Fri Jan 06 22:10:44 2023 +0000
@@ -0,0 +1,131 @@
+<tool id="biscot" name="BiSCoT" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="20.01">
+    <description>Bionano scaffolding correction</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command detect_errors="exit_code"><![CDATA[
+        biscot
+        --cmap-ref '${cmap_ref}'
+        --cmap-1 '${cmap_1}'
+        --xmap-1 '${xmap_1}'
+        --key $key
+        --contigs $contigs
+        #if $secondary_map.cmap_2
+            --cmap-2 '${cmap_2}'
+            --xmap-2 '${xmap_2}'
+        #end if
+        #if $xmap_2enz
+            --xmap-2enz '${xmap_2enz}'
+        #end if
+        ## $aggressive # disabled due to dependency conflicts
+        $only_confirmed_pos
+    ]]>    </command>
+    <inputs>
+        <param argument="--cmap-ref" type="data" format="cmap" label="Reference CMAP file" help="This file describes the positions of enzymatic labelling sites on the reference genome" />
+        <param argument="--cmap-1" type="data" format="cmap" label="Query CMAP file" help="This file describes the positions of enzymatic labelling sites on the contigs" />
+        <param argument="--xmap-1" type="data" format="xml,txt" label="XML configuration file" help="This file describes the alignments of contig labels on the anchor" />
+        <param argument="--contigs" type="data" format="fasta" label="Contigs file" help="Contigs file (FASTA) that was scaffolded by the Bionano scaffold" />
+        <param argument="--key" type="data" format="tabular" label="Bionano key file" help="Bionano key file giving the correspondance between maps and contigs" />
+        <section name="secondary_map" title="Secondary map">
+            <param argument="--cmap-2" type="data" format="cmap" optional="true" label="Query CMAP file" help="This file describes the positions of enzymatic labelling sites on the contigs" />
+            <param argument="--xmap-2" type="data" format="xml,txt" optional="true" label="XML configuration file" help="This file describes the alignments of contig labels on the anchor" />
+        </section>
+        <param argument="--xmap-2enz" type="data" format="xml,txt" optional="true" label="Two enzymes XML configuration file" help="This argument is used to provide the final XMAP file containing 
+            the mappings of labels of both enzymes. This argument is useful (and recommended) to ensure that no mapping has been missed inside one of the individual XMAP file" />
+        <param argument="--aggressive" type="boolean" truevalue="--aggressive" falsevalue="" checked="false" 
+            label="Enable BLAT phase" help=" enables the sequence similarity scaffolding. In a first phase, BiSCoT will search similarities between contigs based on label mappings. If this parameter is set, 
+                BiSCoT will search for sequence similarity to close gaps created by the first step" />
+        <param argument="--only-confirmed-pos" type="boolean" truevalue="--only-confirmed-pos" falsevalue="" checked="false" 
+            label="Only confirmed positions" help="To be retained, an alignment position in --xmap-1 or --xmap-2 has to be present in --xmap-2enz" />
+        <param name="log_file" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Generate log file" help="Log file can be helpful for debuggin purposes" />
+    </inputs>
+    <outputs>
+        <data name="log" format="txt"  from_work_dir="biscot/biscot.log" label="${tool.name} on ${on_string}: log file">
+            <filter>log_file</filter>
+        </data>
+        <data name="fasta" format="fasta" from_work_dir="biscot/scaffolds.fasta" label="${tool.name} on ${on_string}: scaffolds (FASTA)"/>
+        <data name="agp" format="agp"  from_work_dir="biscot/scaffolds.agp" label="${tool.name} on ${on_string}: scaffolds (AGP)"/>
+  </outputs>
+    <tests>
+        <test expect_num_outputs="3">
+            <param name="cmap_ref" value="reference_cmap_file.cmap"/>
+            <param name="cmap_1" value="query_cmap_file.cmap"/>
+            <param name="xmap_1" value="xml_configuration_file.xmap"/>
+            <param name="contigs" value="small.fasta.gz"/>
+            <param name="key" value="bionano_key_file.txt"/>
+            <param name="log_file" value="true"/>
+            <output name="log">
+                <assert_contents>
+                    <has_text text="Final AGP and scaffolds file are in biscot/scaffolds.agp and biscot/scaffolds.fasta"/>
+                    <has_text text="Converting agp file to fasta"/>
+                    <has_n_lines n="13"/>
+                </assert_contents>
+            </output>
+            <output name="fasta">
+                <assert_contents>
+                    <has_text text="Super-Scaffold_1"/>
+                    <has_text text="TCATCGGTTAAATCATCGCCCAGAAATACGGGCGT"/>
+                    <has_size value="2097147"/>
+                </assert_contents>
+            </output>
+            <output name="agp">
+                <assert_contents>
+                    <has_text text="Super-Scaffold_1"/>
+                    <has_text text="4753350"/>
+                    <has_n_lines n="3"/>
+                </assert_contents>
+            </output>
+        </test>
+    <test expect_num_outputs="2">
+        <param name="cmap_ref" value="reference_cmap_file.cmap"/>
+        <param name="cmap_1" value="query_cmap_file.cmap"/>
+        <param name="xmap_1" value="xml_configuration_file.xmap"/>
+        <param name="contigs" value="small.fasta.gz"/>
+        <param name="key" value="bionano_key_file.txt"/>
+        <param name="xmap_2enz" value="xml_configuration_file.xmap"/>
+        <param name="aggressive" value="true"/>
+        <param name="only_confirmed_pos" value="true"/>
+        <section name="secondary_map">
+            <param name="cmap_2" value="query_cmap_file.cmap"/>
+            <param name="xmap_2" value="xml_configuration_file.xmap"/>
+        </section>
+        <output name="fasta">
+            <assert_contents>
+                <has_text text="Super-Scaffold_1"/>
+                <has_text text="TCATCGGTTAAATCATCGCCCAGAAATACGGGCGT"/>
+                <has_size value="2097147"/>
+            </assert_contents>
+        </output>
+        <output name="agp">
+            <assert_contents>
+                <has_text text="Super-Scaffold_1"/>
+                <has_text text="4753350"/>
+                <has_n_lines n="3"/>
+            </assert_contents>
+        </output>
+    </test>
+    </tests>
+    <help><![CDATA[
+
+.. class:: infomark
+            
+**Purpose**
+
+BiSCoT is a tool that examinates data generated during a previous Bionano scaffolding and merges contigs separated by a 13-Ns gap if needed. BiSCoT also re-evaluates gap sizes and searches for an 
+alignment between two contigs if the gap size is inferior to 1,000 nucleotides. BiSCoT is therefore not a traditional scaffolder since it can only be used to improve an existing scaffolding, based
+on an optical map.
+
+-----
+
+.. class:: infomark
+            
+**Required files**
+
+During the scaffolding, the Bionano generates a visual representation of the hybrid scaffolds that is called an *anchor*. It also generates one *.key* file, which describes the mapping between map
+identifiers and contig names, several CMAP files, which contain the position of enzymatic labelling sites on contig maps and on the anchor, and a XMAP file, that describes the alignment between a contig map
+and an anchor. BiSCoT first loads the contigs into memory based on the key file. Then, the anchor CMAP file and contig CMAP files are loaded into memory. Finally, the XMAP file is parsed and loaded.
+
+    ]]>    </help>
+    <expand macro="citations"/>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Fri Jan 06 22:10:44 2023 +0000
@@ -0,0 +1,17 @@
+<macros>
+    <token name="@TOOL_VERSION@">2.3.3</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">biscot</requirement>
+            <requirement type="package" version="36">blat</requirement>
+            <requirement type="package" version="377">ucsc-pslsort</requirement>
+            <requirement type="package" version="377">ucsc-pslreps</requirement>
+        </requirements>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.7717/peerj.10150</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bionano_key_file.txt	Fri Jan 06 22:10:44 2023 +0000
@@ -0,0 +1,3 @@
+CompntId	CompntName	CompntLength
+1	Super_scaffold_3	4753350
+4	Super_scaffold_3	4753350
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/query_cmap_file.cmap	Fri Jan 06 22:10:44 2023 +0000
@@ -0,0 +1,545 @@
+# hostname=6d61d934e61b
+# $ cd /HybridScaffold; /RefAligner/amd2/RefAligner -o /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD -stdout -stderr -i /data/jwd03f/main/053/913/53913897/working/assignAlignType/assignAlignType_q.cmap -ref /data/jwd03f/main/053/913/53913897/working/align_final/step2.hybrid.cmap -maxmem 250 -maxthreads 24 -maxvirtmem 250 -RAmem 3 1 -res 2.9 -FP 0.6 -FN 0.06 -sf 0.20 -sd 0.0 -sr 0.01 -extend 1 -outlier 0.0001 -endoutlier 0.001 -PVendoutlier -deltaX 6 -deltaY 6 -xmapchim 12 -hashgen 5 7 2.4 1.5 0.05 5.0 1 1 4 -hash -hashdelta 26 10 46 -hashMultiMatch 30 10 -insertThreads 24 -nosplit 2 -biaswt 0 -T 1e-10 -S -1000 -indel -PVres 2 -rres 0.9 -MaxSE 0.5 -HSDrange 1.0 -outlierBC -xmapUnique 14 -AlignRes 2. -outlierExtend 6 24 -Kmax 6 -resEstimate -BestRef 1 -f -mres 0.9
