Mercurial > repos > iuc > biscot
changeset 0:ef4b5ce71745 draft default tip
planemo upload for repository https://github.com/bgruening/iuc/tree/master/tools/biscot commit cce7b9b092030d3bb23a706ca3bf2dece9c20b5f
| author | iuc |
|---|---|
| date | Fri, 06 Jan 2023 22:10:44 +0000 |
| parents | |
| children | |
| files | biscot.xml macros.xml test-data/bionano_key_file.txt test-data/query_cmap_file.cmap test-data/reference_cmap_file.cmap test-data/small.fasta.gz test-data/xml_configuration_file.xmap |
| diffstat | 7 files changed, 1344 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/biscot.xml Fri Jan 06 22:10:44 2023 +0000 @@ -0,0 +1,131 @@ +<tool id="biscot" name="BiSCoT" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="20.01"> + <description>Bionano scaffolding correction</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <command detect_errors="exit_code"><![CDATA[ + biscot + --cmap-ref '${cmap_ref}' + --cmap-1 '${cmap_1}' + --xmap-1 '${xmap_1}' + --key $key + --contigs $contigs + #if $secondary_map.cmap_2 + --cmap-2 '${cmap_2}' + --xmap-2 '${xmap_2}' + #end if + #if $xmap_2enz + --xmap-2enz '${xmap_2enz}' + #end if + ## $aggressive # disabled due to dependency conflicts + $only_confirmed_pos + ]]> </command> + <inputs> + <param argument="--cmap-ref" type="data" format="cmap" label="Reference CMAP file" help="This file describes the positions of enzymatic labelling sites on the reference genome" /> + <param argument="--cmap-1" type="data" format="cmap" label="Query CMAP file" help="This file describes the positions of enzymatic labelling sites on the contigs" /> + <param argument="--xmap-1" type="data" format="xml,txt" label="XML configuration file" help="This file describes the alignments of contig labels on the anchor" /> + <param argument="--contigs" type="data" format="fasta" label="Contigs file" help="Contigs file (FASTA) that was scaffolded by the Bionano scaffold" /> + <param argument="--key" type="data" format="tabular" label="Bionano key file" help="Bionano key file giving the correspondance between maps and contigs" /> + <section name="secondary_map" title="Secondary map"> + <param argument="--cmap-2" type="data" format="cmap" optional="true" label="Query CMAP file" help="This file describes the positions of enzymatic labelling sites on the contigs" /> + <param argument="--xmap-2" type="data" format="xml,txt" optional="true" label="XML configuration file" help="This file describes the alignments of contig labels on the anchor" /> + </section> + <param argument="--xmap-2enz" type="data" format="xml,txt" optional="true" label="Two enzymes XML configuration file" help="This argument is used to provide the final XMAP file containing + the mappings of labels of both enzymes. This argument is useful (and recommended) to ensure that no mapping has been missed inside one of the individual XMAP file" /> + <param argument="--aggressive" type="boolean" truevalue="--aggressive" falsevalue="" checked="false" + label="Enable BLAT phase" help=" enables the sequence similarity scaffolding. In a first phase, BiSCoT will search similarities between contigs based on label mappings. If this parameter is set, + BiSCoT will search for sequence similarity to close gaps created by the first step" /> + <param argument="--only-confirmed-pos" type="boolean" truevalue="--only-confirmed-pos" falsevalue="" checked="false" + label="Only confirmed positions" help="To be retained, an alignment position in --xmap-1 or --xmap-2 has to be present in --xmap-2enz" /> + <param name="log_file" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Generate log file" help="Log file can be helpful for debuggin purposes" /> + </inputs> + <outputs> + <data name="log" format="txt" from_work_dir="biscot/biscot.log" label="${tool.name} on ${on_string}: log file"> + <filter>log_file</filter> + </data> + <data name="fasta" format="fasta" from_work_dir="biscot/scaffolds.fasta" label="${tool.name} on ${on_string}: scaffolds (FASTA)"/> + <data name="agp" format="agp" from_work_dir="biscot/scaffolds.agp" label="${tool.name} on ${on_string}: scaffolds (AGP)"/> + </outputs> + <tests> + <test expect_num_outputs="3"> + <param name="cmap_ref" value="reference_cmap_file.cmap"/> + <param name="cmap_1" value="query_cmap_file.cmap"/> + <param name="xmap_1" value="xml_configuration_file.xmap"/> + <param name="contigs" value="small.fasta.gz"/> + <param name="key" value="bionano_key_file.txt"/> + <param name="log_file" value="true"/> + <output name="log"> + <assert_contents> + <has_text text="Final AGP and scaffolds file are in biscot/scaffolds.agp and biscot/scaffolds.fasta"/> + <has_text text="Converting agp file to fasta"/> + <has_n_lines n="13"/> + </assert_contents> + </output> + <output name="fasta"> + <assert_contents> + <has_text text="Super-Scaffold_1"/> + <has_text text="TCATCGGTTAAATCATCGCCCAGAAATACGGGCGT"/> + <has_size value="2097147"/> + </assert_contents> + </output> + <output name="agp"> + <assert_contents> + <has_text text="Super-Scaffold_1"/> + <has_text text="4753350"/> + <has_n_lines n="3"/> + </assert_contents> + </output> + </test> + <test expect_num_outputs="2"> + <param name="cmap_ref" value="reference_cmap_file.cmap"/> + <param name="cmap_1" value="query_cmap_file.cmap"/> + <param name="xmap_1" value="xml_configuration_file.xmap"/> + <param name="contigs" value="small.fasta.gz"/> + <param name="key" value="bionano_key_file.txt"/> + <param name="xmap_2enz" value="xml_configuration_file.xmap"/> + <param name="aggressive" value="true"/> + <param name="only_confirmed_pos" value="true"/> + <section name="secondary_map"> + <param name="cmap_2" value="query_cmap_file.cmap"/> + <param name="xmap_2" value="xml_configuration_file.xmap"/> + </section> + <output name="fasta"> + <assert_contents> + <has_text text="Super-Scaffold_1"/> + <has_text text="TCATCGGTTAAATCATCGCCCAGAAATACGGGCGT"/> + <has_size value="2097147"/> + </assert_contents> + </output> + <output name="agp"> + <assert_contents> + <has_text text="Super-Scaffold_1"/> + <has_text text="4753350"/> + <has_n_lines n="3"/> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + +.. class:: infomark + +**Purpose** + +BiSCoT is a tool that examinates data generated during a previous Bionano scaffolding and merges contigs separated by a 13-Ns gap if needed. BiSCoT also re-evaluates gap sizes and searches for an +alignment between two contigs if the gap size is inferior to 1,000 nucleotides. BiSCoT is therefore not a traditional scaffolder since it can only be used to improve an existing scaffolding, based +on an optical map. + +----- + +.. class:: infomark + +**Required files** + +During the scaffolding, the Bionano generates a visual representation of the hybrid scaffolds that is called an *anchor*. It also generates one *.key* file, which describes the mapping between map +identifiers and contig names, several CMAP files, which contain the position of enzymatic labelling sites on contig maps and on the anchor, and a XMAP file, that describes the alignment between a contig map +and an anchor. BiSCoT first loads the contigs into memory based on the key file. Then, the anchor CMAP file and contig CMAP files are loaded into memory. Finally, the XMAP file is parsed and loaded. + + ]]> </help> + <expand macro="citations"/> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Fri Jan 06 22:10:44 2023 +0000 @@ -0,0 +1,17 @@ +<macros> + <token name="@TOOL_VERSION@">2.3.3</token> + <token name="@VERSION_SUFFIX@">0</token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">biscot</requirement> + <requirement type="package" version="36">blat</requirement> + <requirement type="package" version="377">ucsc-pslsort</requirement> + <requirement type="package" version="377">ucsc-pslreps</requirement> + </requirements> + </xml> + <xml name="citations"> + <citations> + <citation type="doi">10.7717/peerj.10150</citation> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bionano_key_file.txt Fri Jan 06 22:10:44 2023 +0000 @@ -0,0 +1,3 @@ +CompntId CompntName CompntLength +1 Super_scaffold_3 4753350 +4 Super_scaffold_3 4753350
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/query_cmap_file.cmap Fri Jan 06 22:10:44 2023 +0000 @@ -0,0 +1,545 @@ +# hostname=6d61d934e61b +# $ cd /HybridScaffold; /RefAligner/amd2/RefAligner -o /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD -stdout -stderr -i /data/jwd03f/main/053/913/53913897/working/assignAlignType/assignAlignType_q.cmap -ref /data/jwd03f/main/053/913/53913897/working/align_final/step2.hybrid.cmap -maxmem 250 -maxthreads 24 -maxvirtmem 250 -RAmem 3 1 -res 2.9 -FP 0.6 -FN 0.06 -sf 0.20 -sd 0.0 -sr 0.01 -extend 1 -outlier 0.0001 -endoutlier 0.001 -PVendoutlier -deltaX 6 -deltaY 6 -xmapchim 12 -hashgen 5 7 2.4 1.5 0.05 5.0 1 1 4 -hash -hashdelta 26 10 46 -hashMultiMatch 30 10 -insertThreads 24 -nosplit 2 -biaswt 0 -T 1e-10 -S -1000 -indel -PVres 2 -rres 0.9 -MaxSE 0.5 -HSDrange 1.0 -outlierBC -xmapUnique 14 -AlignRes 2. -outlierExtend 6 24 -Kmax 6 -resEstimate -BestRef 1 -f -mres 0.9 +# CompileDir= /home/users/sqa01/RefAlignerBuild/branches/12432.12463rel/12432.12463rel CompileCmd=/opt/gcc-9.3.0/bin/g++ -B/opt/binutils-2.34 -fopenmp -Ofast -march=znver2 -mavx2 -mfpmath=sse -DUSE_PFLOAT=1 -DUSE_RFLOAT=1 -DUSE_SSE=1 -DUSE_MFLOAT=1 -DUSE_EPOW=2 -I/home/users8/tanantharaman/sleef-081120/build/include -I/opt/glibc-2.31/include -DUSE_STATIC -freciprocal-math -fno-signed-zeros -fno-trapping-math -fno-tree-vectorize -mtune=znver2 -fno-lto-odr-type-merging -DRELEASE=1 -std=gnu++98 -Wl,--dynamic-linker=/opt/glibc-2.31/lib/ld-linux-x86-64.so.2 -Wl,--rpath=/opt/glibc-2.31/lib -Wl,--rpath=/opt/gcc-9.3.0/lib64 -lsleefinline -lrt -lmvec -L/home/users8/tanantharaman/sleef-081120/build/lib -L/opt/glibc-2.31/lib -L/opt/gcc-9.3.0/lib64 -static -static-libstdc++ -static-libgcc -s SVNversion=12463 $Header: http://svn.bnm.local:81/svn/Informatics/RefAligner/branches/12432/RefAligner.cpp 12458 2021-10-24 00:56:45Z tanantharaman $ +# FLAGS: USE_SSE=1 USE_AVX=1 USE_MIC=0 USE_PFLOAT=1 USE_RFLOAT=1 USE_MFLOAT=1 USE_EPOW=2 DEBUG=1 VERB=1 +# CMAP File Version: 0.1 +# Label Channels: 1 +# Nickase Recognition Site 1: gctcttc +# Number of Consensus Maps: 2 +# StdDev & Coverage refer to the interval between current site and next site +#h CMapId ContigLength NumSites SiteID LabelChannel Position StdDev Coverage Occurrence +#f int float int int int float float float float +1 3879935.1 449 1 1 20.0 112.1 106.0 106.0 +1 3879935.1 449 2 1 1679.6 290.0 108.0 106.0 +1 3879935.1 449 3 1 45612.1 126.1 114.0 92.0 +1 3879935.1 449 4 1 49245.1 205.8 116.0 100.0 +1 3879935.1 449 5 1 68514.5 123.8 120.0 116.0 +1 3879935.1 449 6 1 71807.2 139.9 126.0 118.0 +1 3879935.1 449 7 1 77614.8 168.6 126.0 116.0 +1 3879935.1 449 8 1 88645.4 147.4 126.0 104.0 +1 3879935.1 449 9 1 95715.0 140.5 130.0 110.0 +1 3879935.1 449 10 1 101612.6 182.6 132.0 118.0 +1 3879935.1 449 11 1 115551.9 136.8 134.0 108.0 +1 3879935.1 449 12 1 120842.6 155.7 136.0 128.0 +1 3879935.1 449 13 1 129405.4 134.2 138.0 136.0 +1 3879935.1 449 14 1 134289.6 133.8 138.0 136.0 +1 3879935.1 449 15 1 139102.5 128.1 136.0 120.0 +1 3879935.1 449 16 1 143032.3 216.3 134.0 130.0 +1 3879935.1 449 17 1 164913.0 114.5 134.0 128.0 +1 3879935.1 449 18 1 166898.9 109.4 126.0 72.0 +1 3879935.1 449 19 1 168209.4 138.5 122.0 102.0 +1 3879935.1 449 20 1 173784.8 151.9 124.0 114.0 +1 3879935.1 449 21 1 181653.5 133.6 122.0 114.0 +1 3879935.1 449 22 1 186435.3 175.5 122.0 108.0 +1 3879935.1 449 23 1 198876.3 135.2 114.0 106.0 +1 3879935.1 449 24 1 203905.3 116.1 114.0 108.0 +1 3879935.1 449 25 1 206098.3 233.2 110.0 106.0 +1 3879935.1 449 26 1 232472.3 127.9 102.0 100.0 +1 3879935.1 449 27 1 236376.4 140.3 100.0 88.0 +1 3879935.1 449 28 1 242248.5 141.5 100.0 98.0 +1 3879935.1 449 29 1 248306.8 161.0 96.0 42.0 +1 3879935.1 449 30 1 257864.3 137.2 98.0 84.0 +1 3879935.1 449 31 1 263229.2 147.9 100.0 94.0 +1 3879935.1 449 32 1 270386.6 122.3 100.0 76.0 +1 3879935.1 449 33 1 273454.8 195.0 98.0 90.0 +1 3879935.1 449 34 1 290153.8 167.9 100.0 90.0 +1 3879935.1 449 35 1 301041.4 163.3 100.0 80.0 +1 3879935.1 449 36 1 311025.8 143.1 104.0 90.0 +1 3879935.1 449 37 1 317358.2 124.2 104.0 102.0 +1 3879935.1 449 38 1 320707.2 114.9 100.0 76.0 +1 3879935.1 449 39 1 322737.0 108.6 104.0 92.0 +1 3879935.1 449 40 1 323935.1 125.1 102.0 90.0 +1 3879935.1 449 41 1 327423.0 155.8 100.0 92.0 +1 3879935.1 449 42 1 336006.5 186.9 100.0 86.0 +1 3879935.1 449 43 1 350878.0 146.3 100.0 100.0 +1 3879935.1 449 44 1 357756.6 121.7 98.0 88.0 +1 3879935.1 449 45 1 360740.3 126.0 98.0 66.0 +1 3879935.1 449 46 1 364354.6 125.6 94.0 92.0 +1 3879935.1 449 47 1 367914.1 188.7 96.0 90.0 +1 3879935.1 449 48 1 383183.4 194.7 94.0 76.0 +1 3879935.1 449 49 1 399818.1 158.3 96.0 58.0 +1 3879935.1 449 50 1 408867.3 124.5 106.0 