+# CompileDir= /home/users/sqa01/RefAlignerBuild/branches/12432.12463rel/12432.12463rel CompileCmd=/opt/gcc-9.3.0/bin/g++ -B/opt/binutils-2.34 -fopenmp -Ofast -march=znver2 -mavx2 -mfpmath=sse -DUSE_PFLOAT=1 -DUSE_RFLOAT=1 -DUSE_SSE=1 -DUSE_MFLOAT=1 -DUSE_EPOW=2 -I/home/users8/tanantharaman/sleef-081120/build/include -I/opt/glibc-2.31/include -DUSE_STATIC -freciprocal-math -fno-signed-zeros -fno-trapping-math -fno-tree-vectorize -mtune=znver2 -fno-lto-odr-type-merging -DRELEASE=1 -std=gnu++98  -Wl,--dynamic-linker=/opt/glibc-2.31/lib/ld-linux-x86-64.so.2 -Wl,--rpath=/opt/glibc-2.31/lib -Wl,--rpath=/opt/gcc-9.3.0/lib64 -lsleefinline -lrt -lmvec -L/home/users8/tanantharaman/sleef-081120/build/lib -L/opt/glibc-2.31/lib -L/opt/gcc-9.3.0/lib64 -static -static-libstdc++ -static-libgcc -s SVNversion=12463 $Header: http://svn.bnm.local:81/svn/Informatics/RefAligner/branches/12432/RefAligner.cpp 12458 2021-10-24 00:56:45Z tanantharaman $
+# FLAGS: USE_SSE=1 USE_AVX=1 USE_MIC=0 USE_PFLOAT=1 USE_RFLOAT=1 USE_MFLOAT=1 USE_EPOW=2 DEBUG=1 VERB=1
+# CMAP File Version:	0.1
+# Label Channels:	1
+# Nickase Recognition Site 1:	gctcttc
+# Number of Consensus Maps:	2
+# StdDev & Coverage refer to the interval between current site and next site
+#h CMapId	ContigLength	NumSites	SiteID	LabelChannel	Position	StdDev	Coverage	Occurrence
+#f int	float	int	int	int	float	float	float	float
+1	3879935.1	449	1	1	20.0	112.1	106.0	106.0
+1	3879935.1	449	2	1	1679.6	290.0	108.0	106.0
+1	3879935.1	449	3	1	45612.1	126.1	114.0	92.0
+1	3879935.1	449	4	1	49245.1	205.8	116.0	100.0
+1	3879935.1	449	5	1	68514.5	123.8	120.0	116.0
+1	3879935.1	449	6	1	71807.2	139.9	126.0	118.0
+1	3879935.1	449	7	1	77614.8	168.6	126.0	116.0
+1	3879935.1	449	8	1	88645.4	147.4	126.0	104.0
+1	3879935.1	449	9	1	95715.0	140.5	130.0	110.0
+1	3879935.1	449	10	1	101612.6	182.6	132.0	118.0
+1	3879935.1	449	11	1	115551.9	136.8	134.0	108.0
+1	3879935.1	449	12	1	120842.6	155.7	136.0	128.0
+1	3879935.1	449	13	1	129405.4	134.2	138.0	136.0
+1	3879935.1	449	14	1	134289.6	133.8	138.0	136.0
+1	3879935.1	449	15	1	139102.5	128.1	136.0	120.0
+1	3879935.1	449	16	1	143032.3	216.3	134.0	130.0
+1	3879935.1	449	17	1	164913.0	114.5	134.0	128.0
+1	3879935.1	449	18	1	166898.9	109.4	126.0	72.0
+1	3879935.1	449	19	1	168209.4	138.5	122.0	102.0
+1	3879935.1	449	20	1	173784.8	151.9	124.0	114.0
+1	3879935.1	449	21	1	181653.5	133.6	122.0	114.0
+1	3879935.1	449	22	1	186435.3	175.5	122.0	108.0
+1	3879935.1	449	23	1	198876.3	135.2	114.0	106.0
+1	3879935.1	449	24	1	203905.3	116.1	114.0	108.0
+1	3879935.1	449	25	1	206098.3	233.2	110.0	106.0
+1	3879935.1	449	26	1	232472.3	127.9	102.0	100.0
+1	3879935.1	449	27	1	236376.4	140.3	100.0	88.0
+1	3879935.1	449	28	1	242248.5	141.5	100.0	98.0
+1	3879935.1	449	29	1	248306.8	161.0	96.0	42.0
+1	3879935.1	449	30	1	257864.3	137.2	98.0	84.0
+1	3879935.1	449	31	1	263229.2	147.9	100.0	94.0
+1	3879935.1	449	32	1	270386.6	122.3	100.0	76.0
+1	3879935.1	449	33	1	273454.8	195.0	98.0	90.0
+1	3879935.1	449	34	1	290153.8	167.9	100.0	90.0
+1	3879935.1	449	35	1	301041.4	163.3	100.0	80.0
+1	3879935.1	449	36	1	311025.8	143.1	104.0	90.0
+1	3879935.1	449	37	1	317358.2	124.2	104.0	102.0
+1	3879935.1	449	38	1	320707.2	114.9	100.0	76.0
+1	3879935.1	449	39	1	322737.0	108.6	104.0	92.0
+1	3879935.1	449	40	1	323935.1	125.1	102.0	90.0
+1	3879935.1	449	41	1	327423.0	155.8	100.0	92.0
+1	3879935.1	449	42	1	336006.5	186.9	100.0	86.0
+1	3879935.1	449	43	1	350878.0	146.3	100.0	100.0
+1	3879935.1	449	44	1	357756.6	121.7	98.0	88.0
+1	3879935.1	449	45	1	360740.3	126.0	98.0	66.0
+1	3879935.1	449	46	1	364354.6	125.6	94.0	92.0
+1	3879935.1	449	47	1	367914.1	188.7	96.0	90.0
+1	3879935.1	449	48	1	383183.4	194.7	94.0	76.0
+1	3879935.1	449	49	1	399818.1	158.3	96.0	58.0
+1	3879935.1	449	50	1	408867.3	124.5	106.0	94.0
+1	3879935.1	449	51	1	412266.2	112.6	106.0	78.0
+1	3879935.1	449	52	1	413986.0	219.5	106.0	100.0
+1	3879935.1	449	53	1	436685.1	158.5	108.0	96.0
+1	3879935.1	449	54	1	445762.2	149.2	106.0	74.0
+1	3879935.1	449	55	1	453154.1	187.2	106.0	98.0
+1	3879935.1	449	56	1	468094.9	155.0	102.0	86.0
+1	3879935.1	449	57	1	476524.9	144.0	100.0	90.0
+1	3879935.1	449	58	1	483017.1	192.5	104.0	90.0
+1	3879935.1	449	59	1	499139.8	137.9	100.0	94.0
+1	3879935.1	449	60	1	504612.9	133.4	98.0	96.0
+1	3879935.1	449	61	1	509361.6	135.8	98.0	82.0
+1	3879935.1	449	62	1	514489.5	137.8	106.0	96.0
+1	3879935.1	449	63	1	519951.3	160.6	106.0	88.0
+1	3879935.1	449	64	1	529428.8	209.4	106.0	96.0
+1	3879935.1	449	65	1	549571.1	126.9	100.0	88.0
+1	3879935.1	449	66	1	553317.9	118.7	98.0	94.0
+1	3879935.1	449	67	1	555874.9	139.2	98.0	94.0
+1	3879935.1	449	68	1	561559.0	158.7	98.0	86.0
+1	3879935.1	449	69	1	570670.7	178.2	96.0	84.0
+1	3879935.1	449	70	1	583674.0	123.7	98.0	78.0
+1	3879935.1	449	71	1	586943.9	164.9	100.0	86.0
+1	3879935.1	449	72	1	597237.8	120.0	98.0	80.0
+1	3879935.1	449	73	1	599975.1	113.6	100.0	70.0
+1	3879935.1	449	74	1	601839.9	153.9	104.0	98.0
+1	3879935.1	449	75	1	610073.9	127.1	102.0	98.0
+1	3879935.1	449	76	1	613858.2	124.8	100.0	100.0
+1	3879935.1	449	77	1	617293.2	136.3	96.0	96.0
+1	3879935.1	449	78	1	622503.4	120.1	96.0	94.0
+1	3879935.1	449	79	1	625262.3	127.3	98.0	82.0
+1	3879935.1	449	80	1	629074.4	138.1	96.0	84.0
+1	3879935.1	449	81	1	634575.7	125.7	96.0	88.0
+1	3879935.1	449	82	1	638144.1	116.9	88.0	52.0
+1	3879935.1	449	83	1	640448.4	196.4	88.0	82.0
+1	3879935.1	449	84	1	657466.4	183.2	86.0	76.0
+1	3879935.1	449	85	1	671526.4	251.2	88.0	72.0
+1	3879935.1	449	86	1	703054.8	177.5	96.0	74.0
+1	3879935.1	449	87	1	715905.6	113.8	100.0	84.0
+1	3879935.1	449	88	1	717785.9	113.8	98.0	86.0
+1	3879935.1	449	89	1	719668.5	121.7	98.0	84.0
+1	3879935.1	449	90	1	722650.2	119.5	100.0	96.0
+1	3879935.1	449	91	1	725320.7	112.5	100.0	84.0
+1	3879935.1	449	92	1	727030.6	158.8	100.0	90.0
+1	3879935.1	449	93	1	736175.5	135.4	96.0	82.0
+1	3879935.1	449	94	1	741250.4	132.1	98.0	98.0
+1	3879935.1	449	95	1	745801.7	118.3	102.0	102.0
+1	3879935.1	449	96	1	748312.3	132.5	102.0	102.0
+1	3879935.1	449	97	1	752921.8	202.6	98.0	92.0
+1	3879935.1	449	98	1	771409.1	117.6	94.0	78.0
+1	3879935.1	449	99	1	773816.7	112.9	96.0	92.0
+1	3879935.1	449	100	1	775581.2	171.1	94.0	84.0
+1	3879935.1	449	101	1	787110.0	159.7	94.0	82.0
+1	3879935.1	449	102	1	796413.6	175.6	96.0	86.0
+1	3879935.1	449	103	1	808878.4	113.6	90.0	70.0
+1	3879935.1	449	104	1	810732.0	128.4	94.0	82.0
+1	3879935.1	449	105	1	814714.3	139.2	96.0	92.0
+1	3879935.1	449	106	1	820400.6	145.9	96.0	80.0
+1	3879935.1	449	107	1	827210.0	113.6	96.0	72.0
+1	3879935.1	449	108	1	829065.0	192.3	98.0	88.0
+1	3879935.1	449	109	1	845143.9	158.3	94.0	86.0
+1	3879935.1	449	110	1	854180.3	125.8	96.0	92.0
+1	3879935.1	449	111	1	857760.5	124.8	98.0	96.0
+1	3879935.1	449	112	1	861203.1	186.5	98.0	68.0
+1	3879935.1	449	113	1	875988.1	145.3	94.0	74.0
+1	3879935.1	449	114	1	882704.7	184.4	92.0	84.0
+1	3879935.1	449	115	1	897025.4	228.6	90.0	76.0
+1	3879935.1	449	116	1	922133.6	169.4	94.0	72.0
+1	3879935.1	449	117	1	933328.9	186.2	98.0	84.0
+1	3879935.1	449	118	1	948057.1	152.5	96.0	90.0
+1	3879935.1	449	119	1	956040.9	165.5	98.0	68.0
+1	3879935.1	449	120	1	966468.8	152.5	98.0	88.0
+1	3879935.1	449	121	1	974437.4	124.3	100.0	94.0
+1	3879935.1	449	122	1	977799.9	143.3	100.0	86.0
+1	3879935.1	449	123	1	984174.3	237.3	98.0	90.0
+1	3879935.1	449	124	1	1011693.3	145.4	96.0	84.0
+1	3879935.1	449	125	1	1018427.8	166.9	96.0	84.0
+1	3879935.1	449	126	1	1029114.7	195.5	94.0	84.0
+1	3879935.1	449	127	1	1045925.8	110.8	92.0	76.0
+1	3879935.1	449	128	1	1047410.3	145.8	98.0	96.0
+1	3879935.1	449	129	1	1054200.9	155.9	98.0	92.0
+1	3879935.1	449	130	1	1062800.1	143.2	100.0	94.0
+1	3879935.1	449	131	1	1069160.3	146.1	106.0	104.0
+1	3879935.1	449	132	1	1076002.7	183.5	96.0	86.0
+1	3879935.1	449	133	1	1090129.4	236.2	92.0	82.0
+1	3879935.1	449	134	1	1117329.2	193.4	96.0	84.0
+1	3879935.1	449	135	1	1133672.7	176.1	102.0	88.0
+1	3879935.1	449	136	1	1146235.6	147.8	98.0	82.0
+1	3879935.1	449	137	1	1153372.0	147.1	100.0	86.0
+1	3879935.1	449	138	1	1160391.5	138.3	100.0	96.0
+1	3879935.1	449	139	1	1165936.0	125.2	102.0	88.0
+1	3879935.1	449	140	1	1169427.5	115.8	98.0	92.0
+1	3879935.1	449	141	1	1171582.5	109.2	98.0	54.0
+1	3879935.1	449	142	1	1172867.8	161.2	98.0	64.0
+1	3879935.1	449	143	1	1182460.8	118.6	100.0	62.0
+1	3879935.1	449	144	1	1185006.6	227.2	100.0	96.0
+1	3879935.1	449	145	1	1209739.7	133.2	98.0	98.0
+1	3879935.1	449	146	1	1214459.4	119.9	102.0	102.0
+1	3879935.1	449	147	1	1217191.9	118.8	104.0	80.0
+1	3879935.1	449	148	1	1219769.6	177.1	104.0	80.0
+1	3879935.1	449	149	1	1232540.7	137.0	108.0	92.0
+1	3879935.1	449	150	1	1237867.1	120.9	108.0	108.0
+1	3879935.1	449	151	1	1240733.4	122.5	110.0	100.0
+1	3879935.1	449	152	1	1243831.8	210.2	112.0	106.0
+1	3879935.1	449	153	1	1264172.5	132.6	108.0	102.0
+1	3879935.1	449	154	1	1268792.4	148.3	104.0	98.0
+1	3879935.1	449	155	1	1276019.4	121.3	104.0	104.0
+1	3879935.1	449	156	1	1278946.0	184.4	106.0	100.0
+1	3879935.1	449	157	1	1293266.5	149.2	106.0	86.0
+1	3879935.1	449	158	1	1300659.6	121.6	104.0	92.0
+1	3879935.1	449	159	1	1303631.2	207.0	104.0	98.0
+1	3879935.1	449	160	1	1323182.7	191.8	98.0	92.0
+1	3879935.1	449	161	1	1339154.6	150.0	108.0	90.0
+1	3879935.1	449	162	1	1346677.8	141.3	112.0	108.0
+1	3879935.1	449	163	1	1352713.8	199.5	112.0	102.0
+1	3879935.1	449	164	1	1370470.1	119.6	112.0	106.0
+1	3879935.1	449	165	1	1373161.0	134.6	112.0	110.0
+1	3879935.1	449	166	1	1378095.5	198.5	108.0	102.0
+1	3879935.1	449	167	1	1395612.0	134.0	100.0	90.0
+1	3879935.1	449	168	1	1400455.3	152.3	100.0	86.0
+1	3879935.1	449	169	1	1408397.6	130.5	104.0	88.0
+1	3879935.1	449	170	1	1412699.9	187.1	106.0	98.0