94.0 +1 3879935.1 449 51 1 412266.2 112.6 106.0 78.0 +1 3879935.1 449 52 1 413986.0 219.5 106.0 100.0 +1 3879935.1 449 53 1 436685.1 158.5 108.0 96.0 +1 3879935.1 449 54 1 445762.2 149.2 106.0 74.0 +1 3879935.1 449 55 1 453154.1 187.2 106.0 98.0 +1 3879935.1 449 56 1 468094.9 155.0 102.0 86.0 +1 3879935.1 449 57 1 476524.9 144.0 100.0 90.0 +1 3879935.1 449 58 1 483017.1 192.5 104.0 90.0 +1 3879935.1 449 59 1 499139.8 137.9 100.0 94.0 +1 3879935.1 449 60 1 504612.9 133.4 98.0 96.0 +1 3879935.1 449 61 1 509361.6 135.8 98.0 82.0 +1 3879935.1 449 62 1 514489.5 137.8 106.0 96.0 +1 3879935.1 449 63 1 519951.3 160.6 106.0 88.0 +1 3879935.1 449 64 1 529428.8 209.4 106.0 96.0 +1 3879935.1 449 65 1 549571.1 126.9 100.0 88.0 +1 3879935.1 449 66 1 553317.9 118.7 98.0 94.0 +1 3879935.1 449 67 1 555874.9 139.2 98.0 94.0 +1 3879935.1 449 68 1 561559.0 158.7 98.0 86.0 +1 3879935.1 449 69 1 570670.7 178.2 96.0 84.0 +1 3879935.1 449 70 1 583674.0 123.7 98.0 78.0 +1 3879935.1 449 71 1 586943.9 164.9 100.0 86.0 +1 3879935.1 449 72 1 597237.8 120.0 98.0 80.0 +1 3879935.1 449 73 1 599975.1 113.6 100.0 70.0 +1 3879935.1 449 74 1 601839.9 153.9 104.0 98.0 +1 3879935.1 449 75 1 610073.9 127.1 102.0 98.0 +1 3879935.1 449 76 1 613858.2 124.8 100.0 100.0 +1 3879935.1 449 77 1 617293.2 136.3 96.0 96.0 +1 3879935.1 449 78 1 622503.4 120.1 96.0 94.0 +1 3879935.1 449 79 1 625262.3 127.3 98.0 82.0 +1 3879935.1 449 80 1 629074.4 138.1 96.0 84.0 +1 3879935.1 449 81 1 634575.7 125.7 96.0 88.0 +1 3879935.1 449 82 1 638144.1 116.9 88.0 52.0 +1 3879935.1 449 83 1 640448.4 196.4 88.0 82.0 +1 3879935.1 449 84 1 657466.4 183.2 86.0 76.0 +1 3879935.1 449 85 1 671526.4 251.2 88.0 72.0 +1 3879935.1 449 86 1 703054.8 177.5 96.0 74.0 +1 3879935.1 449 87 1 715905.6 113.8 100.0 84.0 +1 3879935.1 449 88 1 717785.9 113.8 98.0 86.0 +1 3879935.1 449 89 1 719668.5 121.7 98.0 84.0 +1 3879935.1 449 90 1 722650.2 119.5 100.0 96.0 +1 3879935.1 449 91 1 725320.7 112.5 100.0 84.0 +1 3879935.1 449 92 1 727030.6 158.8 100.0 90.0 +1 3879935.1 449 93 1 736175.5 135.4 96.0 82.0 +1 3879935.1 449 94 1 741250.4 132.1 98.0 98.0 +1 3879935.1 449 95 1 745801.7 118.3 102.0 102.0 +1 3879935.1 449 96 1 748312.3 132.5 102.0 102.0 +1 3879935.1 449 97 1 752921.8 202.6 98.0 92.0 +1 3879935.1 449 98 1 771409.1 117.6 94.0 78.0 +1 3879935.1 449 99 1 773816.7 112.9 96.0 92.0 +1 3879935.1 449 100 1 775581.2 171.1 94.0 84.0 +1 3879935.1 449 101 1 787110.0 159.7 94.0 82.0 +1 3879935.1 449 102 1 796413.6 175.6 96.0 86.0 +1 3879935.1 449 103 1 808878.4 113.6 90.0 70.0 +1 3879935.1 449 104 1 810732.0 128.4 94.0 82.0 +1 3879935.1 449 105 1 814714.3 139.2 96.0 92.0 +1 3879935.1 449 106 1 820400.6 145.9 96.0 80.0 +1 3879935.1 449 107 1 827210.0 113.6 96.0 72.0 +1 3879935.1 449 108 1 829065.0 192.3 98.0 88.0 +1 3879935.1 449 109 1 845143.9 158.3 94.0 86.0 +1 3879935.1 449 110 1 854180.3 125.8 96.0 92.0 +1 3879935.1 449 111 1 857760.5 124.8 98.0 96.0 +1 3879935.1 449 112 1 861203.1 186.5 98.0 68.0 +1 3879935.1 449 113 1 875988.1 145.3 94.0 74.0 +1 3879935.1 449 114 1 882704.7 184.4 92.0 84.0 +1 3879935.1 449 115 1 897025.4 228.6 90.0 76.0 +1 3879935.1 449 116 1 922133.6 169.4 94.0 72.0 +1 3879935.1 449 117 1 933328.9 186.2 98.0 84.0 +1 3879935.1 449 118 1 948057.1 152.5 96.0 90.0 +1 3879935.1 449 119 1 956040.9 165.5 98.0 68.0 +1 3879935.1 449 120 1 966468.8 152.5 98.0 88.0 +1 3879935.1 449 121 1 974437.4 124.3 100.0 94.0 +1 3879935.1 449 122 1 977799.9 143.3 100.0 86.0 +1 3879935.1 449 123 1 984174.3 237.3 98.0 90.0 +1 3879935.1 449 124 1 1011693.3 145.4 96.0 84.0 +1 3879935.1 449 125 1 1018427.8 166.9 96.0 84.0 +1 3879935.1 449 126 1 1029114.7 195.5 94.0 84.0 +1 3879935.1 449 127 1 1045925.8 110.8 92.0 76.0 +1 3879935.1 449 128 1 1047410.3 145.8 98.0 96.0 +1 3879935.1 449 129 1 1054200.9 155.9 98.0 92.0 +1 3879935.1 449 130 1 1062800.1 143.2 100.0 94.0 +1 3879935.1 449 131 1 1069160.3 146.1 106.0 104.0 +1 3879935.1 449 132 1 1076002.7 183.5 96.0 86.0 +1 3879935.1 449 133 1 1090129.4 236.2 92.0 82.0 +1 3879935.1 449 134 1 1117329.2 193.4 96.0 84.0 +1 3879935.1 449 135 1 1133672.7 176.1 102.0 88.0 +1 3879935.1 449 136 1 1146235.6 147.8 98.0 82.0 +1 3879935.1 449 137 1 1153372.0 147.1 100.0 86.0 +1 3879935.1 449 138 1 1160391.5 138.3 100.0 96.0 +1 3879935.1 449 139 1 1165936.0 125.2 102.0 88.0 +1 3879935.1 449 140 1 1169427.5 115.8 98.0 92.0 +1 3879935.1 449 141 1 1171582.5 109.2 98.0 54.0 +1 3879935.1 449 142 1 1172867.8 161.2 98.0 64.0 +1 3879935.1 449 143 1 1182460.8 118.6 100.0 62.0 +1 3879935.1 449 144 1 1185006.6 227.2 100.0 96.0 +1 3879935.1 449 145 1 1209739.7 133.2 98.0 98.0 +1 3879935.1 449 146 1 1214459.4 119.9 102.0 102.0 +1 3879935.1 449 147 1 1217191.9 118.8 104.0 80.0 +1 3879935.1 449 148 1 1219769.6 177.1 104.0 80.0 +1 3879935.1 449 149 1 1232540.7 137.0 108.0 92.0 +1 3879935.1 449 150 1 1237867.1 120.9 108.0 108.0 +1 3879935.1 449 151 1 1240733.4 122.5 110.0 100.0 +1 3879935.1 449 152 1 1243831.8 210.2 112.0 106.0 +1 3879935.1 449 153 1 1264172.5 132.6 108.0 102.0 +1 3879935.1 449 154 1 1268792.4 148.3 104.0 98.0 +1 3879935.1 449 155 1 1276019.4 121.3 104.0 104.0 +1 3879935.1 449 156 1 1278946.0 184.4 106.0 100.0 +1 3879935.1 449 157 1 1293266.5 149.2 106.0 86.0 +1 3879935.1 449 158 1 1300659.6 121.6 104.0 92.0 +1 3879935.1 449 159 1 1303631.2 207.0 104.0 98.0 +1 3879935.1 449 160 1 1323182.7 191.8 98.0 92.0 +1 3879935.1 449 161 1 1339154.6 150.0 108.0 90.0 +1 3879935.1 449 162 1 1346677.8 141.3 112.0 108.0 +1 3879935.1 449 163 1 1352713.8 199.5 112.0 102.0 +1 3879935.1 449 164 1 1370470.1 119.6 112.0 106.0 +1 3879935.1 449 165 1 1373161.0 134.6 112.0 110.0 +1 3879935.1 449 166 1 1378095.5 198.5 108.0 102.0 +1 3879935.1 449 167 1 1395612.0 134.0 100.0 90.0 +1 3879935.1 449 168 1 1400455.3 152.3 100.0 86.0 +1 3879935.1 449 169 1 1408397.6 130.5 104.0 88.0 +1 3879935.1 449 170 1 1412699.9 187.1 106.0 98.0 +1 3879935.1 449 171 1 1427627.4 160.7 102.0 82.0 +1 3879935.1 449 172 1 1437118.2 187.6 104.0 92.0 +1 3879935.1 449 173 1 1452140.3 136.5 106.0 96.0 +1 3879935.1 449 174 1 1457387.1 164.8 102.0 84.0 +1 3879935.1 449 175 1 1467668.9 159.1 98.0 56.0 +1 3879935.1 449 176 1 1476864.2 111.0 98.0 84.0 +1 3879935.1 449 177 1 1478375.0 111.4 100.0 88.0 +1 3879935.1 449 178 1 1479936.2 132.4 100.0 62.0 +1 3879935.1 449 179 1 1484524.1 126.6 102.0 100.0 +1 3879935.1 449 180 1 1488221.8 266.0 102.0 94.0 +1 3879935.1 449 181 1 1524260.6 166.0 98.0 72.0 +1 3879935.1 449 182 1 1534783.9 199.9 94.0 90.0 +1 3879935.1 449 183 1 1552635.8 175.6 100.0 80.0 +1 3879935.1 449 184 1 1565084.2 117.7 108.0 104.0 +1 3879935.1 449 185 1 1567504.1 125.0 108.0 104.0 +1 3879935.1 449 186 1 1570964.8 131.3 112.0 112.0 +1 3879935.1 449 187 1 1575391.5 115.3 112.0 102.0 +1 3879935.1 449 188 1 1577482.7 154.5 112.0 102.0 +1 3879935.1 449 189 1 1585821.5 117.0 114.0 104.0 +1 3879935.1 449 190 1 1588145.8 219.8 114.0 106.0 +1 3879935.1 449 191 1 1610935.0 148.3 106.0 98.0 +1 3879935.1 449 192 1 1618169.1 197.5 108.0 104.0 +1 3879935.1 449 193 1 1635447.0 202.6 110.0 106.0 +1 3879935.1 449 194 1 1653941.6 122.6 108.0 100.0 +1 3879935.1 449 195 1 1657061.7 132.4 114.0 114.0 +1 3879935.1 449 196 1 1661653.1 115.6 116.0 106.0 +1 3879935.1 449 197 1 1663789.9 189.1 116.0 112.0 +1 3879935.1 449 198 1 1679151.9 122.5 118.0 114.0 +1 3879935.1 449 199 1 1682248.8 139.8 116.0 108.0 +1 3879935.1 449 200 1 1688031.2 120.5 112.0 112.0 +1 3879935.1 449 201 1 1690838.8 146.8 110.0 110.0 +1 3879935.1 449 202 1 1697808.6 136.7 110.0 104.0 +1 3879935.1 449 203 1 1703082.9 143.4 110.0 108.0 +1 3879935.1 449 204 1 1709475.1 207.6 104.0 96.0 +1 3879935.1 449 205 1 1729166.5 217.0 96.0 84.0 +1 3879935.1 449 206 1 1751232.4 252.6 92.0 86.0 +1 3879935.1 449 207 1 1783161.2 217.8 90.0 80.0 +1 3879935.1 449 208 1 1805426.2 243.9 92.0 80.0 +1 3879935.1 449 209 1 1834804.4 153.2 92.0 86.0 +1 3879935.1 449 210 1 1842900.5 140.6 96.0 86.0 +1 3879935.1 449 211 1 1848813.1 107.3 96.0 74.0 +1 3879935.1 449 212 1 1849844.6 165.7 98.0 76.0 +1 3879935.1 449 213 1 1860298.3 159.8 94.0 72.0 +1 3879935.1 449 214 1 1869625.7 142.2 102.0 96.0 +1 3879935.1 449 215 1 1875806.4 141.1 104.0 102.0 +1 3879935.1 449 216 1 1881813.8 130.9 102.0 100.0 +1 3879935.1 449 217 1 1886174.9 157.3 100.0 72.0 +1 3879935.1 449 218 1 1895038.9 128.2 102.0 84.0 +1 3879935.1 449 219 1 1898991.3 121.6 102.0 86.0 +1 3879935.1 449 220 1 1901956.6 120.1 102.0 102.0 +1 3879935.1 449 221 1 1904710.5 134.8 100.0 94.0 +1 3879935.1 449 222 1 1909677.3 134.9 100.0 96.0 +1 3879935.1 449 223 1 1914672.1 154.3 102.0 88.0 +1 3879935.1 449 224 1 1922984.0 152.9 104.0 94.0 +1 3879935.1 449 225 1 1931038.3 139.7 104.0 96.0 +1 3879935.1 449 226 1 1936811.8 146.8 102.0 92.0 +1 3879935.1 449 227 1 1943781.6 150.0 102.0 94.0 +1 3879935.1 449 228 1 1951316.2 111.8 104.0 96.0 +1 3879935.1 449 229 1 1952936.5 153.3 100.0 96.0 +1 3879935.1 449 230 1 1961062.6 154.9 104.0 96.0 +1 3879935.1 449 231 1 1969483.7 126.2 104.0 102.0 +1 3879935.1 449 232 1 1973130.1 120.2 104.0 104.0 +1 3879935.1 449 233 1 1975905.8 138.1 102.0 98.0 +1 3879935.1 449 234 1 1981406.8 257.8 102.0 96.0 +1 3879935.1 449 235 1 2014909.9 169.1 106.0 92.0 +1 3879935.1 449 236 1 2026049.9 154.4 110.0 80.0 +1 3879935.1 449 237 1 2034375.7 181.1 112.0 104.0 +1 3879935.1 449 238 1 2047982.8 140.9 110.0 92.0 +1 3879935.1 449 239 1 2053944.0 115.9 108.0 98.0 +1 3879935.1 449 240 1 2056118.2 117.5 108.0 106.0 +1 3879935.1 449 241 1 2058516.6 189.5 106.0 88.0 +1 3879935.1 449 242 1 2073960.7 150.9 104.0 100.0 +1 3879935.1 449 243 1 2081659.1 188.1 106.0 88.0 +1 3879935.1 449 244 1 2096802.1 118.5 104.0 68.0 +1 3879935.1 449 245 1 2099332.4 182.2 104.0 102.0 +1 3879935.1 449 246 1 2113174.7 154.8 100.0 86.0 +1 3879935.1 449 247 1 2121562.2 119.8 100.0 94.0 +1 3879935.1 449 248 1 2124279.1 149.0 104.0 84.0 +1 3879935.1 449 249 1 2131625.1 107.3 98.0 76.0 +1 3879935.1 449 250 1 2132658.8 180.1 98.0 74.0 +1 3879935.1 449 251 1 2146057.6 113.5 98.0 84.0 +1 3879935.1 449 252 1 2147908.2 140.6 108.0 104.0 +1 3879935.1 449 253 1 2153825.7 126.3 104.0 100.0 +1 3879935.1 449 254 1 2157486.7 156.4 106.0 96.0 +1 3879935.1 449 255 1 2166174.3 138.8 104.0 104.0 +1 3879935.1 449 256 1 2171796.8 135.5 102.0 98.0 +1 3879935.1 449 257 1 2176883.1 152.3 100.0 94.0 +1 3879935.1 449 258 1 2184819.7 165.6 100.0 92.0 +1 3879935.1 449 259 1 2195268.3 161.4 100.0 84.0 +1 3879935.1 449 260 1 2204894.8 158.1 100.0 92.0 +1 3879935.1 449 261 1 2213905.0 143.0 102.0 98.0 +1 3879935.1 449 262 1 2220216.9 184.7 102.0 94.0 +1 3879935.1 449 263 1 2234620.2 150.0 102.0 92.0 +1 3879935.1 449 264 1 2242155.0 198.5 106.0 94.0 +1 3879935.1 449 265 1 2259682.1 145.3 110.0 102.0 +1 3879935.1 449 266 1 2266392.4 118.7 112.0 102.0 +1 3879935.1 449 267 1 2268953.1 177.6 108.0 90.0 +1 3879935.1 449 268 1 2281832.6 121.6 110.0 96.0 +1 3879935.1 449 269 1 2284801.6 132.3 112.0 110.0 +1 3879935.1 449 270 1 2289383.9 197.0 114.0 112.0 +1 3879935.1 449 271 1 2306550.6 174.3 112.0 94.0 +1 3879935.1 449 272 1 2318746.4 152.4 112.0 74.0 +1 3879935.1 449 273 1 2326712.6 112.3 112.0 102.0 +1 3879935.1 449 274 1 2328397.2 195.3 114.0 98.0 +1 3879935.1 449 275 1 2345167.6 152.7 112.0 100.0 +1 3879935.1 449 276 1 2353177.6 154.6 110.0 84.0 +1 3879935.1 449 277 1 2361537.9 111.9 108.0 100.0 +1 3879935.1 449 278 1 2363176.7 131.6 110.0 104.0 +1 3879935.1 449 279 1 2367647.0 107.2 108.0 84.0 +1 3879935.1 449 280 1 2368677.9 122.4 108.0 82.0 +1 3879935.1 449 281 1 2371762.9 162.0 104.0 98.0 +1 3879935.1 449 282 1 2381508.2 127.4 98.0 76.0 +1 3879935.1 449 283 1 2385330.6 118.3 102.0 100.0 +1 3879935.1 449 284 1 2387828.9 122.5 102.0 96.0 +1 3879935.1 449 285 1 2390929.1 140.5 102.0 90.0 +1 3879935.1 449 286 1 2396830.8 162.9 102.0 100.0 +1 3879935.1 449 287 1 2406743.8 182.3 96.0 78.0 +1 3879935.1 449 288 1 2420624.4 112.2 92.0 84.0 +1 3879935.1 449 289 1 2422292.8 257.7 90.0 84.0 +1 3879935.1 449 290 1 2455764.6 177.0 90.0 68.0 +1 3879935.1 449 291 1 2468504.8 168.6 96.0 76.0 +1 3879935.1 449 292 1 2479528.1 120.7 102.0 94.0 +1 3879935.1 449 293 1 2482369.5 280.5 100.0 96.0 +1 3879935.1 449 294 1 2523114.4 143.2 98.0 86.0 +1 3879935.1 449 295 1 2529473.1 198.7 100.0 98.0 +1 3879935.1 449 296 1 2547038.9 108.5 102.0 66.0 +1 3879935.1 449 297 1 2548224.3 134.6 106.0 96.0 +1 3879935.1 449 298 1 2553166.6 184.2 108.0 108.0 +1 3879935.1 449 299 1 2567454.3 148.5 106.0 104.0 +1 3879935.1 449 300 1 2574724.2 250.2 96.0 84.0 +1 3879935.1 449 301 1 2605964.5 236.2 96.0 84.0 +1 3879935.1 449 302 1 2633170.3 124.0 94.0 92.0 +1 3879935.1 449 303 1 2636488.3 117.5 94.0 88.0 +1 3879935.1 449 304 1 2638885.8 113.0 94.0 60.0 +1 3879935.1 449 305 1 2640666.9 152.2 94.0 82.0 +1 3879935.1 449 306 1 2648588.5 129.6 96.0 96.0 +1 3879935.1 449 307 1 2652750.5 180.1 92.0 86.0 +1 3879935.1 449 308 1 2666149.1 141.8 104.0 104.0 +1 3879935.1 449 309 1 2672267.4 110.9 