+1	3879935.1	449	171	1	1427627.4	160.7	102.0	82.0
+1	3879935.1	449	172	1	1437118.2	187.6	104.0	92.0
+1	3879935.1	449	173	1	1452140.3	136.5	106.0	96.0
+1	3879935.1	449	174	1	1457387.1	164.8	102.0	84.0
+1	3879935.1	449	175	1	1467668.9	159.1	98.0	56.0
+1	3879935.1	449	176	1	1476864.2	111.0	98.0	84.0
+1	3879935.1	449	177	1	1478375.0	111.4	100.0	88.0
+1	3879935.1	449	178	1	1479936.2	132.4	100.0	62.0
+1	3879935.1	449	179	1	1484524.1	126.6	102.0	100.0
+1	3879935.1	449	180	1	1488221.8	266.0	102.0	94.0
+1	3879935.1	449	181	1	1524260.6	166.0	98.0	72.0
+1	3879935.1	449	182	1	1534783.9	199.9	94.0	90.0
+1	3879935.1	449	183	1	1552635.8	175.6	100.0	80.0
+1	3879935.1	449	184	1	1565084.2	117.7	108.0	104.0
+1	3879935.1	449	185	1	1567504.1	125.0	108.0	104.0
+1	3879935.1	449	186	1	1570964.8	131.3	112.0	112.0
+1	3879935.1	449	187	1	1575391.5	115.3	112.0	102.0
+1	3879935.1	449	188	1	1577482.7	154.5	112.0	102.0
+1	3879935.1	449	189	1	1585821.5	117.0	114.0	104.0
+1	3879935.1	449	190	1	1588145.8	219.8	114.0	106.0
+1	3879935.1	449	191	1	1610935.0	148.3	106.0	98.0
+1	3879935.1	449	192	1	1618169.1	197.5	108.0	104.0
+1	3879935.1	449	193	1	1635447.0	202.6	110.0	106.0
+1	3879935.1	449	194	1	1653941.6	122.6	108.0	100.0
+1	3879935.1	449	195	1	1657061.7	132.4	114.0	114.0
+1	3879935.1	449	196	1	1661653.1	115.6	116.0	106.0
+1	3879935.1	449	197	1	1663789.9	189.1	116.0	112.0
+1	3879935.1	449	198	1	1679151.9	122.5	118.0	114.0
+1	3879935.1	449	199	1	1682248.8	139.8	116.0	108.0
+1	3879935.1	449	200	1	1688031.2	120.5	112.0	112.0
+1	3879935.1	449	201	1	1690838.8	146.8	110.0	110.0
+1	3879935.1	449	202	1	1697808.6	136.7	110.0	104.0
+1	3879935.1	449	203	1	1703082.9	143.4	110.0	108.0
+1	3879935.1	449	204	1	1709475.1	207.6	104.0	96.0
+1	3879935.1	449	205	1	1729166.5	217.0	96.0	84.0
+1	3879935.1	449	206	1	1751232.4	252.6	92.0	86.0
+1	3879935.1	449	207	1	1783161.2	217.8	90.0	80.0
+1	3879935.1	449	208	1	1805426.2	243.9	92.0	80.0
+1	3879935.1	449	209	1	1834804.4	153.2	92.0	86.0
+1	3879935.1	449	210	1	1842900.5	140.6	96.0	86.0
+1	3879935.1	449	211	1	1848813.1	107.3	96.0	74.0
+1	3879935.1	449	212	1	1849844.6	165.7	98.0	76.0
+1	3879935.1	449	213	1	1860298.3	159.8	94.0	72.0
+1	3879935.1	449	214	1	1869625.7	142.2	102.0	96.0
+1	3879935.1	449	215	1	1875806.4	141.1	104.0	102.0
+1	3879935.1	449	216	1	1881813.8	130.9	102.0	100.0
+1	3879935.1	449	217	1	1886174.9	157.3	100.0	72.0
+1	3879935.1	449	218	1	1895038.9	128.2	102.0	84.0
+1	3879935.1	449	219	1	1898991.3	121.6	102.0	86.0
+1	3879935.1	449	220	1	1901956.6	120.1	102.0	102.0
+1	3879935.1	449	221	1	1904710.5	134.8	100.0	94.0
+1	3879935.1	449	222	1	1909677.3	134.9	100.0	96.0
+1	3879935.1	449	223	1	1914672.1	154.3	102.0	88.0
+1	3879935.1	449	224	1	1922984.0	152.9	104.0	94.0
+1	3879935.1	449	225	1	1931038.3	139.7	104.0	96.0
+1	3879935.1	449	226	1	1936811.8	146.8	102.0	92.0
+1	3879935.1	449	227	1	1943781.6	150.0	102.0	94.0
+1	3879935.1	449	228	1	1951316.2	111.8	104.0	96.0
+1	3879935.1	449	229	1	1952936.5	153.3	100.0	96.0
+1	3879935.1	449	230	1	1961062.6	154.9	104.0	96.0
+1	3879935.1	449	231	1	1969483.7	126.2	104.0	102.0
+1	3879935.1	449	232	1	1973130.1	120.2	104.0	104.0
+1	3879935.1	449	233	1	1975905.8	138.1	102.0	98.0
+1	3879935.1	449	234	1	1981406.8	257.8	102.0	96.0
+1	3879935.1	449	235	1	2014909.9	169.1	106.0	92.0
+1	3879935.1	449	236	1	2026049.9	154.4	110.0	80.0
+1	3879935.1	449	237	1	2034375.7	181.1	112.0	104.0
+1	3879935.1	449	238	1	2047982.8	140.9	110.0	92.0
+1	3879935.1	449	239	1	2053944.0	115.9	108.0	98.0
+1	3879935.1	449	240	1	2056118.2	117.5	108.0	106.0
+1	3879935.1	449	241	1	2058516.6	189.5	106.0	88.0
+1	3879935.1	449	242	1	2073960.7	150.9	104.0	100.0
+1	3879935.1	449	243	1	2081659.1	188.1	106.0	88.0
+1	3879935.1	449	244	1	2096802.1	118.5	104.0	68.0
+1	3879935.1	449	245	1	2099332.4	182.2	104.0	102.0
+1	3879935.1	449	246	1	2113174.7	154.8	100.0	86.0
+1	3879935.1	449	247	1	2121562.2	119.8	100.0	94.0
+1	3879935.1	449	248	1	2124279.1	149.0	104.0	84.0
+1	3879935.1	449	249	1	2131625.1	107.3	98.0	76.0
+1	3879935.1	449	250	1	2132658.8	180.1	98.0	74.0
+1	3879935.1	449	251	1	2146057.6	113.5	98.0	84.0
+1	3879935.1	449	252	1	2147908.2	140.6	108.0	104.0
+1	3879935.1	449	253	1	2153825.7	126.3	104.0	100.0
+1	3879935.1	449	254	1	2157486.7	156.4	106.0	96.0
+1	3879935.1	449	255	1	2166174.3	138.8	104.0	104.0
+1	3879935.1	449	256	1	2171796.8	135.5	102.0	98.0
+1	3879935.1	449	257	1	2176883.1	152.3	100.0	94.0
+1	3879935.1	449	258	1	2184819.7	165.6	100.0	92.0
+1	3879935.1	449	259	1	2195268.3	161.4	100.0	84.0
+1	3879935.1	449	260	1	2204894.8	158.1	100.0	92.0
+1	3879935.1	449	261	1	2213905.0	143.0	102.0	98.0
+1	3879935.1	449	262	1	2220216.9	184.7	102.0	94.0
+1	3879935.1	449	263	1	2234620.2	150.0	102.0	92.0
+1	3879935.1	449	264	1	2242155.0	198.5	106.0	94.0
+1	3879935.1	449	265	1	2259682.1	145.3	110.0	102.0
+1	3879935.1	449	266	1	2266392.4	118.7	112.0	102.0
+1	3879935.1	449	267	1	2268953.1	177.6	108.0	90.0
+1	3879935.1	449	268	1	2281832.6	121.6	110.0	96.0
+1	3879935.1	449	269	1	2284801.6	132.3	112.0	110.0
+1	3879935.1	449	270	1	2289383.9	197.0	114.0	112.0
+1	3879935.1	449	271	1	2306550.6	174.3	112.0	94.0
+1	3879935.1	449	272	1	2318746.4	152.4	112.0	74.0
+1	3879935.1	449	273	1	2326712.6	112.3	112.0	102.0
+1	3879935.1	449	274	1	2328397.2	195.3	114.0	98.0
+1	3879935.1	449	275	1	2345167.6	152.7	112.0	100.0
+1	3879935.1	449	276	1	2353177.6	154.6	110.0	84.0
+1	3879935.1	449	277	1	2361537.9	111.9	108.0	100.0
+1	3879935.1	449	278	1	2363176.7	131.6	110.0	104.0
+1	3879935.1	449	279	1	2367647.0	107.2	108.0	84.0
+1	3879935.1	449	280	1	2368677.9	122.4	108.0	82.0
+1	3879935.1	449	281	1	2371762.9	162.0	104.0	98.0
+1	3879935.1	449	282	1	2381508.2	127.4	98.0	76.0
+1	3879935.1	449	283	1	2385330.6	118.3	102.0	100.0
+1	3879935.1	449	284	1	2387828.9	122.5	102.0	96.0
+1	3879935.1	449	285	1	2390929.1	140.5	102.0	90.0
+1	3879935.1	449	286	1	2396830.8	162.9	102.0	100.0
+1	3879935.1	449	287	1	2406743.8	182.3	96.0	78.0
+1	3879935.1	449	288	1	2420624.4	112.2	92.0	84.0
+1	3879935.1	449	289	1	2422292.8	257.7	90.0	84.0
+1	3879935.1	449	290	1	2455764.6	177.0	90.0	68.0
+1	3879935.1	449	291	1	2468504.8	168.6	96.0	76.0
+1	3879935.1	449	292	1	2479528.1	120.7	102.0	94.0
+1	3879935.1	449	293	1	2482369.5	280.5	100.0	96.0
+1	3879935.1	449	294	1	2523114.4	143.2	98.0	86.0
+1	3879935.1	449	295	1	2529473.1	198.7	100.0	98.0
+1	3879935.1	449	296	1	2547038.9	108.5	102.0	66.0
+1	3879935.1	449	297	1	2548224.3	134.6	106.0	96.0
+1	3879935.1	449	298	1	2553166.6	184.2	108.0	108.0
+1	3879935.1	449	299	1	2567454.3	148.5	106.0	104.0
+1	3879935.1	449	300	1	2574724.2	250.2	96.0	84.0
+1	3879935.1	449	301	1	2605964.5	236.2	96.0	84.0
+1	3879935.1	449	302	1	2633170.3	124.0	94.0	92.0
+1	3879935.1	449	303	1	2636488.3	117.5	94.0	88.0
+1	3879935.1	449	304	1	2638885.8	113.0	94.0	60.0
+1	3879935.1	449	305	1	2640666.9	152.2	94.0	82.0
+1	3879935.1	449	306	1	2648588.5	129.6	96.0	96.0
+1	3879935.1	449	307	1	2652750.5	180.1	92.0	86.0
+1	3879935.1	449	308	1	2666149.1	141.8	104.0	104.0
+1	3879935.1	449	309	1	2672267.4	110.9	100.0	86.0
+1	3879935.1	449	310	1	2673773.5	115.0	102.0	92.0
+1	3879935.1	449	311	1	2675828.6	195.3	104.0	100.0
+1	3879935.1	449	312	1	2692596.6	134.3	100.0	88.0
+1	3879935.1	449	313	1	2697488.1	126.7	98.0	92.0
+1	3879935.1	449	314	1	2701204.5	125.7	98.0	86.0
+1	3879935.1	449	315	1	2704777.8	146.1	96.0	92.0
+1	3879935.1	449	316	1	2711632.9	148.4	94.0	90.0
+1	3879935.1	449	317	1	2718887.0	114.5	92.0	70.0
+1	3879935.1	449	318	1	2720874.0	169.1	92.0	62.0
+1	3879935.1	449	319	1	2731996.4	116.7	86.0	68.0
+1	3879935.1	449	320	1	2734283.9	137.3	86.0	64.0
+1	3879935.1	449	321	1	2739657.9	112.7	90.0	84.0
+1	3879935.1	449	322	1	2741401.5	223.4	92.0	82.0
+1	3879935.1	449	323	1	2765134.8	110.1	84.0	76.0
+1	3879935.1	449	324	1	2766535.5	119.0	86.0	82.0
+1	3879935.1	449	325	1	2769134.4	167.4	88.0	56.0
+1	3879935.1	449	326	1	2779918.7	114.8	94.0	78.0
+1	3879935.1	449	327	1	2781934.7	219.2	92.0	66.0
+1	3879935.1	449	328	1	2804553.5	130.3	96.0	92.0
+1	3879935.1	449	329	1	2808825.9	125.2	96.0	80.0
+1	3879935.1	449	330	1	2812317.0	156.2	96.0	86.0
+1	3879935.1	449	331	1	2820968.5	113.5	96.0	92.0
+1	3879935.1	449	332	1	2822810.4	122.6	96.0	56.0
+1	3879935.1	449	333	1	2825924.7	271.8	96.0	92.0
+1	3879935.1	449	334	1	2863805.6	109.8	100.0	96.0
+1	3879935.1	449	335	1	2865163.2	192.5	110.0	94.0
+1	3879935.1	449	336	1	2881291.9	122.0	100.0	88.0
+1	3879935.1	449	337	1	2884324.5	150.0	100.0	96.0
+1	3879935.1	449	338	1	2891856.4	111.4	102.0	98.0
+1	3879935.1	449	339	1	2893423.5	143.8	98.0	94.0
+1	3879935.1	449	340	1	2899869.4	144.1	96.0	94.0
+1	3879935.1	449	341	1	2906379.6	117.1	94.0	88.0
+1	3879935.1	449	342	1	2908718.4	122.4	96.0	80.0
+1	3879935.1	449	343	1	2911806.2	172.8	96.0	68.0
+1	3879935.1	449	344	1	2923684.8	130.8	94.0	76.0
+1	3879935.1	449	345	1	2928030.8	239.1	98.0	90.0
+1	3879935.1	449	346	1	2956055.5	148.8	104.0	98.0
+1	3879935.1	449	347	1	2963382.4	131.8	104.0	102.0
+1	3879935.1	449	348	1	2967886.6	178.8	104.0	100.0
+1	3879935.1	449	349	1	2981013.9	112.5	104.0	54.0
+1	3879935.1	449	350	1	2982723.1	226.2	104.0	100.0
+1	3879935.1	449	351	1	3007195.7	207.5	104.0	92.0
+1	3879935.1	449	352	1	3026882.0	125.9	104.0	98.0
+1	3879935.1	449	353	1	3030483.0	126.0	104.0	90.0
+1	3879935.1	449	354	1	3034102.1	146.3	102.0	94.0
+1	3879935.1	449	355	1	3040989.4	153.5	98.0	72.0
+1	3879935.1	449	356	1	3049155.8	108.1	100.0	72.0
+1	3879935.1	449	357	1	3050296.4	126.4	104.0	96.0
+1	3879935.1	449	358	1	3053965.5	127.0	106.0	96.0
+1	3879935.1	449	359	1	3057730.6	173.5	106.0	98.0
+1	3879935.1	449	360	1	3069743.5	120.3	108.0	74.0
+1	3879935.1	449	361	1	3072530.0	180.0	108.0	100.0