100.0 86.0 +1 3879935.1 449 310 1 2673773.5 115.0 102.0 92.0 +1 3879935.1 449 311 1 2675828.6 195.3 104.0 100.0 +1 3879935.1 449 312 1 2692596.6 134.3 100.0 88.0 +1 3879935.1 449 313 1 2697488.1 126.7 98.0 92.0 +1 3879935.1 449 314 1 2701204.5 125.7 98.0 86.0 +1 3879935.1 449 315 1 2704777.8 146.1 96.0 92.0 +1 3879935.1 449 316 1 2711632.9 148.4 94.0 90.0 +1 3879935.1 449 317 1 2718887.0 114.5 92.0 70.0 +1 3879935.1 449 318 1 2720874.0 169.1 92.0 62.0 +1 3879935.1 449 319 1 2731996.4 116.7 86.0 68.0 +1 3879935.1 449 320 1 2734283.9 137.3 86.0 64.0 +1 3879935.1 449 321 1 2739657.9 112.7 90.0 84.0 +1 3879935.1 449 322 1 2741401.5 223.4 92.0 82.0 +1 3879935.1 449 323 1 2765134.8 110.1 84.0 76.0 +1 3879935.1 449 324 1 2766535.5 119.0 86.0 82.0 +1 3879935.1 449 325 1 2769134.4 167.4 88.0 56.0 +1 3879935.1 449 326 1 2779918.7 114.8 94.0 78.0 +1 3879935.1 449 327 1 2781934.7 219.2 92.0 66.0 +1 3879935.1 449 328 1 2804553.5 130.3 96.0 92.0 +1 3879935.1 449 329 1 2808825.9 125.2 96.0 80.0 +1 3879935.1 449 330 1 2812317.0 156.2 96.0 86.0 +1 3879935.1 449 331 1 2820968.5 113.5 96.0 92.0 +1 3879935.1 449 332 1 2822810.4 122.6 96.0 56.0 +1 3879935.1 449 333 1 2825924.7 271.8 96.0 92.0 +1 3879935.1 449 334 1 2863805.6 109.8 100.0 96.0 +1 3879935.1 449 335 1 2865163.2 192.5 110.0 94.0 +1 3879935.1 449 336 1 2881291.9 122.0 100.0 88.0 +1 3879935.1 449 337 1 2884324.5 150.0 100.0 96.0 +1 3879935.1 449 338 1 2891856.4 111.4 102.0 98.0 +1 3879935.1 449 339 1 2893423.5 143.8 98.0 94.0 +1 3879935.1 449 340 1 2899869.4 144.1 96.0 94.0 +1 3879935.1 449 341 1 2906379.6 117.1 94.0 88.0 +1 3879935.1 449 342 1 2908718.4 122.4 96.0 80.0 +1 3879935.1 449 343 1 2911806.2 172.8 96.0 68.0 +1 3879935.1 449 344 1 2923684.8 130.8 94.0 76.0 +1 3879935.1 449 345 1 2928030.8 239.1 98.0 90.0 +1 3879935.1 449 346 1 2956055.5 148.8 104.0 98.0 +1 3879935.1 449 347 1 2963382.4 131.8 104.0 102.0 +1 3879935.1 449 348 1 2967886.6 178.8 104.0 100.0 +1 3879935.1 449 349 1 2981013.9 112.5 104.0 54.0 +1 3879935.1 449 350 1 2982723.1 226.2 104.0 100.0 +1 3879935.1 449 351 1 3007195.7 207.5 104.0 92.0 +1 3879935.1 449 352 1 3026882.0 125.9 104.0 98.0 +1 3879935.1 449 353 1 3030483.0 126.0 104.0 90.0 +1 3879935.1 449 354 1 3034102.1 146.3 102.0 94.0 +1 3879935.1 449 355 1 3040989.4 153.5 98.0 72.0 +1 3879935.1 449 356 1 3049155.8 108.1 100.0 72.0 +1 3879935.1 449 357 1 3050296.4 126.4 104.0 96.0 +1 3879935.1 449 358 1 3053965.5 127.0 106.0 96.0 +1 3879935.1 449 359 1 3057730.6 173.5 106.0 98.0 +1 3879935.1 449 360 1 3069743.5 120.3 108.0 74.0 +1 3879935.1 449 361 1 3072530.0 180.0 108.0 100.0 +1 3879935.1 449 362 1 3085919.8 135.8 106.0 78.0 +1 3879935.1 449 363 1 3091044.9 200.3 108.0 102.0 +1 3879935.1 449 364 1 3108983.1 127.3 110.0 108.0 +1 3879935.1 449 365 1 3112791.2 122.2 110.0 110.0 +1 3879935.1 449 366 1 3115847.2 137.0 106.0 102.0 +1 3879935.1 449 367 1 3121172.8 176.7 106.0 86.0 +1 3879935.1 449 368 1 3133865.8 149.3 104.0 88.0 +1 3879935.1 449 369 1 3141273.4 146.5 98.0 92.0 +1 3879935.1 449 370 1 3148185.0 126.2 94.0 86.0 +1 3879935.1 449 371 1 3151833.8 158.1 98.0 84.0 +1 3879935.1 449 372 1 3160837.9 158.1 104.0 86.0 +1 3879935.1 449 373 1 3169848.7 147.8 102.0 74.0 +1 3879935.1 449 374 1 3176991.9 118.0 100.0 92.0 +1 3879935.1 449 375 1 3179454.4 166.8 100.0 74.0 +1 3879935.1 449 376 1 3190125.8 232.8 98.0 78.0 +1 3879935.1 449 377 1 3216382.8 114.6 98.0 88.0 +1 3879935.1 449 378 1 3218381.4 165.6 102.0 86.0 +1 3879935.1 449 379 1 3228823.5 124.1 102.0 84.0 +1 3879935.1 449 380 1 3232164.9 160.6 100.0 78.0 +1 3879935.1 449 381 1 3241646.8 129.7 92.0 84.0 +1 3879935.1 449 382 1 3245818.3 109.7 92.0 78.0 +1 3879935.1 449 383 1 3247158.0 162.9 90.0 62.0 +1 3879935.1 449 384 1 3257081.2 114.2 96.0 78.0 +1 3879935.1 449 385 1 3259024.8 152.8 96.0 90.0 +1 3879935.1 449 386 1 3267051.2 180.2 98.0 88.0 +1 3879935.1 449 387 1 3280475.8 144.7 98.0 90.0 +1 3879935.1 449 388 1 3287079.9 164.1 96.0 92.0 +1 3879935.1 449 389 1 3297221.3 189.9 96.0 82.0 +1 3879935.1 449 390 1 3312770.8 148.7 102.0 98.0 +1 3879935.1 449 391 1 3320073.7 135.3 102.0 94.0 +1 3879935.1 449 392 1 3325131.9 122.2 102.0 100.0 +1 3879935.1 449 393 1 3328188.5 182.0 102.0 84.0 +1 3879935.1 449 394 1 3341998.9 122.1 102.0 98.0 +1 3879935.1 449 395 1 3345041.5 120.8 104.0 98.0 +1 3879935.1 449 396 1 3347892.0 154.6 104.0 92.0 +1 3879935.1 449 397 1 3356248.2 156.1 98.0 76.0 +1 3879935.1 449 398 1 3364885.2 113.8 100.0 70.0 +1 3879935.1 449 399 1 3366771.3 231.8 102.0 90.0 +1 3879935.1 449 400 1 3392767.6 228.2 96.0 72.0 +1 3879935.1 449 401 1 3417769.3 269.4 96.0 86.0 +1 3879935.1 449 402 1 3454889.2 123.9 100.0 86.0 +1 3879935.1 449 403 1 3458195.0 248.3 100.0 92.0 +1 3879935.1 449 404 1 3488859.8 166.5 96.0 76.0 +1 3879935.1 449 405 1 3499477.6 131.6 94.0 64.0 +1 3879935.1 449 406 1 3503940.7 121.6 96.0 94.0 +1 3879935.1 449 407 1 3506912.7 239.2 94.0 82.0 +1 3879935.1 449 408 1 3534964.1 129.4 102.0 100.0 +1 3879935.1 449 409 1 3539096.1 133.7 104.0 100.0 +1 3879935.1 449 410 1 3543893.3 142.1 102.0 100.0 +1 3879935.1 449 411 1 3550063.7 140.0 102.0 102.0 +1 3879935.1 449 412 1 3555878.3 153.5 100.0 94.0 +1 3879935.1 449 413 1 3564043.5 126.4 100.0 100.0 +1 3879935.1 449 414 1 3567713.9 145.9 102.0 90.0 +1 3879935.1 449 415 1 3574523.3 134.4 100.0 90.0 +1 3879935.1 449 416 1 3579439.1 147.8 100.0 100.0 +1 3879935.1 449 417 1 3586588.1 205.7 102.0 98.0 +1 3879935.1 449 418 1 3605819.6 127.5 102.0 94.0 +1 3879935.1 449 419 1 3609663.1 119.5 98.0 94.0 +1 3879935.1 449 420 1 3612330.9 182.5 102.0 96.0 +1 3879935.1 449 421 1 3626256.9 184.0 100.0 94.0 +1 3879935.1 449 422 1 3640495.5 163.1 98.0 90.0 +1 3879935.1 449 423 1 3650450.5 231.5 98.0 72.0 +1 3879935.1 449 424 1 3676345.5 118.4 102.0 98.0 +1 3879935.1 449 425 1 3678862.2 152.4 104.0 100.0 +1 3879935.1 449 426 1 3686814.4 182.6 104.0 96.0 +1 3879935.1 449 427 1 3700754.7 173.6 110.0 76.0 +1 3879935.1 449 428 1 3712795.2 240.9 112.0 66.0 +1 3879935.1 449 429 1 3741315.1 212.1 112.0 106.0 +1 3879935.1 449 430 1 3762130.7 130.4 114.0 110.0 +1 3879935.1 449 431 1 3766416.6 150.3 114.0 106.0 +1 3879935.1 449 432 1 3774008.3 117.7 114.0 108.0 +1 3879935.1 449 433 1 3776432.9 157.2 114.0 108.0 +1 3879935.1 449 434 1 3785270.1 125.0 114.0 112.0 +1 3879935.1 449 435 1 3788741.2 120.6 114.0 112.0 +1 3879935.1 449 436 1 3791576.1 191.9 112.0 104.0 +1 3879935.1 449 437 1 3807566.1 118.7 110.0 98.0 +1 3879935.1 