+1	3879935.1	449	362	1	3085919.8	135.8	106.0	78.0
+1	3879935.1	449	363	1	3091044.9	200.3	108.0	102.0
+1	3879935.1	449	364	1	3108983.1	127.3	110.0	108.0
+1	3879935.1	449	365	1	3112791.2	122.2	110.0	110.0
+1	3879935.1	449	366	1	3115847.2	137.0	106.0	102.0
+1	3879935.1	449	367	1	3121172.8	176.7	106.0	86.0
+1	3879935.1	449	368	1	3133865.8	149.3	104.0	88.0
+1	3879935.1	449	369	1	3141273.4	146.5	98.0	92.0
+1	3879935.1	449	370	1	3148185.0	126.2	94.0	86.0
+1	3879935.1	449	371	1	3151833.8	158.1	98.0	84.0
+1	3879935.1	449	372	1	3160837.9	158.1	104.0	86.0
+1	3879935.1	449	373	1	3169848.7	147.8	102.0	74.0
+1	3879935.1	449	374	1	3176991.9	118.0	100.0	92.0
+1	3879935.1	449	375	1	3179454.4	166.8	100.0	74.0
+1	3879935.1	449	376	1	3190125.8	232.8	98.0	78.0
+1	3879935.1	449	377	1	3216382.8	114.6	98.0	88.0
+1	3879935.1	449	378	1	3218381.4	165.6	102.0	86.0
+1	3879935.1	449	379	1	3228823.5	124.1	102.0	84.0
+1	3879935.1	449	380	1	3232164.9	160.6	100.0	78.0
+1	3879935.1	449	381	1	3241646.8	129.7	92.0	84.0
+1	3879935.1	449	382	1	3245818.3	109.7	92.0	78.0
+1	3879935.1	449	383	1	3247158.0	162.9	90.0	62.0
+1	3879935.1	449	384	1	3257081.2	114.2	96.0	78.0
+1	3879935.1	449	385	1	3259024.8	152.8	96.0	90.0
+1	3879935.1	449	386	1	3267051.2	180.2	98.0	88.0
+1	3879935.1	449	387	1	3280475.8	144.7	98.0	90.0
+1	3879935.1	449	388	1	3287079.9	164.1	96.0	92.0
+1	3879935.1	449	389	1	3297221.3	189.9	96.0	82.0
+1	3879935.1	449	390	1	3312770.8	148.7	102.0	98.0
+1	3879935.1	449	391	1	3320073.7	135.3	102.0	94.0
+1	3879935.1	449	392	1	3325131.9	122.2	102.0	100.0
+1	3879935.1	449	393	1	3328188.5	182.0	102.0	84.0
+1	3879935.1	449	394	1	3341998.9	122.1	102.0	98.0
+1	3879935.1	449	395	1	3345041.5	120.8	104.0	98.0
+1	3879935.1	449	396	1	3347892.0	154.6	104.0	92.0
+1	3879935.1	449	397	1	3356248.2	156.1	98.0	76.0
+1	3879935.1	449	398	1	3364885.2	113.8	100.0	70.0
+1	3879935.1	449	399	1	3366771.3	231.8	102.0	90.0
+1	3879935.1	449	400	1	3392767.6	228.2	96.0	72.0
+1	3879935.1	449	401	1	3417769.3	269.4	96.0	86.0
+1	3879935.1	449	402	1	3454889.2	123.9	100.0	86.0
+1	3879935.1	449	403	1	3458195.0	248.3	100.0	92.0
+1	3879935.1	449	404	1	3488859.8	166.5	96.0	76.0
+1	3879935.1	449	405	1	3499477.6	131.6	94.0	64.0
+1	3879935.1	449	406	1	3503940.7	121.6	96.0	94.0
+1	3879935.1	449	407	1	3506912.7	239.2	94.0	82.0
+1	3879935.1	449	408	1	3534964.1	129.4	102.0	100.0
+1	3879935.1	449	409	1	3539096.1	133.7	104.0	100.0
+1	3879935.1	449	410	1	3543893.3	142.1	102.0	100.0
+1	3879935.1	449	411	1	3550063.7	140.0	102.0	102.0
+1	3879935.1	449	412	1	3555878.3	153.5	100.0	94.0
+1	3879935.1	449	413	1	3564043.5	126.4	100.0	100.0
+1	3879935.1	449	414	1	3567713.9	145.9	102.0	90.0
+1	3879935.1	449	415	1	3574523.3	134.4	100.0	90.0
+1	3879935.1	449	416	1	3579439.1	147.8	100.0	100.0
+1	3879935.1	449	417	1	3586588.1	205.7	102.0	98.0
+1	3879935.1	449	418	1	3605819.6	127.5	102.0	94.0
+1	3879935.1	449	419	1	3609663.1	119.5	98.0	94.0
+1	3879935.1	449	420	1	3612330.9	182.5	102.0	96.0
+1	3879935.1	449	421	1	3626256.9	184.0	100.0	94.0
+1	3879935.1	449	422	1	3640495.5	163.1	98.0	90.0
+1	3879935.1	449	423	1	3650450.5	231.5	98.0	72.0
+1	3879935.1	449	424	1	3676345.5	118.4	102.0	98.0
+1	3879935.1	449	425	1	3678862.2	152.4	104.0	100.0
+1	3879935.1	449	426	1	3686814.4	182.6	104.0	96.0
+1	3879935.1	449	427	1	3700754.7	173.6	110.0	76.0
+1	3879935.1	449	428	1	3712795.2	240.9	112.0	66.0
+1	3879935.1	449	429	1	3741315.1	212.1	112.0	106.0
+1	3879935.1	449	430	1	3762130.7	130.4	114.0	110.0
+1	3879935.1	449	431	1	3766416.6	150.3	114.0	106.0
+1	3879935.1	449	432	1	3774008.3	117.7	114.0	108.0
+1	3879935.1	449	433	1	3776432.9	157.2	114.0	108.0
+1	3879935.1	449	434	1	3785270.1	125.0	114.0	112.0
+1	3879935.1	449	435	1	3788741.2	120.6	114.0	112.0
+1	3879935.1	449	436	1	3791576.1	191.9	112.0	104.0
+1	3879935.1	449	437	1	3807566.1	118.7	110.0	98.0
+1	3879935.1	449	438	1	3810121.5	120.0	104.0	104.0
+1	3879935.1	449	439	1	3812864.3	124.1	104.0	74.0
+1	3879935.1	449	440	1	3816193.8	196.5	102.0	100.0
+1	3879935.1	449	441	1	3833238.6	114.8	100.0	98.0
+1	3879935.1	449	442	1	3835254.9	128.3	96.0	94.0
+1	3879935.1	449	443	1	3839216.0	157.0	94.0	92.0
+1	3879935.1	449	444	1	3848008.2	125.5	74.0	74.0
+1	3879935.1	449	445	1	3851556.2	125.2	72.0	72.0
+1	3879935.1	449	446	1	3855049.5	162.6	62.0	50.0
+1	3879935.1	449	447	1	3864915.8	178.8	62.0	44.0
+1	3879935.1	449	448	1	3878051.7	113.6	58.0	52.0
+1	3879935.1	449	449	1	3879911.1	0.0	50.0	50.0
+1	3879935.1	449	450	0	3879935.1	0.0	0.0	0.0
+4	715091.0	83	1	1	20.0	198.3	78.0	78.0
+4	715091.0	83	2	1	17502.1	202.6	92.0	88.0
+4	715091.0	83	3	1	35986.3	116.3	94.0	74.0
+4	715091.0	83	4	1	38211.6	264.3	96.0	90.0
+4	715091.0	83	5	1	73713.3	128.4	102.0	88.0
+4	715091.0	83	6	1	77683.6	152.9	102.0	88.0
+4	715091.0	83	7	1	85740.1	125.1	102.0	94.0
+4	715091.0	83	8	1	89217.8	149.3	106.0	98.0
+4	715091.0	83	9	1	96619.7	171.3	108.0	80.0
+4	715091.0	83	10	1	108194.6	190.1	112.0	92.0
+4	715091.0	83	11	1	123784.8	166.4	116.0	102.0
+4	715091.0	83	12	1	134383.7	150.6	118.0	94.0
+4	715091.0	83	13	1	142022.1	232.2	114.0	110.0
+4	715091.0	83	14	1	168118.5	125.0	112.0	110.0
+4	715091.0	83	15	1	171583.7	150.1	106.0	104.0
+4	715091.0	83	16	1	179127.4	200.8	104.0	96.0
+4	715091.0	83	17	1	197184.6	123.5	96.0	96.0
+4	715091.0	83	18	1	200433.3	242.1	94.0	86.0
+4	715091.0	83	19	1	229300.9	172.7	80.0	64.0
+4	715091.0	83	20	1	241168.2	215.0	80.0	40.0
+4	715091.0	83	21	1	262713.1	236.7	86.0	68.0
+4	715091.0	83	22	1	290046.7	155.9	82.0	78.0
+4	715091.0	83	23	1	298634.5	107.0	84.0	48.0
+4	715091.0	83	24	1	299637.7	129.2	86.0	78.0
+4	715091.0	83	25	1	303739.2	132.2	80.0	76.0
+4	715091.0	83	26	1	308300.7	128.9	86.0	66.0
+4	715091.0	83	27	1	312359.2	211.5	88.0	84.0
+4	715091.0	83	28	1	333018.4	114.7	94.0	80.0
+4	715091.0	83	29	1	335029.9	109.4	94.0	84.0
+4	715091.0	83	30	1	336330.1	145.5	98.0	80.0
+4	715091.0	83	31	1	343074.6	121.8	100.0	94.0
+4	715091.0	83	32	1	346078.6	192.6	100.0	96.0
+4	715091.0	83	33	1	362235.1	162.5	98.0	84.0
+4	715091.0	83	34	1	372068.1	131.4	98.0	98.0
+4	715091.0	83	35	1	376510.8	127.5	100.0	98.0
+4	715091.0	83	36	1	380352.2	131.3	98.0	86.0
+4	715091.0	83	37	1	384775.5	130.7	96.0	88.0
+4	715091.0	83	38	1	389097.1	124.6	94.0	90.0
+4	715091.0	83	39	1	392499.7	145.1	94.0	88.0
+4	715091.0	83	40	1	399172.6	119.0	96.0	70.0
+4	715091.0	83	41	1	401771.6	127.7	98.0	94.0
+4	715091.0	83	42	1	405645.9	168.2	98.0	74.0
+4	715091.0	83	43	1	416597.0	210.9	96.0	86.0
+4	715091.0	83	44	1	437110.7	167.9	96.0	84.0
+4	715091.0	83	45	1	448013.1	197.9	98.0	70.0
+4	715091.0	83	46	1	465393.9	217.2	104.0	82.0
+4	715091.0	83	47	1	487501.6	115.6	118.0	108.0
+4	715091.0	83	48	1	489634.0	165.6	118.0	74.0
+4	715091.0	83	49	1	500080.4	162.4	122.0	92.0
+4	715091.0	83	50	1	509904.5	144.3	126.0	110.0
+4	715091.0	83	51	1	516435.1	110.3	126.0	72.0
+4	715091.0	83	52	1	517853.2	144.0	126.0	120.0
+4	715091.0	83	53	1	524345.8	137.7	130.0	122.0
+4	715091.0	83	54	1	529788.8	132.4	134.0	128.0
+4	715091.0	83	55	1	534388.1	146.4	134.0	124.0
+4	715091.0	83	56	1	541285.4	133.3	134.0	126.0
+4	715091.0	83	57	1	546021.7	106.9	136.0	116.0
+4	715091.0	83	58	1	547013.1	176.2	136.0	88.0
+4	715091.0	83	59	1	559588.7	158.0	146.0	126.0
+4	715091.0	83	60	1	568566.0	117.5	148.0	126.0
+4	715091.0	83	61	1	570959.0	108.1	148.0	112.0
+4	715091.0	83	62	1	572095.5	118.1	150.0	112.0
+4	715091.0	83	63	1	574565.4	135.8	148.0	144.0
+4	715091.0	83	64	1	579691.4	225.6	148.0	142.0
+4	715091.0	83	65	1	603997.3	131.9	144.3	142.3
+4	715091.0	83	66	1	608509.3	114.4	140.3	130.3
+4	715091.0	83	67	1	610471.0	150.2	140.3	136.3
+4	715091.0	83	68	1	618042.7	122.8	136.3	128.3
+4	715091.0	83	69	1	621181.0	132.7	136.3	134.3
+4	715091.0	83	70	1	625817.0	121.1	138.3	102.0
+4	715091.0	83	71	1	628717.9	123.4	138.3	138.3
+4	715091.0	83	72	1	631956.9	133.7	136.3	134.3
+4	715091.0	83	73	1	636748.2	178.6	136.3	130.3
+4	715091.0	83	74	1	649842.3	132.1	126.3	116.0
+4	715091.0	83	75	1	654390.7	170.4	124.3	114.3
+4	715091.0	83	76	1	665785.2	184.0	120.3	84.3
+4	715091.0	83	77	1	680036.2	129.4	116.3	110.3
+4	715091.0	83	78	1	684166.7	131.3	116.3	112.3
+4	715091.0	83	79	1	688595.4	151.3	116.3	110.3
+4	715091.0	83	80	1	696365.3	152.2	110.3	106.3
+4	715091.0	83	81	1	704279.9	132.8	104.3	104.3
+4	715091.0	83	82	1	708941.2	141.9	98.3	98.3
+4	715091.0	83	83	1	715071.0	0.0	72.0	72.0
+4	715091.0	83	84	0	715091.0	0.0	0.0	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/reference_cmap_file.cmap	Fri Jan 06 22:10:44 2023 +0000
@@ -0,0 +1,636 @@
+# hostname=6d61d934e61b
+# $ cd /HybridScaffold; /RefAligner/amd2/RefAligner -o /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD -stdout -stderr -i /data/jwd03f/main/053/913/53913897/working/assignAlignType/assignAlignType_q.cmap -ref /data/jwd03f/main/053/913/53913897/working/align_final/step2.hybrid.cmap -maxmem 250 -maxthreads 24 -maxvirtmem 250 -RAmem 3 1 -res 2.9 -FP 0.6 -FN 0.06 -sf 0.20 -sd 0.0 -sr 0.01 -extend 1 -outlier 0.0001 -endoutlier 0.001 -PVendoutlier -deltaX 6 -deltaY 6 -xmapchim 12 -hashgen 5 7 2.4 1.5 0.05 5.0 1 1 4 -hash -hashdelta 26 10 46 -hashMultiMatch 30 10 -insertThreads 24 -nosplit 2 -biaswt 0 -T 1e-10 -S -1000 -indel -PVres 2 -rres 0.9 -MaxSE 0.5 -HSDrange 1.0 -outlierBC -xmapUnique 14 -AlignRes 2. -outlierExtend 6 24 -Kmax 6 -resEstimate -BestRef 1 -f -mres 0.9
+# CompileDir= /home/users/sqa01/RefAlignerBuild/branches/12432.12463rel/12432.12463rel CompileCmd=/opt/gcc-9.3.0/bin/g++ -B/opt/binutils-2.34 -fopenmp -Ofast -march=znver2 -mavx2 -mfpmath=sse -DUSE_PFLOAT=1 -DUSE_RFLOAT=1 -DUSE_SSE=1 -DUSE_MFLOAT=1 -DUSE_EPOW=2 -I/home/users8/tanantharaman/sleef-081120/build/include -I/opt/glibc-2.31/include -DUSE_STATIC -freciprocal-math -fno-signed-zeros -fno-trapping-math -fno-tree-vectorize -mtune=znver2 -fno-lto-odr-type-merging -DRELEASE=1 -std=gnu++98  -Wl,--dynamic-linker=/opt/glibc-2.31/lib/ld-linux-x86-64.so.2 -Wl,--rpath=/opt/glibc-2.31/lib -Wl,--rpath=/opt/gcc-9.3.0/lib64 -lsleefinline -lrt -lmvec -L/home/users8/tanantharaman/sleef-081120/build/lib -L/opt/glibc-2.31/lib -L/opt/gcc-9.3.0/lib64 -static -static-libstdc++ -static-libgcc -s SVNversion=12463 $Header: http://svn.bnm.local:81/svn/Informatics/RefAligner/branches/12432/RefAligner.cpp 12458 2021-10-24 00:56:45Z tanantharaman $
+# FLAGS: USE_SSE=1 USE_AVX=1 USE_MIC=0 USE_PFLOAT=1 USE_RFLOAT=1 USE_MFLOAT=1 USE_EPOW=2 DEBUG=1 VERB=1
+# CMAP File Version:	0.1
+# Label Channels:	1
+# Nickase Recognition Site 1:	gctcttc
+# Number of Consensus Maps:	1
+# StdDev refers to the interval between the current site and the next site
+#h CMapId	ContigLength	NumSites	SiteID	LabelChannel	Position	StdDev	Coverage	Occurrence	Mask
+#f int	float	int	int	int	float	float	float	float	Hex
+1	4753350.0	624	1	1	4239.0	0.0	0.0	0.0	10
+1	4753350.0	624	2	1	17279.0	0.0	0.0	0.0	0
+1	4753350.0	624	3	1	19489.5	0.0	1.0	1.0	0
+1	4753350.0	624	4	1	37090.0	0.0	1.0	1.0	0
+1	4753350.0	624	5	1	55531.0	0.0	1.0	1.0	0
+1	4753350.0	624	6	1	58111.0	0.0	1.0	1.0	0
+1	4753350.0	624	7	1	93858.0	0.0	1.0	1.0	0
+1	4753350.0	624	8	1	97892.0	0.0	1.0	1.0	0
+1	4753350.0	624	9	1	105928.0	0.0	1.0	1.0	0
+1	4753350.0	624	10	1	108648.0	0.0	1.0	1.0	0
+1	4753350.0	624	11	1	109729.0	0.0	1.0	1.0	0
+1	4753350.0	624	12	1	116817.0	0.0	1.0	1.0	0
+1	4753350.0	624	13	1	128506.0	0.0	1.0	1.0	0
+1	4753350.0	624	14	1	144099.0	0.0	1.0	1.0	0
+1	4753350.0	624	15	1	154799.0	0.0	1.0	1.0	0
+1	4753350.0	624	16	1	162505.0	0.0	1.0	1.0	0
+1	4753350.0	624	17	1	188701.0	0.0	1.0	1.0	0
+1	4753350.0	624	18	1	192239.0	0.0	1.0	1.0	0
+1	4753350.0	624	19	1	199811.0	0.0	1.0	1.0	0
+1	4753350.0	624	20	1	217835.0	0.0	1.0	1.0	0
+1	4753350.0	624	21	1	221220.0	0.0	1.0	1.0	0
+1	4753350.0	624	22	1	250186.0	0.0	1.0	1.0	0
+1	4753350.0	624	23	1	262123.0	0.0	1.0	0.0	0
+1	4753350.0	624	24	1	266376.0	0.0	1.0	1.0	0
+1	4753350.0	624	25	1	288059.0	0.0	1.0	1.0	0
+1	4753350.0	624	26	1	315575.0	0.0	1.0	1.0	0
+1	4753350.0	624	27	1	323727.0	0.0	1.0	1.0	0
+1	4753350.0	624	28	1	325223.0	0.0	1.0	1.0	0
+1	4753350.0	624	29	1	329323.5	0.0	1.0	1.0	0
+1	4753350.0	624	30	1	333940.0	0.0	1.0	1.0	0
+1	4753350.0	624	31	1	337999.0	0.0	1.0	1.0	0
+1	4753350.0	624	32	1	348486.0	0.0	1.0	0.0	0
+1	4753350.0	624	33	1	358353.0	0.0	1.0	1.0	0
+1	4753350.0	624	34	1	360358.0	0.0	1.0	1.0	0
+1	4753350.0	624	35	1	361821.0	0.0	1.0	1.0	0
+1	4753350.0	624	36	1	362356.0	0.0	1.0	1.0	0
+1	4753350.0	624	37	1	368752.0	0.0	1.0	1.0	0
+1	4753350.0	624	38	1	371856.0	0.0	1.0	1.0	0
+1	4753350.0	624	39	1	388051.0	0.0	1.0	1.0	0
+1	4753350.0	624	40	1	397842.0	0.0	1.0	1.0	0
+1	4753350.0	624	41	1	402384.0	0.0	1.0	1.0	0
+1	4753350.0	624	42	1	406999.0	0.0	1.0	1.0	0
+1	4753350.0	624	43	1	411437.0	0.0	1.0	1.0	0
+1	4753350.0	624	44	1	415644.0	0.0	1.0	1.0	0
+1	4753350.0	624	45	1	418640.0	0.0	1.0	1.0	0
+1	4753350.0	624	46	1	419539.0	0.0	1.0	1.0	0
+1	4753350.0	624	47	1	425668.0	0.0	1.0	1.0	0
+1	4753350.0	624	48	1	428336.0	0.0	1.0	1.0	0
+1	4753350.0	624	49	1	432419.0	0.0	1.0	1.0	0
+1	4753350.0	624	50	1	441525.0	0.0	1.0	0.0	0
+1	4753350.0	624	51	1	443358.0	0.0	1.0	1.0	0
+1	4753350.0	624	52	1	463778.0	0.0	1.0	1.0	0
+1	4753350.0	624	53	1	474831.0	0.0	1.0	1.0	0
+1	4753350.0	624	54	1	492458.0	0.0	1.0	1.0	0
+1	4753350.0	624	55	1	514820.0	0.0	1.0	1.0	0
+1	4753350.0	624	56	1	517179.0	0.0	1.0	1.0	0
+1	4753350.0	624	57	1	527496.0	0.0	1.0	1.0	0
+1	4753350.0	624	58	1	537373.0	0.0	1.0	1.0	0
+1	4753350.0	624	59	1	543569.0	0.0	1.0	1.0	0
+1	4753350.0	624	60	1	545170.0	0.0	1.0	1.0	0
+1	4753350.0	624	61	1	545936.0	0.0	1.0	0.0	0
+1	4753350.0	624	62	1	551771.0	0.0	1.0	1.0	0
+1	4753350.0	624	63	1	556881.0	0.0	1.0	1.0	0
+1	4753350.0	624	64	1	557641.0	0.0	1.0	1.0	0
+1	4753350.0	624	65	1	561928.0	0.0	1.0	1.0	0
+1	4753350.0	624	66	1	568890.0	0.0	1.0	1.0	0
+1	4753350.0	624	67	1	573460.0	0.0	1.0	1.0	0
+1	4753350.0	624	68	1	574888.0	0.0	1.0	1.0	0
+1	4753350.0	624	69	1	587312.0	0.0	1.0	1.0	0
+1	4753350.0	624	70	1	596147.0	0.0	1.0	1.0	0
+1	4753350.0	624	71	1	598321.0	0.0	1.0	1.0	0
+1	4753350.0	624	72	1	599783.0	0.0	1.0	1.0	0
+1	4753350.0	624	73	1	602322.0	0.0	1.0	1.0	0
+1	4753350.0	624	74	1	607378.0	0.0	1.0	1.0	0
+1	4753350.0	624	75	1	631798.0	0.0	1.0	1.0	0
+1	4753350.0	624	76	1	636224.0	0.0	1.0	1.0	0
+1	4753350.0	624	77	1	638410.0	0.0	1.0	1.0	0
+1	4753350.0	624	78	1	645851.0	0.0	1.0	1.0	0
+1	4753350.0	624	79	1	649137.0	0.0	1.0	1.0	0
+1	4753350.0	624	80	1	653670.0	0.0	1.0	1.0	0
+1	4753350.0	624	81	1	656604.0	0.0	1.0	1.0	0
+1	4753350.0	624	82	1	659908.0	0.0	1.0	1.0	0
+1	4753350.0	624	83	1	664686.0	0.0	1.0	1.0	0
+1	4753350.0	624	84	1	677855.0	0.0	1.0	1.0	0
+1	4753350.0	624	85	1	682394.0	0.0	1.0	1.0	0
+1	4753350.0	624	86	1	693884.0	0.0	1.0	1.0	0
+1	4753350.0	624	87	1	707834.5	0.0	1.0	1.0	0
+1	4753350.0	624	88	1	708653.0	0.0	1.0	1.0	0
+1	4753350.0	624	89	1	712259.0	0.0	1.0	1.0	0
+1	4753350.0	624	90	1	716442.0	0.0	1.0	1.0	0
+1	4753350.0	624	91	1	717564.0	0.0	1.0	1.0	0
+1	4753350.0	624	92	1	724542.0	0.0	1.0	1.0	0
+1	4753350.0	624	93	1	732436.0	0.0	1.0	1.0	0
+1	4753350.0	624	94	1	737227.0	0.0	1.0	1.0	0
+1	4753350.0	624	95	1	743436.5	0.0	1.0	1.0	0
+1	4753350.0	624	96	1	765981.0	0.0	1.0	1.0	0
+1	4753350.0	624	97	1	767873.0	0.0	1.0	1.0	0
+1	4753350.0	624	98	1	811829.0	0.0	1.0	1.0	0
+1	4753350.0	624	99	1	815523.0	0.0	1.0	1.0	0
+1	4753350.0	624	100	1	835691.5	0.0	1.0	1.0	0
+1	4753350.0	624	101	1	839012.0	0.0	1.0	1.0	0
+1	4753350.0	624	102	1	844824.0	0.0	1.0	1.0	0
+1	4753350.0	624	103	1	855861.0	0.0	1.0	1.0	0
+1	4753350.0	624	104	1	862953.0	0.0	1.0	1.0	0
+1	4753350.0	624	105	1	868835.0	0.0	1.0	1.0	0
+1	4753350.0	624	106	1	882537.0	0.0	1.0	1.0	0
+1	4753350.0	624	107	1	883646.0	0.0	1.0	1.0	0
+1	4753350.0	624	108	1	888143.0	0.0	1.0	1.0	0
+1	4753350.0	624	109	1	896620.0	0.0	1.0	1.0	0
+1	4753350.0	624	110	1	901539.0	0.0	1.0	1.0	0
+1	4753350.0	624	111	1	906376.0	0.0	1.0	1.0	0
+1	4753350.0	624	112	1	910317.0	0.0	1.0	1.0	0
+1	4753350.0	624	113	1	911007.0	0.0	1.0	1.0	0
+1	4753350.0	624	114	1	932375.0	0.0	1.0	1.0	0
+1	4753350.0	624	115	1	934326.0	0.0	1.0	1.0	0
+1	4753350.0	624	116	1	935945.0	0.0	1.0	1.0	0
+1	4753350.0	624	117	1	942719.0	0.0	1.0	1.0	0
+1	4753350.0	624	118	1	950554.0	0.0	1.0	1.0	0
+1	4753350.0	624	119	1	955451.5	0.0	1.0	1.0	0
+1	4753350.0	624	120	1	967823.0	0.0	1.0	1.0	0
+1	4753350.0	624	121	1	972446.0	0.0	1.0	1.0	0
+1	4753350.0	624	122	1	973196.0	0.0	1.0	1.0	0
+1	4753350.0	624	123	1	975202.0	0.0	1.0	1.0	0
+1	4753350.0	624	124	1	1001484.0	0.0	1.0	1.0	0
+1	4753350.0	624	125	1	1005349.0	0.0	1.0	1.0	0
+1	4753350.0	624	126	1	1011256.0	0.0	1.0	1.0	0
+1	4753350.0	624	127	1	1026412.0	0.0	1.0	1.0	0
+1	4753350.0	624	128	1	1027378.0	0.0	1.0	1.0	0
+1	4753350.0	624	129	1	1032431.0	0.0	1.0	1.0	0
+1	4753350.0	624	130	1	1039538.0	0.0	1.0	1.0	0
+1	4753350.0	624	131	1	1042715.0	0.0	1.0	1.0	0
+1	4753350.0	624	132	1	1059415.0	0.0	1.0	1.0	0
+1	4753350.0	624	133	1	1070382.0	0.0	1.0	1.0	0
+1	4753350.0	624	134	1	1080320.0	0.0	1.0	1.0	0
+1	4753350.0	624	135	1	1086698.0	0.0	1.0	1.0	0
+1	4753350.0	624	136	1	1089958.0	0.0	1.0	1.0	0
+1	4753350.0	624	137	1	1091965.0	0.0	1.0	1.0	0
+1	4753350.0	624	138	1	1093648.0	0.0	1.0	1.0	0
+1	4753350.0	624	139	1	1096808.0	0.0	1.0	1.0	0
+1	4753350.0	624	140	1	1106576.0	0.0	1.0	1.0	0
+1	4753350.0	624	141	1	1121476.0	0.0	1.0	1.0	0
+1	4753350.0	624	142	1	1128394.0	0.0	1.0	1.0	0
+1	4753350.0	624	143	1	1131455.0	0.0	1.0	1.0	0
+1	4753350.0	624	144	1	1139677.0	0.0	1.0	0.0	0
+1	4753350.0	624	145	1	1143211.0	0.0	1.0	0.0	0
+1	4753350.0	624	146	1	1155998.0	0.0	1.0	1.0	0
+1	4753350.0	624	147	1	1157210.0	0.0	1.0	1.0	0
+1	4753350.0	624	148	1	1172484.0	0.0	1.0	1.0	0
+1	4753350.0	624	149	1	1173723.0	0.0	1.0	1.0	0
+1	4753350.0	624	150	1	1182409.0	0.0	1.0	1.0	0
+1	4753350.0	624	151	1	1185645.0	0.0	1.0	1.0	0
+1	4753350.0	624	152	1	1187661.0	0.0	1.0	1.0	0
+1	4753350.0	624	153	1	1210410.0	0.0	1.0	1.0	0
+1	4753350.0	624	154	1	1219414.0	0.0	1.0	1.0	0
+1	4753350.0	624	155	1	1226169.0	0.0	1.0	1.0	0
+1	4753350.0	624	156	1	1227018.0	0.0	1.0	1.0	0
+1	4753350.0	624	157	1	1240575.0	0.0	1.0	1.0	0
+1	4753350.0	624	158	1	1242081.0	0.0	1.0	1.0	0
+1	4753350.0	624	159	1	1250286.0	0.0	1.0	1.0	0
+1	4753350.0	624	160	1	1256833.0	0.0	1.0	1.0	0
+1	4753350.0	624	161	1	1272964.0	0.0	1.0	1.0	0
+1	4753350.0	624	162	1	1278512.0	0.0	1.0	1.0	0
+1	4753350.0	624	163	1	1283280.0	0.0	1.0	1.0	0
+1	4753350.0	624	164	1	1288448.0	0.0	1.0	1.0	0
+1	4753350.0	624	165	1	1293957.0	0.0	1.0	1.0	0
+1	4753350.0	624	166	1	1303481.0	0.0	1.0	1.0	0
+1	4753350.0	624	167	1	1323797.0	0.0	1.0	1.0	0
+1	4753350.0	624	168	1	1327446.0	0.0	1.0	1.0	0
+1	4753350.0	624	169	1	1330154.0	0.0	1.0	1.0	0
+1	4753350.0	624	170	1	1335816.0	0.0	1.0	1.0	0
+1	4753350.0	624	171	1	1344894.0	0.0	1.0	1.0	0
+1	4753350.0	624	172	1	1357874.0	0.0	1.0	1.0	0
+1	4753350.0	624	173	1	1361337.0	0.0	1.0	1.0	0
+1	4753350.0	624	174	1	1371627.0	0.0	1.0	1.0	0
+1	4753350.0	624	175	1	1374164.0	0.0	1.0	1.0	0
+1	4753350.0	624	176	1	1376226.0	0.0	1.0	1.0	0
+1	4753350.0	624	177	1	1384189.0	0.0	1.0	1.0	0
+1	4753350.0	624	178	1	1385330.0	0.0	1.0	1.0	0
+1	4753350.0	624	179	1	1388204.0	0.0	1.0	1.0	0
+1	4753350.0	624	180	1	1391671.5	0.0	1.0	1.0	0
+1	4753350.0	624	181	1	1396918.0	0.0	1.0	1.0	0
+1	4753350.0	624	182	1	1399751.0	0.0	1.0	1.0	0
+1	4753350.0	624	183	1	1403582.0	0.0	1.0	1.0	0
+1	4753350.0	624	184	1	1408862.0	0.0	1.0	1.0	0
+1	4753350.0	624	185	1	1409548.0	0.0	1.0	1.0	0