449 438 1 3810121.5 120.0 104.0 104.0 +1 3879935.1 449 439 1 3812864.3 124.1 104.0 74.0 +1 3879935.1 449 440 1 3816193.8 196.5 102.0 100.0 +1 3879935.1 449 441 1 3833238.6 114.8 100.0 98.0 +1 3879935.1 449 442 1 3835254.9 128.3 96.0 94.0 +1 3879935.1 449 443 1 3839216.0 157.0 94.0 92.0 +1 3879935.1 449 444 1 3848008.2 125.5 74.0 74.0 +1 3879935.1 449 445 1 3851556.2 125.2 72.0 72.0 +1 3879935.1 449 446 1 3855049.5 162.6 62.0 50.0 +1 3879935.1 449 447 1 3864915.8 178.8 62.0 44.0 +1 3879935.1 449 448 1 3878051.7 113.6 58.0 52.0 +1 3879935.1 449 449 1 3879911.1 0.0 50.0 50.0 +1 3879935.1 449 450 0 3879935.1 0.0 0.0 0.0 +4 715091.0 83 1 1 20.0 198.3 78.0 78.0 +4 715091.0 83 2 1 17502.1 202.6 92.0 88.0 +4 715091.0 83 3 1 35986.3 116.3 94.0 74.0 +4 715091.0 83 4 1 38211.6 264.3 96.0 90.0 +4 715091.0 83 5 1 73713.3 128.4 102.0 88.0 +4 715091.0 83 6 1 77683.6 152.9 102.0 88.0 +4 715091.0 83 7 1 85740.1 125.1 102.0 94.0 +4 715091.0 83 8 1 89217.8 149.3 106.0 98.0 +4 715091.0 83 9 1 96619.7 171.3 108.0 80.0 +4 715091.0 83 10 1 108194.6 190.1 112.0 92.0 +4 715091.0 83 11 1 123784.8 166.4 116.0 102.0 +4 715091.0 83 12 1 134383.7 150.6 118.0 94.0 +4 715091.0 83 13 1 142022.1 232.2 114.0 110.0 +4 715091.0 83 14 1 168118.5 125.0 112.0 110.0 +4 715091.0 83 15 1 171583.7 150.1 106.0 104.0 +4 715091.0 83 16 1 179127.4 200.8 104.0 96.0 +4 715091.0 83 17 1 197184.6 123.5 96.0 96.0 +4 715091.0 83 18 1 200433.3 242.1 94.0 86.0 +4 715091.0 83 19 1 229300.9 172.7 80.0 64.0 +4 715091.0 83 20 1 241168.2 215.0 80.0 40.0 +4 715091.0 83 21 1 262713.1 236.7 86.0 68.0 +4 715091.0 83 22 1 290046.7 155.9 82.0 78.0 +4 715091.0 83 23 1 298634.5 107.0 84.0 48.0 +4 715091.0 83 24 1 299637.7 129.2 86.0 78.0 +4 715091.0 83 25 1 303739.2 132.2 80.0 76.0 +4 715091.0 83 26 1 308300.7 128.9 86.0 66.0 +4 715091.0 83 27 1 312359.2 211.5 88.0 84.0 +4 715091.0 83 28 1 333018.4 114.7 94.0 80.0 +4 715091.0 83 29 1 335029.9 109.4 94.0 84.0 +4 715091.0 83 30 1 336330.1 145.5 98.0 80.0 +4 715091.0 83 31 1 343074.6 121.8 100.0 94.0 +4 715091.0 83 32 1 346078.6 192.6 100.0 96.0 +4 715091.0 83 33 1 362235.1 162.5 98.0 84.0 +4 715091.0 83 34 1 372068.1 131.4 98.0 98.0 +4 715091.0 83 35 1 376510.8 127.5 100.0 98.0 +4 715091.0 83 36 1 380352.2 131.3 98.0 86.0 +4 715091.0 83 37 1 384775.5 130.7 96.0 88.0 +4 715091.0 83 38 1 389097.1 124.6 94.0 90.0 +4 715091.0 83 39 1 392499.7 145.1 94.0 88.0 +4 715091.0 83 40 1 399172.6 119.0 96.0 70.0 +4 715091.0 83 41 1 401771.6 127.7 98.0 94.0 +4 715091.0 83 42 1 405645.9 168.2 98.0 74.0 +4 715091.0 83 43 1 416597.0 210.9 96.0 86.0 +4 715091.0 83 44 1 437110.7 167.9 96.0 84.0 +4 715091.0 83 45 1 448013.1 197.9 98.0 70.0 +4 715091.0 83 46 1 465393.9 217.2 104.0 82.0 +4 715091.0 83 47 1 487501.6 115.6 118.0 108.0 +4 715091.0 83 48 1 489634.0 165.6 118.0 74.0 +4 715091.0 83 49 1 500080.4 162.4 122.0 92.0 +4 715091.0 83 50 1 509904.5 144.3 126.0 110.0 +4 715091.0 83 51 1 516435.1 110.3 126.0 72.0 +4 715091.0 83 52 1 517853.2 144.0 126.0 120.0 +4 715091.0 83 53 1 524345.8 137.7 130.0 122.0 +4 715091.0 83 54 1 529788.8 132.4 134.0 128.0 +4 715091.0 83 55 1 534388.1 146.4 134.0 124.0 +4 715091.0 83 56 1 541285.4 133.3 134.0 126.0 +4 715091.0 83 57 1 546021.7 106.9 136.0 116.0 +4 715091.0 83 58 1 547013.1 176.2 136.0 88.0 +4 715091.0 83 59 1 559588.7 158.0 146.0 126.0 +4 715091.0 83 60 1 568566.0 117.5 148.0 126.0 +4 715091.0 83 61 1 570959.0 108.1 148.0 112.0 +4 715091.0 83 62 1 572095.5 118.1 150.0 112.0 +4 715091.0 83 63 1 574565.4 135.8 148.0 144.0 +4 715091.0 83 64 1 579691.4 225.6 148.0 142.0 +4 715091.0 83 65 1 603997.3 131.9 144.3 142.3 +4 715091.0 83 66 1 608509.3 114.4 140.3 130.3 +4 715091.0 83 67 1 610471.0 150.2 140.3 136.3 +4 715091.0 83 68 1 618042.7 122.8 136.3 128.3 +4 715091.0 83 69 1 621181.0 132.7 136.3 134.3 +4 715091.0 83 70 1 625817.0 121.1 138.3 102.0 +4 715091.0 83 71 1 628717.9 123.4 138.3 138.3 +4 715091.0 83 72 1 631956.9 133.7 136.3 134.3 +4 715091.0 83 73 1 636748.2 178.6 136.3 130.3 +4 715091.0 83 74 1 649842.3 132.1 126.3 116.0 +4 715091.0 83 75 1 654390.7 170.4 124.3 114.3 +4 715091.0 83 76 1 665785.2 184.0 120.3 84.3 +4 715091.0 83 77 1 680036.2 129.4 116.3 110.3 +4 715091.0 83 78 1 684166.7 131.3 116.3 112.3 +4 715091.0 83 79 1 688595.4 151.3 116.3 110.3 +4 715091.0 83 80 1 696365.3 152.2 110.3 106.3 +4 715091.0 83 81 1 704279.9 132.8 104.3 104.3 +4 715091.0 83 82 1 708941.2 141.9 98.3 98.3 +4 715091.0 83 83 1 715071.0 0.0 72.0 72.0 +4 715091.0 83 84 0 715091.0 0.0 0.0 0.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference_cmap_file.cmap Fri Jan 06 22:10:44 2023 +0000 @@ -0,0 +1,636 @@ +# hostname=6d61d934e61b +# $ cd /HybridScaffold; /RefAligner/amd2/RefAligner -o /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD -stdout -stderr -i /data/jwd03f/main/053/913/53913897/working/assignAlignType/assignAlignType_q.cmap -ref /data/jwd03f/main/053/913/53913897/working/align_final/step2.hybrid.cmap -maxmem 250 -maxthreads 24 -maxvirtmem 250 -RAmem 3 1 -res 2.9 -FP 0.6 -FN 0.06 -sf 0.20 -sd 0.0 -sr 0.01 -extend 1 -outlier 0.0001 -endoutlier 0.001 -PVendoutlier -deltaX 6 -deltaY 6 -xmapchim 12 -hashgen 5 7 2.4 1.5 0.05 5.0 1 1 4 -hash -hashdelta 26 10 46 -hashMultiMatch 30 10 -insertThreads 24 -nosplit 2 -biaswt 0 -T 1e-10 -S -1000 -indel -PVres 2 -rres 0.9 -MaxSE 0.5 -HSDrange 1.0 -outlierBC -xmapUnique 14 -AlignRes 2. -outlierExtend 6 24 -Kmax 6 -resEstimate -BestRef 1 -f -mres 0.9 +# CompileDir= /home/users/sqa01/RefAlignerBuild/branches/12432.12463rel/12432.12463rel CompileCmd=/opt/gcc-9.3.0/bin/g++ -B/opt/binutils-2.34 -fopenmp -Ofast -march=znver2 -mavx2 -mfpmath=sse -DUSE_PFLOAT=1 -DUSE_RFLOAT=1 -DUSE_SSE=1 -DUSE_MFLOAT=1 -DUSE_EPOW=2 -I/home/users8/tanantharaman/sleef-081120/build/include -I/opt/glibc-2.31/include -DUSE_STATIC -freciprocal-math -fno-signed-zeros -fno-trapping-math -fno-tree-vectorize -mtune=znver2 -fno-lto-odr-type-merging -DRELEASE=1 -std=gnu++98 -Wl,--dynamic-linker=/opt/glibc-2.31/lib/ld-linux-x86-64.so.2 -Wl,--rpath=/opt/glibc-2.31/lib -Wl,--rpath=/opt/gcc-9.3.0/lib64 -lsleefinline -lrt -lmvec -L/home/users8/tanantharaman/sleef-081120/build/lib -L/opt/glibc-2.31/lib -L/opt/gcc-9.3.0/lib64 -static -static-libstdc++ -static-libgcc -s SVNversion=12463 $Header: http://svn.bnm.local:81/svn/Informatics/RefAligner/branches/12432/RefAligner.cpp 12458 2021-10-24 00:56:45Z tanantharaman $ +# FLAGS: USE_SSE=1 USE_AVX=1 USE_MIC=0 USE_PFLOAT=1 