+1	4753350.0	624	186	1	1412647.0	0.0	1.0	1.0	0
+1	4753350.0	624	187	1	1415102.0	0.0	1.0	1.0	0
+1	4753350.0	624	188	1	1432087.0	0.0	1.0	1.0	0
+1	4753350.0	624	189	1	1446142.0	0.0	1.0	1.0	0
+1	4753350.0	624	190	1	1477988.0	0.0	1.0	1.0	0
+1	4753350.0	624	191	1	1490755.0	0.0	1.0	1.0	0
+1	4753350.0	624	192	1	1492814.0	0.0	1.0	1.0	0
+1	4753350.0	624	193	1	1494770.0	0.0	1.0	1.0	0
+1	4753350.0	624	194	1	1497500.0	0.0	1.0	1.0	0
+1	4753350.0	624	195	1	1500104.0	0.0	1.0	1.0	0
+1	4753350.0	624	196	1	1502028.0	0.0	1.0	1.0	0
+1	4753350.0	624	197	1	1511074.0	0.0	1.0	1.0	0
+1	4753350.0	624	198	1	1516126.0	0.0	1.0	1.0	0
+1	4753350.0	624	199	1	1520686.0	0.0	1.0	1.0	0
+1	4753350.0	624	200	1	1523395.0	0.0	1.0	1.0	0
+1	4753350.0	624	201	1	1527971.0	0.0	1.0	1.0	0
+1	4753350.0	624	202	1	1546270.0	0.0	1.0	1.0	0
+1	4753350.0	624	203	1	1548569.0	0.0	1.0	1.0	0
+1	4753350.0	624	204	1	1550539.0	0.0	1.0	1.0	0
+1	4753350.0	624	205	1	1562130.0	0.0	1.0	1.0	0
+1	4753350.0	624	206	1	1571447.0	0.0	1.0	1.0	0
+1	4753350.0	624	207	1	1583723.0	0.0	1.0	1.0	0
+1	4753350.0	624	208	1	1585826.0	0.0	1.0	1.0	0
+1	4753350.0	624	209	1	1589744.0	0.0	1.0	1.0	0
+1	4753350.0	624	210	1	1595459.0	0.0	1.0	1.0	0
+1	4753350.0	624	211	1	1602017.0	0.0	1.0	1.0	0
+1	4753350.0	624	212	1	1604017.0	0.0	1.0	1.0	0
+1	4753350.0	624	213	1	1604588.0	0.0	1.0	1.0	0
+1	4753350.0	624	214	1	1620327.0	0.0	1.0	1.0	0
+1	4753350.0	624	215	1	1629337.0	0.0	1.0	1.0	0
+1	4753350.0	624	216	1	1633023.5	0.0	1.0	1.0	0
+1	4753350.0	624	217	1	1636670.0	0.0	1.0	1.0	0
+1	4753350.0	624	218	1	1651352.0	0.0	1.0	1.0	0
+1	4753350.0	624	219	1	1658047.0	0.0	1.0	1.0	0
+1	4753350.0	624	220	1	1672431.0	0.0	1.0	1.0	0
+1	4753350.0	624	221	1	1697220.0	0.0	1.0	1.0	0
+1	4753350.0	624	222	1	1697970.0	0.0	1.0	1.0	0
+1	4753350.0	624	223	1	1708996.0	0.0	1.0	1.0	0
+1	4753350.0	624	224	1	1723734.0	0.0	1.0	1.0	0
+1	4753350.0	624	225	1	1731707.0	0.0	1.0	1.0	0
+1	4753350.0	624	226	1	1741993.0	0.0	1.0	1.0	0
+1	4753350.0	624	227	1	1750035.0	0.0	1.0	1.0	0
+1	4753350.0	624	228	1	1753398.0	0.0	1.0	1.0	0
+1	4753350.0	624	229	1	1759688.0	0.0	1.0	1.0	0
+1	4753350.0	624	230	1	1787434.0	0.0	1.0	1.0	0
+1	4753350.0	624	231	1	1794175.0	0.0	1.0	1.0	0
+1	4753350.0	624	232	1	1804966.0	0.0	1.0	1.0	0
+1	4753350.0	624	233	1	1821519.0	0.0	1.0	1.0	0
+1	4753350.0	624	234	1	1823262.0	0.0	1.0	1.0	0
+1	4753350.0	624	235	1	1829994.0	0.0	1.0	1.0	0
+1	4753350.0	624	236	1	1838454.0	0.0	1.0	1.0	0
+1	4753350.0	624	237	1	1839012.0	0.0	1.0	1.0	0
+1	4753350.0	624	238	1	1845126.5	0.0	1.0	1.0	0
+1	4753350.0	624	239	1	1851996.0	0.0	1.0	1.0	0
+1	4753350.0	624	240	1	1866093.0	0.0	1.0	1.0	0
+1	4753350.0	624	241	1	1893677.0	0.0	1.0	1.0	0
+1	4753350.0	624	242	1	1909954.0	0.0	1.0	1.0	0
+1	4753350.0	624	243	1	1922631.0	0.0	1.0	1.0	0
+1	4753350.0	624	244	1	1929816.0	0.0	1.0	1.0	0
+1	4753350.0	624	245	1	1936834.0	0.0	1.0	1.0	0
+1	4753350.0	624	246	1	1942385.0	0.0	1.0	1.0	0
+1	4753350.0	624	247	1	1944710.0	0.0	1.0	0.0	0
+1	4753350.0	624	248	1	1946087.5	0.0	1.0	1.0	0
+1	4753350.0	624	249	1	1948265.0	0.0	1.0	1.0	0
+1	4753350.0	624	250	1	1949581.0	0.0	1.0	1.0	0
+1	4753350.0	624	251	1	1966907.0	0.0	1.0	1.0	0
+1	4753350.0	624	252	1	1992106.0	0.0	1.0	1.0	0
+1	4753350.0	624	253	1	1993239.0	0.0	1.0	1.0	0
+1	4753350.0	624	254	1	1997117.0	0.0	1.0	1.0	0
+1	4753350.0	624	255	1	1997923.0	0.0	1.0	1.0	0
+1	4753350.0	624	256	1	2000536.0	0.0	1.0	1.0	0
+1	4753350.0	624	257	1	2003126.0	0.0	1.0	1.0	0
+1	4753350.0	624	258	1	2015855.0	0.0	1.0	1.0	0
+1	4753350.0	624	259	1	2020749.0	0.0	1.0	1.0	0
+1	4753350.0	624	260	1	2021383.5	0.0	1.0	1.0	0
+1	4753350.0	624	261	1	2023972.0	0.0	1.0	1.0	0
+1	4753350.0	624	262	1	2025495.0	0.0	1.0	0.0	0
+1	4753350.0	624	263	1	2027262.0	0.0	1.0	1.0	0
+1	4753350.0	624	264	1	2047531.0	0.0	1.0	1.0	0
+1	4753350.0	624	265	1	2052273.0	0.0	1.0	1.0	0
+1	4753350.0	624	266	1	2059471.0	0.0	1.0	1.0	0
+1	4753350.0	624	267	1	2062498.0	0.0	1.0	1.0	0
+1	4753350.0	624	268	1	2076780.0	0.0	1.0	1.0	0
+1	4753350.0	624	269	1	2084242.0	0.0	1.0	1.0	0
+1	4753350.0	624	270	1	2087324.0	0.0	1.0	1.0	0
+1	4753350.0	624	271	1	2107688.0	0.0	1.0	1.0	0
+1	4753350.0	624	272	1	2123723.0	0.0	1.0	1.0	0
+1	4753350.0	624	273	1	2131233.0	0.0	1.0	1.0	0
+1	4753350.0	624	274	1	2137357.0	0.0	1.0	1.0	0
+1	4753350.0	624	275	1	2155018.5	0.0	1.0	1.0	0
+1	4753350.0	624	276	1	2157418.0	0.0	1.0	1.0	0
+1	4753350.0	624	277	1	2158003.0	0.0	1.0	1.0	0
+1	4753350.0	624	278	1	2162229.0	0.0	1.0	1.0	0
+1	4753350.0	624	279	1	2163364.0	0.0	1.0	1.0	0
+1	4753350.0	624	280	1	2179644.0	0.0	1.0	1.0	0
+1	4753350.0	624	281	1	2180219.0	0.0	1.0	1.0	0
+1	4753350.0	624	282	1	2181049.0	0.0	1.0	1.0	0
+1	4753350.0	624	283	1	2185384.0	0.0	1.0	1.0	0
+1	4753350.0	624	284	1	2193391.0	0.0	1.0	1.0	0
+1	4753350.0	624	285	1	2196931.0	0.0	1.0	1.0	0
+1	4753350.0	624	286	1	2198046.0	0.0	1.0	1.0	0
+1	4753350.0	624	287	1	2212757.0	0.0	1.0	1.0	0
+1	4753350.0	624	288	1	2222278.5	0.0	1.0	1.0	0
+1	4753350.0	624	289	1	2236311.0	0.0	1.0	0.0	0
+1	4753350.0	624	290	1	2237533.0	0.0	1.0	1.0	0
+1	4753350.0	624	291	1	2242354.0	0.0	1.0	1.0	0
+1	4753350.0	624	292	1	2243467.0	0.0	1.0	1.0	0
+1	4753350.0	624	293	1	2252876.0	0.0	1.0	1.0	0
+1	4753350.0	624	294	1	2261808.0	0.0	1.0	1.0	0
+1	4753350.0	624	295	1	2263578.0	0.0	1.0	1.0	0
+1	4753350.0	624	296	1	2265285.0	0.0	1.0	1.0	0
+1	4753350.0	624	297	1	2269662.0	0.0	1.0	1.0	0
+1	4753350.0	624	298	1	2273470.0	0.0	1.0	1.0	0
+1	4753350.0	624	299	1	2309523.0	0.0	1.0	1.0	0
+1	4753350.0	624	300	1	2320083.0	0.0	1.0	1.0	0
+1	4753350.0	624	301	1	2338777.0	0.0	1.0	1.0	0
+1	4753350.0	624	302	1	2351212.0	0.0	1.0	1.0	0
+1	4753350.0	624	303	1	2353671.0	0.0	1.0	1.0	0
+1	4753350.0	624	304	1	2356999.0	0.0	1.0	1.0	0
+1	4753350.0	624	305	1	2361318.0	0.0	1.0	1.0	0
+1	4753350.0	624	306	1	2363573.0	0.0	1.0	1.0	0
+1	4753350.0	624	307	1	2371737.0	0.0	1.0	1.0	0
+1	4753350.0	624	308	1	2374197.0	0.0	1.0	1.0	0
+1	4753350.0	624	309	1	2397082.0	0.0	1.0	1.0	0
+1	4753350.0	624	310	1	2404413.0	0.0	1.0	1.0	0
+1	4753350.0	624	311	1	2421749.0	0.0	1.0	1.0	0
+1	4753350.0	624	312	1	2440188.0	0.0	1.0	1.0	0
+1	4753350.0	624	313	1	2442946.0	0.0	1.0	1.0	0
+1	4753350.0	624	314	1	2443848.0	0.0	1.0	1.0	0
+1	4753350.0	624	315	1	2447921.0	0.0	1.0	1.0	0
+1	4753350.0	624	316	1	2450213.0	0.0	1.0	1.0	0
+1	4753350.0	624	317	1	2465443.0	0.0	1.0	1.0	0
+1	4753350.0	624	318	1	2468644.5	0.0	1.0	1.0	0
+1	4753350.0	624	319	1	2474340.0	0.0	1.0	1.0	0
+1	4753350.0	624	320	1	2477236.0	0.0	1.0	1.0	0
+1	4753350.0	624	321	1	2484210.0	0.0	1.0	1.0	0
+1	4753350.0	624	322	1	2489494.0	0.0	1.0	1.0	0
+1	4753350.0	624	323	1	2490113.0	0.0	1.0	0.0	0
+1	4753350.0	624	324	1	2497328.0	0.0	1.0	1.0	0
+1	4753350.0	624	325	1	2517158.0	0.0	1.0	1.0	0
+1	4753350.0	624	326	1	2539365.0	0.0	1.0	1.0	0
+1	4753350.0	624	327	1	2571467.0	0.0	1.0	1.0	0
+1	4753350.0	624	328	1	2581683.5	0.0	1.0	0.0	0
+1	4753350.0	624	329	1	2583009.0	0.0	1.0	1.0	0
+1	4753350.0	624	330	1	2583548.0	0.0	1.0	1.0	0
+1	4753350.0	624	331	1	2593922.0	0.0	1.0	1.0	0
+1	4753350.0	624	332	1	2603285.5	0.0	1.0	1.0	0
+1	4753350.0	624	333	1	2609419.0	0.0	1.0	1.0	0
+1	4753350.0	624	334	1	2615243.0	0.0	1.0	1.0	0
+1	4753350.0	624	335	1	2616084.0	0.0	1.0	1.0	0
+1	4753350.0	624	336	1	2619949.0	0.0	1.0	1.0	0
+1	4753350.0	624	337	1	2686490.0	0.0	1.0	1.0	0
+1	4753350.0	624	338	1	2690434.0	0.0	1.0	1.0	0
+1	4753350.0	624	339	1	2693446.0	0.0	1.0	1.0	0
+1	4753350.0	624	340	1	2696290.0	0.0	1.0	1.0	0
+1	4753350.0	624	341	1	2696756.0	0.0	1.0	1.0	0
+1	4753350.0	624	342	1	2701387.0	0.0	1.0	1.0	0
+1	4753350.0	624	343	1	2706377.0	0.0	1.0	1.0	0
+1	4753350.0	624	344	1	2714755.0	0.0	1.0	1.0	0
+1	4753350.0	624	345	1	2722749.0	0.0	1.0	1.0	0
+1	4753350.0	624	346	1	2728060.0	0.0	1.0	1.0	0
+1	4753350.0	624	347	1	2729019.0	0.0	1.0	1.0	0
+1	4753350.0	624	348	1	2735530.0	0.0	1.0	1.0	0
+1	4753350.0	624	349	1	2742763.0	0.0	1.0	1.0	0
+1	4753350.0	624	350	1	2743680.0	0.0	1.0	1.0	0
+1	4753350.0	624	351	1	2744769.0	0.0	1.0	1.0	0
+1	4753350.0	624	352	1	2747375.5	0.0	1.0	1.0	0
+1	4753350.0	624	353	1	2781059.0	0.0	1.0	1.0	0
+1	4753350.0	624	354	1	2792133.0	0.0	1.0	1.0	0
+1	4753350.0	624	355	1	2800460.5	0.0	1.0	1.0	0
+1	4753350.0	624	356	1	2814169.0	0.0	1.0	1.0	0
+1	4753350.0	624	357	1	2820078.0	0.0	1.0	1.0	0
+1	4753350.0	624	358	1	2822391.0	0.0	1.0	1.0	0
+1	4753350.0	624	359	1	2824851.0	0.0	1.0	1.0	0
+1	4753350.0	624	360	1	2840253.0	0.0	1.0	1.0	0
+1	4753350.0	624	361	1	2847987.0	0.0	1.0	1.0	0
+1	4753350.0	624	362	1	2862670.0	0.0	1.0	1.0	0
+1	4753350.0	624	363	1	2864554.0	0.0	1.0	1.0	0
+1	4753350.0	624	364	1	2865879.5	0.0	1.0	1.0	0
+1	4753350.0	624	365	1	2879444.5	0.0	1.0	1.0	0
+1	4753350.0	624	366	1	2887886.0	0.0	1.0	1.0	0
+1	4753350.0	624	367	1	2890709.0	0.0	1.0	1.0	0
+1	4753350.0	624	368	1	2897559.0	0.0	1.0	1.0	0
+1	4753350.0	624	369	1	2898702.0	0.0	1.0	1.0	0
+1	4753350.0	624	370	1	2899575.0	0.0	1.0	0.0	0
+1	4753350.0	624	371	1	2912270.0	0.0	1.0	1.0	0
+1	4753350.0	624	372	1	2914496.0	0.0	1.0	1.0	0
+1	4753350.0	624	373	1	2920370.0	0.0	1.0	1.0	0
+1	4753350.0	624	374	1	2923801.0	0.0	1.0	1.0	0
+1	4753350.0	624	375	1	2924679.0	0.0	1.0	1.0	0
+1	4753350.0	624	376	1	2932607.0	0.0	1.0	1.0	0
+1	4753350.0	624	377	1	2938320.0	0.0	1.0	1.0	0
+1	4753350.0	624	378	1	2943388.0	0.0	1.0	1.0	0
+1	4753350.0	624	379	1	2944925.0	0.0	1.0	1.0	0
+1	4753350.0	624	380	1	2952740.0	0.0	1.0	1.0	0
+1	4753350.0	624	381	1	2963166.0	0.0	1.0	1.0	0
+1	4753350.0	624	382	1	2972848.0	0.0	1.0	1.0	0
+1	4753350.0	624	383	1	2981868.0	0.0	1.0	1.0	0
+1	4753350.0	624	384	1	2987736.0	0.0	1.0	1.0	0
+1	4753350.0	624	385	1	2988553.0	0.0	1.0	1.0	0
+1	4753350.0	624	386	1	2998344.0	0.0	1.0	1.0	0
+1	4753350.0	624	387	1	3000672.0	0.0	1.0	1.0	0
+1	4753350.0	624	388	1	3001299.0	0.0	1.0	1.0	0
+1	4753350.0	624	389	1	3013747.0	0.0	1.0	1.0	0
+1	4753350.0	624	390	1	3016755.0	0.0	1.0	1.0	0
+1	4753350.0	624	391	1	3021444.0	0.0	1.0	1.0	0
+1	4753350.0	624	392	1	3038684.0	0.0	1.0	1.0	0
+1	4753350.0	624	393	1	3050840.0	0.0	1.0	1.0	0
+1	4753350.0	624	394	1	3058648.0	0.0	1.0	1.0	0
+1	4753350.0	624	395	1	3060537.0	0.0	1.0	1.0	0
+1	4753350.0	624	396	1	3077132.5	0.0	1.0	1.0	0
+1	4753350.0	624	397	1	3085239.0	0.0	1.0	1.0	0
+1	4753350.0	624	398	1	3093465.0	0.0	1.0	1.0	0
+1	4753350.0	624	399	1	3095285.0	0.0	1.0	1.0	0
+1	4753350.0	624	400	1	3096094.0	0.0	1.0	0.0	0
+1	4753350.0	624	401	1	3099592.0	0.0	1.0	1.0	0
+1	4753350.0	624	402	1	3100887.0	0.0	1.0	1.0	0
+1	4753350.0	624	403	1	3103930.0	0.0	1.0	1.0	0
+1	4753350.0	624	404	1	3113616.0	0.0	1.0	1.0	0
+1	4753350.0	624	405	1	3117537.0	0.0	1.0	1.0	0
+1	4753350.0	624	406	1	3120144.0	0.0	1.0	1.0	0
+1	4753350.0	624	407	1	3123136.0	0.0	1.0	1.0	0
+1	4753350.0	624	408	1	3128911.0	0.0	1.0	1.0	0
+1	4753350.0	624	409	1	3129628.0	0.0	1.0	1.0	0
+1	4753350.0	624	410	1	3139029.0	0.0	1.0	1.0	0
+1	4753350.0	624	411	1	3152764.0	0.0	1.0	1.0	0
+1	4753350.0	624	412	1	3154730.0	0.0	1.0	1.0	0
+1	4753350.0	624	413	1	3188180.0	0.0	1.0	1.0	0
+1	4753350.0	624	414	1	3200949.0	0.0	1.0	1.0	0
+1	4753350.0	624	415	1	3211941.0	0.0	1.0	1.0	0
+1	4753350.0	624	416	1	3214944.0	0.0	1.0	1.0	0
+1	4753350.0	624	417	1	3256336.0	0.0	1.0	1.0	0
+1	4753350.0	624	418	1	3261460.0	0.0	1.0	0.0	0
+1	4753350.0	624	419	1	3262782.0	0.0	1.0	0.0	0
+1	4753350.0	624	420	1	3280389.0	0.0	1.0	0.0	0
+1	4753350.0	624	421	1	3281810.0	0.0	1.0	0.0	0
+1	4753350.0	624	422	1	3286595.0	0.0	1.0	0.0	0
+1	4753350.0	624	423	1	3301019.0	0.0	1.0	0.0	0
+1	4753350.0	624	424	1	3308320.0	0.0	1.0	0.0	0
+1	4753350.0	624	425	1	3314209.0	0.0	1.0	0.0	0
+1	4753350.0	624	426	1	3325201.0	0.0	1.0	0.0	0
+1	4753350.0	624	427	1	3328204.0	0.0	1.0	0.0	0
+1	4753350.0	624	428	1	3369596.0	0.0	1.0	0.0	0
+1	4753350.0	624	429	1	3374720.0	0.0	1.0	0.0	0
+1	4753350.0	624	430	1	3376042.0	0.0	1.0	1.0	0
+1	4753350.0	624	431	1	3393649.0	0.0	1.0	1.0	0
+1	4753350.0	624	432	1	3395070.0	0.0	1.0	1.0	0
+1	4753350.0	624	433	1	3399855.0	0.0	1.0	1.0	0
+1	4753350.0	624	434	1	3414279.0	0.0	1.0	1.0	0
+1	4753350.0	624	435	1	3421580.0	0.0	1.0	1.0	0
+1	4753350.0	624	436	1	3453060.0	0.0	1.0	1.0	0
+1	4753350.0	624	437	1	3480533.0	0.0	1.0	1.0	0
+1	4753350.0	624	438	1	3483858.0	0.0	1.0	1.0	0
+1	4753350.0	624	439	1	3486171.0	0.0	1.0	1.0	0
+1	4753350.0	624	440	1	3488090.0	0.0	1.0	1.0	0
+1	4753350.0	624	441	1	3495680.0	0.0	1.0	1.0	0
+1	4753350.0	624	442	1	3496195.0	0.0	1.0	1.0	0
+1	4753350.0	624	443	1	3500014.0	0.0	1.0	1.0	0
+1	4753350.0	624	444	1	3513426.5	0.0	1.0	1.0	0
+1	4753350.0	624	445	1	3519405.0	0.0	1.0	1.0	0
+1	4753350.0	624	446	1	3520228.0	0.0	1.0	1.0	0
+1	4753350.0	624	447	1	3521426.0	0.0	1.0	1.0	0
+1	4753350.0	624	448	1	3523293.0	0.0	1.0	1.0	0
+1	4753350.0	624	449	1	3541393.0	0.0	1.0	1.0	0
+1	4753350.0	624	450	1	3546342.0	0.0	1.0	1.0	0
+1	4753350.0	624	451	1	3550034.5	0.0	1.0	1.0	0
+1	4753350.0	624	452	1	3553337.0	0.0	1.0	1.0	0
+1	4753350.0	624	453	1	3554698.0	0.0	1.0	1.0	0
+1	4753350.0	624	454	1	3560540.0	0.0	1.0	1.0	0
+1	4753350.0	624	455	1	3561800.0	0.0	1.0	0.0	0
+1	4753350.0	624	456	1	3567496.0	0.0	1.0	1.0	0
+1	4753350.0	624	457	1	3569095.5	0.0	1.0	1.0	0
+1	4753350.0	624	458	1	3570163.5	0.0	1.0	1.0	0
+1	4753350.0	624	459	1	3580895.0	0.0	1.0	1.0	0
+1	4753350.0	624	460	1	3583282.0	0.0	1.0	1.0	0
+1	4753350.0	624	461	1	3587709.0	0.0	1.0	0.0	0
+1	4753350.0	624	462	1	3588931.0	0.0	1.0	1.0	0
+1	4753350.0	624	463	1	3590608.0	0.0	1.0	1.0	0
+1	4753350.0	624	464	1	3601254.0	0.0	1.0	0.0	0
+1	4753350.0	624	465	1	3614149.0	0.0	1.0	1.0	0
+1	4753350.0	624	466	1	3615799.0	0.0	1.0	1.0	0
+1	4753350.0	624	467	1	3618404.0	0.0	1.0	1.0	0
+1	4753350.0	624	468	1	3629017.0	0.0	1.0	1.0	0
+1	4753350.0	624	469	1	3630572.0	0.0	1.0	1.0	0
+1	4753350.0	624	470	1	3631597.0	0.0	1.0	1.0	0
+1	4753350.0	624	471	1	3653692.0	0.0	1.0	1.0	0
+1	4753350.0	624	472	1	3658051.0	0.0	1.0	1.0	0
+1	4753350.0	624	473	1	3661560.0	0.0	1.0	1.0	0
+1	4753350.0	624	474	1	3670223.0	0.0	1.0	1.0	0
+1	4753350.0	624	475	1	3672317.0	0.0	1.0	1.0	0
+1	4753350.0	624	476	1	3675287.0	0.0	1.0	1.0	0
+1	4753350.0	624	477	1	3713109.0	0.0	1.0	1.0	0
+1	4753350.0	624	478	1	3713748.0	0.0	1.0	1.0	0
+1	4753350.0	624	479	1	3715176.0	0.0	1.0	1.0	0
+1	4753350.0	624	480	1	3731188.0	0.0	1.0	1.0	0
+1	4753350.0	624	481	1	3734313.0	0.0	1.0	1.0	0
+1	4753350.0	624	482	1	3741685.0	0.0	1.0	1.0	0
+1	4753350.0	624	483	1	3743571.0	0.0	1.0	1.0	0
+1	4753350.0	624	484	1	3749771.0	0.0	1.0	1.0	0
+1	4753350.0	624	485	1	3756229.0	0.0	1.0	1.0	0
+1	4753350.0	624	486	1	3758814.0	0.0	1.0	1.0	0
+1	4753350.0	624	487	1	3761839.0	0.0	1.0	1.0	0
+1	4753350.0	624	488	1	3773601.0	0.0	1.0	1.0	0
+1	4753350.0	624	489	1	3777520.0	0.0	1.0	1.0	0
+1	4753350.0	624	490	1	3778518.0	0.0	1.0	1.0	0
+1	4753350.0	624	491	1	3806149.0	0.0	1.0	1.0	0
+1	4753350.0	624	492	1	3813529.0	0.0	1.0	1.0	0
+1	4753350.0	624	493	1	3818162.0	0.0	1.0	1.0	0
+1	4753350.0	624	494	1	3832215.0	0.0	1.0	1.0	0
+1	4753350.0	624	495	1	3834396.0	0.0	1.0	1.0	0
+1	4753350.0	624	496	1	3848434.0	0.0	1.0	0.0	0
+1	4753350.0	624	497	1	3858858.0	0.0	1.0	1.0	0
+1	4753350.0	624	498	1	3860274.0	0.0	1.0	0.0	0
+1	4753350.0	624	499	1	3878173.0	0.0	1.0	1.0	0
+1	4753350.0	624	500	1	3879001.0	0.0	1.0	1.0	0
+1	4753350.0	624	501	1	3879472.0	0.0	1.0	1.0	0
+1	4753350.0	624	502	1	3881251.0	0.0	1.0	1.0	0
+1	4753350.0	624	503	1	3882711.0	0.0	1.0	1.0	0
+1	4753350.0	624	504	1	3883755.0	0.0	1.0	1.0	0
+1	4753350.0	624	505	1	3886474.0	0.0	1.0	1.0	0
+1	4753350.0	624	506	1	3893366.0	0.0	1.0	1.0	0
+1	4753350.0	624	507	1	3901348.0	0.0	1.0	1.0	0
+1	4753350.0	624	508	1	3902819.0	0.0	1.0	1.0	0
+1	4753350.0	624	509	1	3906431.0	0.0	1.0	1.0	0
+1	4753350.0	624	510	1	3910189.0	0.0	1.0	1.0	0
+1	4753350.0	624	511	1	3922088.0	0.0	1.0	1.0	0
+1	4753350.0	624	512	1	3924932.0	0.0	1.0	1.0	0
+1	4753350.0	624	513	1	3946291.0	0.0	1.0	1.0	0
+1	4753350.0	624	514	1	3946849.0	0.0	1.0	1.0	0
+1	4753350.0	624	515	1	3950267.5	0.0	1.0	1.0	0
+1	4753350.0	624	516	1	3953454.0	0.0	1.0	1.0	0
+1	4753350.0	624	517	1	3958759.0	0.0	1.0	1.0	0
+1	4753350.0	624	518	1	3971446.0	0.0	1.0	1.0	0
+1	4753350.0	624	519	1	3978854.0	0.0	1.0	1.0	0
+1	4753350.0	624	520	1	3985895.0	0.0	1.0	1.0	0
+1	4753350.0	624	521	1	3989489.0	0.0	1.0	1.0	0
+1	4753350.0	624	522	1	3998452.0	0.0	1.0	1.0	0
+1	4753350.0	624	523	1	4006315.0	0.0	1.0	1.0	0
+1	4753350.0	624	524	1	4007728.0	0.0	1.0	1.0	0
+1	4753350.0	624	525	1	4014243.0	0.0	1.0	1.0	0
+1	4753350.0	624	526	1	4014767.0	0.0	1.0	1.0	0
+1	4753350.0	624	527	1	4017011.0	0.0	1.0	1.0	0
+1	4753350.0	624	528	1	4018421.0	0.0	1.0	0.0	0
+1	4753350.0	624	529	1	4028600.0	0.0	1.0	0.0	0
+1	4753350.0	624	530	1	4036577.5	0.0	1.0	0.0	0
+1	4753350.0	624	531	1	4037700.5	0.0	1.0	0.0	0
+1	4753350.0	624	532	1	4045541.0	0.0	1.0	0.0	0
+1	4753350.0	624	533	1	4055113.0	0.0	1.0	0.0	0
+1	4753350.0	624	534	1	4056067.0	0.0	1.0	0.0	0
+1	4753350.0	624	535	1	4056638.0	0.0	1.0	0.0	0
+1	4753350.0	624	536	1	4060186.0	0.0	1.0	0.0	0
+1	4753350.0	624	537	1	4070547.0	0.0	1.0	0.0	0
+1	4753350.0	624	538	1	4071780.0	0.0	1.0	0.0	0
+1	4753350.0	624	539	1	4072258.0	0.0	1.0	0.0	0
+1	4753350.0	624	540	1	4078175.0	0.0	1.0	1.0	0
+1	4753350.0	624	541	1	4103399.0	0.0	1.0	1.0	0
+1	4753350.0	624	542	1	4105588.0	0.0	1.0	1.0	0
+1	4753350.0	624	543	1	4116024.0	0.0	1.0	1.0	0
+1	4753350.0	624	544	1	4119395.0	0.0	1.0	1.0	0
+1	4753350.0	624	545	1	4128486.5	0.0	1.0	1.0	0
+1	4753350.0	624	546	1	4130043.0	0.0	1.0	1.0	0
+1	4753350.0	624	547	1	4132997.0	0.0	1.0	1.0	0
+1	4753350.0	624	548	1	4134603.0	0.0	1.0	1.0	0
+1	4753350.0	624	549	1	4143994.0	0.0	1.0	1.0	0
+1	4753350.0	624	550	1	4146204.0	0.0	1.0	1.0	0
+1	4753350.0	624	551	1	4154254.0	0.0	1.0	1.0	0
+1	4753350.0	624	552	1	4167571.0	0.0	1.0	1.0	0
+1	4753350.0	624	553	1	4168084.0	0.0	1.0	1.0	0
+1	4753350.0	624	554	1	4174150.0	0.0	1.0	1.0	0
+1	4753350.0	624	555	1	4174929.0	0.0	1.0	1.0	0
+1	4753350.0	624	556	1	4184615.0	0.0	1.0	1.0	0
+1	4753350.0	624	557	1	4200229.0	0.0	1.0	1.0	0
+1	4753350.0	624	558	1	4208724.0	0.0	1.0	1.0	0
+1	4753350.0	624	559	1	4213813.0	0.0	1.0	1.0	0
+1	4753350.0	624	560	1	4216996.0	0.0	1.0	1.0	0
+1	4753350.0	624	561	1	4230831.0	0.0	1.0	1.0	0
+1	4753350.0	624	562	1	4233860.0	0.0	1.0	1.0	0
+1	4753350.0	624	563	1	4236701.0	0.0	1.0	1.0	0
+1	4753350.0	624	564	1	4244962.0	0.0	1.0	1.0	0
+1	4753350.0	624	565	1	4253166.0	0.0	1.0	1.0	0
+1	4753350.0	624	566	1	4254649.0	0.0	1.0	1.0	0
+1	4753350.0	624	567	1	4255627.0	0.0	1.0	1.0	0
+1	4753350.0	624	568	1	4256548.0	0.0	1.0	1.0	0
+1	4753350.0	624	569	1	4282081.0	0.0	1.0	1.0	0
+1	4753350.0	624	570	1	4307180.0	0.0	1.0	1.0	0
+1	4753350.0	624	571	1	4307943.0	0.0	1.0	1.0	0
+1	4753350.0	624	572	1	4344738.0	0.0	1.0	1.0	0
+1	4753350.0	624	573	1	4348150.0	0.0	1.0	1.0	0
+1	4753350.0	624	574	1	4378210.0	0.0	1.0	1.0	0
+1	4753350.0	624	575	1	4388767.0	0.0	1.0	1.0	0
+1	4753350.0	624	576	1	4393246.5	0.0	1.0	1.0	0
+1	4753350.0	624	577	1	4396436.0	0.0	1.0	1.0	0
+1	4753350.0	624	578	1	4425979.0	0.0	1.0	1.0	0
+1	4753350.0	624	579	1	4430102.0	0.0	1.0	1.0	0
+1	4753350.0	624	580	1	4434980.0	0.0	1.0	1.0	0
+1	4753350.0	624	581	1	4441066.0	0.0	1.0	1.0	0
+1	4753350.0	624	582	1	4447044.0	0.0	1.0	1.0	0
+1	4753350.0	624	583	1	4455184.0	0.0	1.0	1.0	0
+1	4753350.0	624	584	1	4458855.0	0.0	1.0	1.0	0
+1	4753350.0	624	585	1	4465699.0	0.0	1.0	1.0	0
+1	4753350.0	624	586	1	4470564.0	0.0	1.0	1.0	0
+1	4753350.0	624	587	1	4477348.0	0.0	1.0	1.0	0
+1	4753350.0	624	588	1	4496647.0	0.0	1.0	1.0	0
+1	4753350.0	624	589	1	4500425.0	0.0	1.0	1.0	0
+1	4753350.0	624	590	1	4503201.5	0.0	1.0	1.0	0
+1	4753350.0	624	591	1	4504903.0	0.0	1.0	0.0	0