USE_RFLOAT=1 USE_MFLOAT=1 USE_EPOW=2 DEBUG=1 VERB=1 +# CMAP File Version: 0.1 +# Label Channels: 1 +# Nickase Recognition Site 1: gctcttc +# Number of Consensus Maps: 1 +# StdDev refers to the interval between the current site and the next site +#h CMapId ContigLength NumSites SiteID LabelChannel Position StdDev Coverage Occurrence Mask +#f int float int int int float float float float Hex +1 4753350.0 624 1 1 4239.0 0.0 0.0 0.0 10 +1 4753350.0 624 2 1 17279.0 0.0 0.0 0.0 0 +1 4753350.0 624 3 1 19489.5 0.0 1.0 1.0 0 +1 4753350.0 624 4 1 37090.0 0.0 1.0 1.0 0 +1 4753350.0 624 5 1 55531.0 0.0 1.0 1.0 0 +1 4753350.0 624 6 1 58111.0 0.0 1.0 1.0 0 +1 4753350.0 624 7 1 93858.0 0.0 1.0 1.0 0 +1 4753350.0 624 8 1 97892.0 0.0 1.0 1.0 0 +1 4753350.0 624 9 1 105928.0 0.0 1.0 1.0 0 +1 4753350.0 624 10 1 108648.0 0.0 1.0 1.0 0 +1 4753350.0 624 11 1 109729.0 0.0 1.0 1.0 0 +1 4753350.0 624 12 1 116817.0 0.0 1.0 1.0 0 +1 4753350.0 624 13 1 128506.0 0.0 1.0 1.0 0 +1 4753350.0 624 14 1 144099.0 0.0 1.0 1.0 0 +1 4753350.0 624 15 1 154799.0 0.0 1.0 1.0 0 +1 4753350.0 624 16 1 162505.0 0.0 1.0 1.0 0 +1 4753350.0 624 17 1 188701.0 0.0 1.0 1.0 0 +1 4753350.0 624 18 1 192239.0 0.0 1.0 1.0 0 +1 4753350.0 624 19 1 199811.0 0.0 1.0 1.0 0 +1 4753350.0 624 20 1 217835.0 0.0 1.0 1.0 0 +1 4753350.0 624 21 1 221220.0 0.0 1.0 1.0 0 +1 4753350.0 624 22 1 250186.0 0.0 1.0 1.0 0 +1 4753350.0 624 23 1 262123.0 0.0 1.0 0.0 0 +1 4753350.0 624 24 1 266376.0 0.0 1.0 1.0 0 +1 4753350.0 624 25 1 288059.0 0.0 1.0 1.0 0 +1 4753350.0 624 26 1 315575.0 0.0 1.0 1.0 0 +1 4753350.0 624 27 1 323727.0 0.0 1.0 1.0 0 +1 4753350.0 624 28 1 325223.0 0.0 1.0 1.0 0 +1 4753350.0 624 29 1 329323.5 0.0 1.0 1.0 0 +1 4753350.0 624 30 1 333940.0 0.0 1.0 1.0 0 +1 4753350.0 624 31 1 337999.0 0.0 1.0 1.0 0 +1 4753350.0 624 32 1 348486.0 0.0 1.0 0.0 0 +1 4753350.0 624 33 1 358353.0 0.0 1.0 1.0 0 +1 4753350.0 624 34 1 360358.0 0.0 1.0 1.0 0 +1 4753350.0 624 35 1 361821.0 0.0 1.0 1.0 0 +1 4753350.0 624 36 1 362356.0 0.0 1.0 1.0 0 +1 4753350.0 624 37 1 368752.0 0.0 1.0 1.0 0 +1 4753350.0 624 38 1 371856.0 0.0 1.0 1.0 0 +1 4753350.0 624 39 1 388051.0 0.0 1.0 1.0 0 +1 4753350.0 624 40 1 397842.0 0.0 1.0 1.0 0 +1 4753350.0 624 41 1 402384.0 0.0 1.0 1.0 0 +1 4753350.0 624 42 1 406999.0 0.0 1.0 1.0 0 +1 4753350.0 624 43 1 411437.0 0.0 1.0 1.0 0 +1 4753350.0 624 44 1 415644.0 0.0 1.0 1.0 0 +1 4753350.0 624 45 1 418640.0 0.0 1.0 1.0 0 +1 4753350.0 624 46 1 419539.0 0.0 1.0 1.0 0 +1 4753350.0 624 47 1 425668.0 0.0 1.0 1.0 0 +1 4753350.0 624 48 1 428336.0 0.0 1.0 1.0 0 +1 4753350.0 624 49 1 432419.0 0.0 1.0 1.0 0 +1 4753350.0 624 50 1 441525.0 0.0 1.0 0.0 0 +1 4753350.0 624 51 1 443358.0 0.0 1.0 1.0 0 +1 4753350.0 624 52 1 463778.0 0.0 1.0 1.0 0 +1 4753350.0 624 53 1 474831.0 0.0 1.0 1.0 0 +1 4753350.0 624 54 1 492458.0 0.0 1.0 1.0 0 +1 4753350.0 624 55 1 514820.0 0.0 1.0 1.0 0 +1 4753350.0 624 56 1 517179.0 0.0 1.0 1.0 0 +1 4753350.0 624 57 1 527496.0 0.0 1.0 1.0 0 +1 4753350.0 624 58 1 537373.0 0.0 1.0 1.0 0 +1 4753350.0 624 59 1 543569.0 0.0 1.0 1.0 0 +1 4753350.0 624 60 1 545170.0 0.0 1.0 1.0 0 +1 4753350.0 624 61 1 545936.0 0.0 1.0 0.0 0 +1 4753350.0 624 62 1 551771.0 0.0 1.0 1.0 0 +1 4753350.0 624 63 1 556881.0 0.0 1.0 1.0 0 +1 4753350.0 624 64 1 557641.0 0.0 1.0 1.0 0 +1 4753350.0 624 65 1 561928.0 0.0 1.0 1.0 0 +1 4753350.0 624 66 1 568890.0 0.0 1.0 1.0 0 +1 4753350.0 624 67 1 573460.0 0.0 1.0 1.0 0 +1 4753350.0 624 68 1 574888.0 0.0 1.0 1.0 0 +1 4753350.0 624 69 1 587312.0 0.0 1.0 1.0 0 +1 4753350.0 624 70 1 596147.0 0.0 1.0 1.0 0 +1 4753350.0 624 71 1 598321.0 0.0 1.0 1.0 0 +1 4753350.0 624 72 1 599783.0 0.0 1.0 1.0 0 +1 4753350.0 624 73 1 602322.0 0.0 1.0 1.0 0 +1 4753350.0 624 74 1 607378.0 0.0 1.0 1.0 0 +1 4753350.0 624 75 1 631798.0 0.0 1.0 1.0 0 +1 4753350.0 624 76 1 636224.0 0.0 1.0 1.0 0 +1 4753350.0 624 77 1 638410.0 0.0 1.0 1.0 0 +1 4753350.0 624 78 1 645851.0 0.0 1.0 1.0 0 +1 4753350.0 624 79 1 649137.0 0.0 1.0 1.0 0 +1 4753350.0 624 80 1 653670.0 0.0 1.0 1.0 0 +1 4753350.0 624 81 1 656604.0 0.0 1.0 1.0 0 +1 4753350.0 624 82 1 659908.0 0.0 1.0 1.0 0 +1 4753350.0 624 83 1 664686.0 0.0 1.0 1.0 0 +1 4753350.0 624 84 1 677855.0 0.0 1.0 1.0 0 +1 4753350.0 624 85 1 682394.0 0.0 1.0 1.0 0 +1 4753350.0 624 86 1 693884.0 0.0 1.0 1.0 0 +1 4753350.0 624 87 1 707834.5 0.0 1.0 1.0 0 +1 4753350.0 624 88 1 708653.0 0.0 1.0 1.0 0 +1 4753350.0 624 89 1 712259.0 0.0 1.0 1.0 0 +1 4753350.0 624 90 1 716442.0 0.0 1.0 1.0 0 +1 4753350.0 624 91 1 717564.0 0.0 1.0 1.0 0 +1 4753350.0 624 92 1 724542.0 0.0 1.0 1.0 0 +1 4753350.0 624 93 1 732436.0 0.0 1.0 1.0 0 +1 4753350.0 624 94 1 737227.0 0.0 1.0 1.0 0 +1 4753350.0 624 95 1 743436.5 0.0 1.0 1.0 0 +1 4753350.0 624 96 1 765981.0 0.0 1.0 1.0 0 +1 4753350.0 624 97 1 767873.0 0.0 1.0 1.0 0 +1 4753350.0 624 98 1 811829.0 0.0 1.0 1.0 0 +1 4753350.0 624 99 1 815523.0 0.0 1.0 1.0 0 +1 4753350.0 624 100 1 835691.5 0.0 1.0 1.0 0 +1 4753350.0 624 101 1 839012.0 0.0 1.0 1.0 0 +1 4753350.0 624 102 1 844824.0 0.0 1.0 1.0 0 +1 4753350.0 624 103 1 855861.0 0.0 1.0 1.0 0 +1 4753350.0 624 104 1 862953.0 0.0 1.0 1.0 0 +1 4753350.0 624 105 1 868835.0 0.0 1.0 1.0 0 +1 4753350.0 624 106 1 882537.0 0.0 1.0 1.0 0 +1 4753350.0 624 107 1 883646.0 0.0 1.0 1.0 0 +1 4753350.0 624 108 1 888143.0 0.0 1.0 1.0 0 +1 4753350.0 624 109 1 896620.0 0.0 1.0 1.0 0 +1 4753350.0 624 110 1 901539.0 0.0 1.0 1.0 0 +1 4753350.0 624 111 1 906376.0 0.0 1.0 1.0 0 +1 4753350.0 624 112 1 910317.0 0.0 1.0 1.0 0 +1 4753350.0 624 113 1 911007.0 0.0 1.0 1.0 0 +1 4753350.0 624 114 1 932375.0 0.0 1.0 1.0 0 +1 4753350.0 624 115 1 934326.0 0.0 1.0 1.0 0 +1 4753350.0 624 116 1 935945.0 0.0 1.0 1.0 0 +1 4753350.0 624 117 1 942719.0 0.0 1.0 1.0 0 +1 4753350.0 624 118 1 950554.0 0.0 1.0 1.0 0 +1 4753350.0 624 119 1 955451.5 0.0 1.0 1.0 0 +1 4753350.0 624 120 1 967823.0 0.0 1.0 1.0 0 +1 4753350.0 624 121 1 972446.0 0.0 1.0 1.0 0 +1 4753350.0 624 122 1 973196.0 0.0 1.0 1.0 0 +1 4753350.0 624 123 1 975202.0 0.0 1.0 1.0 0 +1 4753350.0 624 124 1 1001484.0 0.0 1.0 1.0 0 +1 4753350.0 624 125 1 1005349.0 0.0 1.0 1.0 0 +1 4753350.0 624 126 1 1011256.0 0.0 1.0 1.0 0 +1 4753350.0 624 127 1 1026412.0 0.0 1.0 1.0 0 +1 4753350.0 624 128 1 1027378.0 0.0 1.0 1.0 0 +1 4753350.0 624 129 1 1032431.0 0.0 1.0 1.0 0 +1 4753350.0 624 130 1 1039538.0 0.0 1.0 1.0 0 +1 4753350.0 624 131 1 1042715.0 0.0 1.0 1.0 0 +1 4753350.0 624 132 1 1059415.0 0.0 1.0 1.0 0 +1 4753350.0 624 133 1 1070382.0 0.0 