+1	4753350.0	624	592	1	4517141.0	0.0	1.0	1.0	0
+1	4753350.0	624	593	1	4531397.0	0.0	1.0	1.0	0
+1	4753350.0	624	594	1	4541380.0	0.0	1.0	1.0	0
+1	4753350.0	624	595	1	4567270.0	0.0	1.0	1.0	0
+1	4753350.0	624	596	1	4569921.0	0.0	1.0	1.0	0
+1	4753350.0	624	597	1	4577868.0	0.0	1.0	1.0	0
+1	4753350.0	624	598	1	4590892.0	0.0	1.0	0.0	0
+1	4753350.0	624	599	1	4592022.0	0.0	1.0	1.0	0
+1	4753350.0	624	600	1	4604106.0	0.0	1.0	1.0	0
+1	4753350.0	624	601	1	4632897.0	0.0	1.0	1.0	0
+1	4753350.0	624	602	1	4653877.0	0.0	1.0	1.0	0
+1	4753350.0	624	603	1	4657868.0	0.0	1.0	1.0	0
+1	4753350.0	624	604	1	4658400.0	0.0	1.0	1.0	0
+1	4753350.0	624	605	1	4665746.0	0.0	1.0	1.0	0
+1	4753350.0	624	606	1	4668337.0	0.0	1.0	1.0	0
+1	4753350.0	624	607	1	4677111.0	0.0	1.0	1.0	0
+1	4753350.0	624	608	1	4680578.5	0.0	1.0	1.0	0
+1	4753350.0	624	609	1	4681147.0	0.0	1.0	1.0	0
+1	4753350.0	624	610	1	4683691.0	0.0	1.0	1.0	0
+1	4753350.0	624	611	1	4698978.0	0.0	1.0	1.0	0
+1	4753350.0	624	612	1	4700428.0	0.0	1.0	1.0	0
+1	4753350.0	624	613	1	4702436.5	0.0	1.0	1.0	0
+1	4753350.0	624	614	1	4705006.0	0.0	1.0	1.0	0
+1	4753350.0	624	615	1	4708196.0	0.0	1.0	1.0	0
+1	4753350.0	624	616	1	4724778.0	0.0	1.0	1.0	0
+1	4753350.0	624	617	1	4725417.0	0.0	1.0	1.0	0
+1	4753350.0	624	618	1	4727183.0	0.0	1.0	1.0	0
+1	4753350.0	624	619	1	4727700.0	0.0	1.0	1.0	0
+1	4753350.0	624	620	1	4731209.0	0.0	1.0	1.0	0
+1	4753350.0	624	621	1	4732628.0	0.0	1.0	0.0	0
+1	4753350.0	624	622	1	4740112.0	0.0	1.0	1.0	0
+1	4753350.0	624	623	1	4743710.0	0.0	1.0	1.0	0
+1	4753350.0	624	624	1	4747257.5	0.0	1.0	1.0	0
+1	4753350.0	624	625	0	4753350.0	0.0	1.0	1.0	10
Binary file test-data/small.fasta.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/xml_configuration_file.xmap	Fri Jan 06 22:10:44 2023 +0000
@@ -0,0 +1,12 @@
+# hostname=6d61d934e61b
+# $ cd /HybridScaffold; /RefAligner/amd2/RefAligner -o /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD -stdout -stderr -i /data/jwd03f/main/053/913/53913897/working/assignAlignType/assignAlignType_q.cmap -ref /data/jwd03f/main/053/913/53913897/working/align_final/step2.hybrid.cmap -maxmem 250 -maxthreads 24 -maxvirtmem 250 -RAmem 3 1 -res 2.9 -FP 0.6 -FN 0.06 -sf 0.20 -sd 0.0 -sr 0.01 -extend 1 -outlier 0.0001 -endoutlier 0.001 -PVendoutlier -deltaX 6 -deltaY 6 -xmapchim 12 -hashgen 5 7 2.4 1.5 0.05 5.0 1 1 4 -hash -hashdelta 26 10 46 -hashMultiMatch 30 10 -insertThreads 24 -nosplit 2 -biaswt 0 -T 1e-10 -S -1000 -indel -PVres 2 -rres 0.9 -MaxSE 0.5 -HSDrange 1.0 -outlierBC -xmapUnique 14 -AlignRes 2. -outlierExtend 6 24 -Kmax 6 -resEstimate -BestRef 1 -f -mres 0.9
+# CompileDir= /home/users/sqa01/RefAlignerBuild/branches/12432.12463rel/12432.12463rel CompileCmd=/opt/gcc-9.3.0/bin/g++ -B/opt/binutils-2.34 -fopenmp -Ofast -march=znver2 -mavx2 -mfpmath=sse -DUSE_PFLOAT=1 -DUSE_RFLOAT=1 -DUSE_SSE=1 -DUSE_MFLOAT=1 -DUSE_EPOW=2 -I/home/users8/tanantharaman/sleef-081120/build/include -I/opt/glibc-2.31/include -DUSE_STATIC -freciprocal-math -fno-signed-zeros -fno-trapping-math -fno-tree-vectorize -mtune=znver2 -fno-lto-odr-type-merging -DRELEASE=1 -std=gnu++98  -Wl,--dynamic-linker=/opt/glibc-2.31/lib/ld-linux-x86-64.so.2 -Wl,--rpath=/opt/glibc-2.31/lib -Wl,--rpath=/opt/gcc-9.3.0/lib64 -lsleefinline -lrt -lmvec -L/home/users8/tanantharaman/sleef-081120/build/lib -L/opt/glibc-2.31/lib -L/opt/gcc-9.3.0/lib64 -static -static-libstdc++ -static-libgcc -s SVNversion=12463 $Header: http://svn.bnm.local:81/svn/Informatics/RefAligner/branches/12432/RefAligner.cpp 12458 2021-10-24 00:56:45Z tanantharaman $
+# FLAGS: USE_SSE=1 USE_AVX=1 USE_MIC=0 USE_PFLOAT=1 USE_RFLOAT=1 USE_MFLOAT=1 USE_EPOW=2 DEBUG=1 VERB=1
+# XMAP File Version:	0.2
+# Label Channels:	1
+# Reference Maps From:	/data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD_r.cmap
+# Query Maps From:	/data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD_q.cmap
+#h XmapEntryID	QryContigID	RefContigID	QryStartPos	QryEndPos	RefStartPos	RefEndPos	Orientation	Confidence	HitEnum	QryLen	RefLen	LabelChannel	Alignment
+#f int        	int        	int        	float      	float    	float      	float    	string     	float     	string 	float 	float 	int         	string   
+1	4	1	20.0	715071.0	19489.5	743436.5	+	92.15	7M1D12M1D8M1D2M1D9M1D4M1D10M1D1M1D23M1D2M1D5M	715091.0	4753350.0	1	(3,1)(4,2)(5,3)(6,4)(7,5)(8,6)(9,7)(10,8)(11,8)(12,9)(13,10)(14,11)(15,12)(16,13)(17,14)(18,15)(19,16)(20,17)(21,18)(22,19)(24,20)(25,21)(26,22)(27,23)(28,24)(29,25)(30,26)(31,27)(33,28)(34,29)(35,30)(36,30)(37,31)(38,32)(39,33)(40,34)(41,35)(42,36)(43,37)(44,38)(45,39)(46,39)(47,40)(48,41)(49,42)(51,43)(52,44)(53,45)(54,46)(55,47)(56,48)(57,49)(58,50)(59,51)(60,52)(62,53)(63,54)(64,54)(65,55)(66,56)(67,57)(68,58)(69,59)(70,60)(71,61)(72,62)(73,63)(74,64)(75,65)(76,66)(77,67)(78,68)(79,69)(80,70)(81,71)(82,72)(83,73)(84,74)(85,75)(86,76)(87,77)(88,77)(89,78)(90,79)(91,79)(92,80)(93,81)(94,82)(95,83)
+2	1	1	20.0	3855049.5	765981.0	4747257.5	+	455.85	10M1D5M1D8M1D5M1I1D16M2I3D1M1D6M1D1M1D19M1D6M1D27M1D8M1D14M1D10M1D3M1I1M1D1M1D4M1D2M1D13M1D1M1D1M2D3M1D3M1D1M1D21M1D9M1D4M4I2D4M1D5M1D5M1D2M1D2M4I11M1D6M1D3M1D3M1D5M1D1M3I1M1D12M1D7M1D9M12D11M1D3M1D6M1D2M1D1M1D3M1D2M1D4M1D7M1D11M1D6M1D1M3D1M2D9M2I1D9M1D1M1D2M12D5M1D6M1D1M1D10M1D1M1D2M1D20M1D6M1D4M1D4M1D2M1D4M1D1M1D2M1D3M	3879935.1	4753350.0	1	(96,1)(97,2)(98,3)(99,4)(100,5)(101,6)(102,7)(103,8)(104,9)(105,10)(106,11)(107,11)(108,12)(109,13)(110,14)(111,15)(112,16)(113,16)(114,17)(115,18)(116,19)(117,20)(118,21)(119,22)(120,23)(121,24)(122,24)(123,25)(124,26)(125,27)(126,28)(127,30)(128,30)(129,31)(130,32)(131,33)(132,34)(133,35)(134,36)(135,37)(136,38)(137,39)(138,40)(139,41)(140,42)(141,43)(142,44)(143,45)(146,48)(147,48)(148,49)(149,49)(150,50)(151,51)(152,52)(153,53)(154,54)(155,55)(156,55)(157,56)(158,56)(159,57)(160,58)(161,59)(162,60)(163,61)(164,62)(165,63)(166,64)(167,65)(168,66)(169,67)(170,68)(171,69)(172,70)(173,71)(174,72)(175,73)(176,74)(177,75)(178,75)(179,76)(180,77)(181,78)(182,79)(183,80)(184,81)(185,81)(186,82)(187,83)(188,84)(189,85)(190,86)(191,87)(192,88)(193,89)(194,90)(195,91)(196,92)(197,93)(198,94)(199,95)(200,96)(201,97)(202,98)(203,99)(204,100)(205,101)(206,102)(207,103)(208,104)(209,105)(210,106)(211,107)(212,108)(213,108)(214,109)(215,110)(216,111)(217,112)(218,113)(219,114)(220,115)(221,116)(222,116)(223,117)(224,118)(225,119)(226,120)(227,121)(228,122)(229,123)(230,124)(231,125)(232,126)(233,127)(234,128)(235,129)(236,130)(237,130)(238,131)(239,132)(240,133)(241,134)(242,135)(243,136)(244,137)(245,138)(246,139)(248,140)(249,141)(250,142)(251,144)(252,145)(253,145)(254,146)(255,146)(256,147)(257,148)(258,149)(259,150)(260,150)(261,151)(263,152)(264,153)(265,154)(266,155)(267,156)(268,157)(269,158)(270,159)(271,160)(272,161)(273,162)(274,163)(275,164)(276,165)(277,165)(278,166)(279,166)(280,167)(282,167)(283,168)(284,169)(285,170)(286,170)(287,171)(288,172)(290,173)(291,174)(292,174)(293,175)(294,176)(295,177)(296,178)(297,179)(298,180)(299,181)(300,182)(301,183)(302,184)(303,185)(304,186)(305,187)(306,188)(307,189)(308,190)(309,191)(310,192)(311,193)(312,194)(313,195)(314,195)(315,196)(316,197)(317,198)(318,199)(319,200)(320,201)(321,202)(322,203)(324,204)(325,205)(326,206)(327,207)(329,212)(330,212)(331,213)(332,214)(333,215)(334,216)(335,216)(336,217)(337,218)(338,219)(339,220)(340,221)(341,221)(342,222)(343,223)(344,224)(345,225)(346,226)(347,226)(348,227)(349,228)(350,228)(351,229)(352,234)(353,235)(354,236)(355,237)(356,238)(357,239)(358,240)(359,241)(360,242)(361,243)(362,244)(363,245)(364,245)(365,246)(366,247)(367,248)(368,249)(369,250)(371,251)(372,252)(373,253)(374,254)(375,254)(376,255)(377,256)(378,257)(379,257)(380,258)(381,259)(382,260)(383,261)(384,262)(385,262)(386,266)(387,267)(388,267)(389,268)(390,269)(391,270)(392,271)(393,272)(394,273)(395,274)(396,275)(397,276)(398,277)(399,278)(401,279)(402,280)(403,281)(404,282)(405,283)(406,284)(407,285)(408,286)(409,286)(410,287)(411,288)(412,289)(413,290)(414,291)(415,292)(416,293)(417,294)(430,295)(431,296)(432,297)(433,298)(434,299)(435,300)(436,301)(437,302)(438,303)(439,304)(440,305)(441,306)(442,306)(443,307)(444,308)(445,309)(446,309)(447,310)(448,311)(449,312)(450,313)(451,314)(452,315)(453,315)(454,316)(456,317)(457,318)(458,318)(459,319)(460,320)(462,321)(463,322)(465,323)(466,324)(467,325)(468,326)(469,327)(470,327)(471,328)(472,329)(473,330)(474,331)(475,332)(476,333)(477,334)(478,334)(479,335)(480,336)(481,337)(482,338)(483,339)(484,340)(485,341)(486,342)(487,343)(488,344)(489,345)(490,345)(491,346)(492,347)(493,348)(494,349)(495,350)(497,351)(499,352)(501,352)(502,353)(504,353)(505,354)(506,355)(507,356)(508,357)(509,358)(510,359)(511,360)(512,361)(513,364)(514,364)(515,365)(516,366)(517,367)(518,368)(519,369)(520,370)(521,371)(522,372)(523,373)(524,373)(525,374)(526,374)(527,375)(540,376)(541,377)(542,378)(543,379)(544,380)(545,381)(546,381)(547,382)(548,383)(549,384)(550,385)(551,386)(552,387)(553,387)(554,388)(555,388)(556,389)(557,390)(558,391)(559,392)(560,393)(561,394)(562,395)(563,396)(564,397)(565,398)(566,398)(567,399)(568,399)(569,400)(570,401)(571,401)(572,402)(573,403)(574,404)(575,405)(576,406)(577,407)(578,408)(579,409)(580,410)(581,411)(582,412)(583,413)(584,414)(585,415)(586,416)(587,417)(588,418)(589,419)(590,420)(592,421)(593,422)(594,423)(595,424)(596,425)(597,426)(599,427)(600,428)(601,429)(602,430)(603,431)(604,431)(605,432)(606,433)(607,434)(608,435)(609,435)(610,436)(611,437)(612,437)(613,438)(614,439)(615,440)(616,441)(617,441)(618,442)(619,442)(620,443)(622,444)(623,445)(624,446)