1.0 1.0 0 +1 4753350.0 624 134 1 1080320.0 0.0 1.0 1.0 0 +1 4753350.0 624 135 1 1086698.0 0.0 1.0 1.0 0 +1 4753350.0 624 136 1 1089958.0 0.0 1.0 1.0 0 +1 4753350.0 624 137 1 1091965.0 0.0 1.0 1.0 0 +1 4753350.0 624 138 1 1093648.0 0.0 1.0 1.0 0 +1 4753350.0 624 139 1 1096808.0 0.0 1.0 1.0 0 +1 4753350.0 624 140 1 1106576.0 0.0 1.0 1.0 0 +1 4753350.0 624 141 1 1121476.0 0.0 1.0 1.0 0 +1 4753350.0 624 142 1 1128394.0 0.0 1.0 1.0 0 +1 4753350.0 624 143 1 1131455.0 0.0 1.0 1.0 0 +1 4753350.0 624 144 1 1139677.0 0.0 1.0 0.0 0 +1 4753350.0 624 145 1 1143211.0 0.0 1.0 0.0 0 +1 4753350.0 624 146 1 1155998.0 0.0 1.0 1.0 0 +1 4753350.0 624 147 1 1157210.0 0.0 1.0 1.0 0 +1 4753350.0 624 148 1 1172484.0 0.0 1.0 1.0 0 +1 4753350.0 624 149 1 1173723.0 0.0 1.0 1.0 0 +1 4753350.0 624 150 1 1182409.0 0.0 1.0 1.0 0 +1 4753350.0 624 151 1 1185645.0 0.0 1.0 1.0 0 +1 4753350.0 624 152 1 1187661.0 0.0 1.0 1.0 0 +1 4753350.0 624 153 1 1210410.0 0.0 1.0 1.0 0 +1 4753350.0 624 154 1 1219414.0 0.0 1.0 1.0 0 +1 4753350.0 624 155 1 1226169.0 0.0 1.0 1.0 0 +1 4753350.0 624 156 1 1227018.0 0.0 1.0 1.0 0 +1 4753350.0 624 157 1 1240575.0 0.0 1.0 1.0 0 +1 4753350.0 624 158 1 1242081.0 0.0 1.0 1.0 0 +1 4753350.0 624 159 1 1250286.0 0.0 1.0 1.0 0 +1 4753350.0 624 160 1 1256833.0 0.0 1.0 1.0 0 +1 4753350.0 624 161 1 1272964.0 0.0 1.0 1.0 0 +1 4753350.0 624 162 1 1278512.0 0.0 1.0 1.0 0 +1 4753350.0 624 163 1 1283280.0 0.0 1.0 1.0 0 +1 4753350.0 624 164 1 1288448.0 0.0 1.0 1.0 0 +1 4753350.0 624 165 1 1293957.0 0.0 1.0 1.0 0 +1 4753350.0 624 166 1 1303481.0 0.0 1.0 1.0 0 +1 4753350.0 624 167 1 1323797.0 0.0 1.0 1.0 0 +1 4753350.0 624 168 1 1327446.0 0.0 1.0 1.0 0 +1 4753350.0 624 169 1 1330154.0 0.0 1.0 1.0 0 +1 4753350.0 624 170 1 1335816.0 0.0 1.0 1.0 0 +1 4753350.0 624 171 1 1344894.0 0.0 1.0 1.0 0 +1 4753350.0 624 172 1 1357874.0 0.0 1.0 1.0 0 +1 4753350.0 624 173 1 1361337.0 0.0 1.0 1.0 0 +1 4753350.0 624 174 1 1371627.0 0.0 1.0 1.0 0 +1 4753350.0 624 175 1 1374164.0 0.0 1.0 1.0 0 +1 4753350.0 624 176 1 1376226.0 0.0 1.0 1.0 0 +1 4753350.0 624 177 1 1384189.0 0.0 1.0 1.0 0 +1 4753350.0 624 178 1 1385330.0 0.0 1.0 1.0 0 +1 4753350.0 624 179 1 1388204.0 0.0 1.0 1.0 0 +1 4753350.0 624 180 1 1391671.5 0.0 1.0 1.0 0 +1 4753350.0 624 181 1 1396918.0 0.0 1.0 1.0 0 +1 4753350.0 624 182 1 1399751.0 0.0 1.0 1.0 0 +1 4753350.0 624 183 1 1403582.0 0.0 1.0 1.0 0 +1 4753350.0 624 184 1 1408862.0 0.0 1.0 1.0 0 +1 4753350.0 624 185 1 1409548.0 0.0 1.0 1.0 0 +1 4753350.0 624 186 1 1412647.0 0.0 1.0 1.0 0 +1 4753350.0 624 187 1 1415102.0 0.0 1.0 1.0 0 +1 4753350.0 624 188 1 1432087.0 0.0 1.0 1.0 0 +1 4753350.0 624 189 1 1446142.0 0.0 1.0 1.0 0 +1 4753350.0 624 190 1 1477988.0 0.0 1.0 1.0 0 +1 4753350.0 624 191 1 1490755.0 0.0 1.0 1.0 0 +1 4753350.0 624 192 1 1492814.0 0.0 1.0 1.0 0 +1 4753350.0 624 193 1 1494770.0 0.0 1.0 1.0 0 +1 4753350.0 624 194 1 1497500.0 0.0 1.0 1.0 0 +1 4753350.0 624 195 1 1500104.0 0.0 1.0 1.0 0 +1 4753350.0 624 196 1 1502028.0 0.0 1.0 1.0 0 +1 4753350.0 624 197 1 1511074.0 0.0 1.0 1.0 0 +1 4753350.0 624 198 1 1516126.0 0.0 1.0 1.0 0 +1 4753350.0 624 199 1 1520686.0 0.0 1.0 1.0 0 +1 4753350.0 624 200 1 1523395.0 0.0 1.0 1.0 0 +1 4753350.0 624 201 1 1527971.0 0.0 1.0 1.0 0 +1 4753350.0 624 202 1 1546270.0 0.0 1.0 1.0 0 +1 4753350.0 624 203 1 1548569.0 0.0 1.0 1.0 0 +1 4753350.0 624 204 1 1550539.0 0.0 1.0 1.0 0 +1 4753350.0 624 205 1 1562130.0 0.0 1.0 1.0 0 +1 4753350.0 624 206 1 1571447.0 0.0 1.0 1.0 0 +1 4753350.0 624 207 1 1583723.0 0.0 1.0 1.0 0 +1 4753350.0 624 208 1 1585826.0 0.0 1.0 1.0 0 +1 4753350.0 624 209 1 1589744.0 0.0 1.0 1.0 0 +1 4753350.0 624 210 1 1595459.0 0.0 1.0 1.0 0 +1 4753350.0 624 211 1 1602017.0 0.0 1.0 1.0 0 +1 4753350.0 624 212 1 1604017.0 0.0 1.0 1.0 0 +1 4753350.0 624 213 1 1604588.0 0.0 1.0 1.0 0 +1 4753350.0 624 214 1 1620327.0 0.0 1.0 1.0 0 +1 4753350.0 624 215 1 1629337.0 0.0 1.0 1.0 0 +1 4753350.0 624 216 1 1633023.5 0.0 1.0 1.0 0 +1 4753350.0 624 217 1 1636670.0 0.0 1.0 1.0 0 +1 4753350.0 624 218 1 1651352.0 0.0 1.0 1.0 0 +1 4753350.0 624 219 1 1658047.0 0.0 1.0 1.0 0 +1 4753350.0 624 220 1 1672431.0 0.0 1.0 1.0 0 +1 4753350.0 624 221 1 1697220.0 0.0 1.0 1.0 0 +1 4753350.0 624 222 1 1697970.0 0.0 1.0 1.0 0 +1 4753350.0 624 223 1 1708996.0 0.0 1.0 1.0 0 +1 4753350.0 624 224 1 1723734.0 0.0 1.0 1.0 0 +1 4753350.0 624 225 1 1731707.0 0.0 1.0 1.0 0 +1 4753350.0 624 226 1 1741993.0 0.0 1.0 1.0 0 +1 4753350.0 624 227 1 1750035.0 0.0 1.0 1.0 0 +1 4753350.0 624 228 1 1753398.0 0.0 1.0 1.0 0 +1 4753350.0 624 229 1 1759688.0 0.0 1.0 1.0 0 +1 4753350.0 624 230 1 1787434.0 0.0 1.0 1.0 0 +1 4753350.0 624 231 1 1794175.0 0.0 1.0 1.0 0 +1 4753350.0 624 232 1 1804966.0 0.0 1.0 1.0 0 +1 4753350.0 624 233 1 1821519.0 0.0 1.0 1.0 0 +1 4753350.0 624 234 1 1823262.0 0.0 1.0 1.0 0 +1 4753350.0 624 235 1 1829994.0 0.0 1.0 1.0 0 +1 4753350.0 624 236 1 1838454.0 0.0 1.0 1.0 0 +1 4753350.0 624 237 1 1839012.0 0.0 1.0 1.0 0 +1 4753350.0 624 238 1 1845126.5 0.0 1.0 1.0 0 +1 4753350.0 624 239 1 1851996.0 0.0 1.0 1.0 0 +1 4753350.0 624 240 1 1866093.0 0.0 1.0 1.0 0 +1 4753350.0 624 241 1 1893677.0 0.0 1.0 1.0 0 +1 4753350.0 624 242 1 1909954.0 0.0 1.0 1.0 0 +1 4753350.0 624 243 1 1922631.0 0.0 1.0 1.0 0 +1 4753350.0 624 244 1 1929816.0 0.0 1.0 1.0 0 +1 4753350.0 624 245 1 1936834.0 0.0 1.0 1.0 0 +1 4753350.0 624 246 1 1942385.0 0.0 1.0 1.0 0 +1 4753350.0 624 247 1 1944710.0 0.0 1.0 0.0 0 +1 4753350.0 624 248 1 1946087.5 0.0 1.0 1.0 0 +1 4753350.0 624 249 1 1948265.0 0.0 1.0 1.0 0 +1 4753350.0 624 250 1 1949581.0 0.0 1.0 1.0 0 +1 4753350.0 624 251 1 1966907.0 0.0 1.0 1.0 0 +1 4753350.0 624 252 1 1992106.0 0.0 1.0 1.0 0 +1 4753350.0 624 253 1 1993239.0 0.0 1.0 1.0 0 +1 4753350.0 624 254 1 1997117.0 0.0 1.0 1.0 0 +1 4753350.0 624 255 1 1997923.0 0.0 1.0 1.0 0 +1 4753350.0 624 256 1 2000536.0 0.0 1.0 1.0 0 +1 4753350.0 624 257 1 2003126.0 0.0 1.0 1.0 0 +1 4753350.0 624 258 1 2015855.0 0.0 1.0 1.0 0 +1 4753350.0 624 259 1 2020749.0 0.0 1.0 1.0 0 +1 4753350.0 624 260 1 2021383.5 0.0 1.0 1.0 0 +1 4753350.0 624 261 1 2023972.0 0.0 1.0 1.0 0 +1 4753350.0 624 262 1 2025495.0 0.0 1.0 0.0 0 +1 4753350.0 624 263 1 2027262.0 0.0 1.0 1.0 0 +1 4753350.0 624 264 1 2047531.0 0.0 1.0 1.0 0 +1 4753350.0 624 265 1 2052273.0 0.0 1.0 1.0 0 +1 4753350.0 624 266 1 2059471.0 0.0 1.0 1.0 0 +1 4753350.0 624 267 1 2062498.0 0.0 1.0 1.0 0 +1 4753350.0 624 268 1 2076780.0 0.0 1.0 1.0 0 +1 4753350.0 624 269 1 2084242.0 0.0 1.0 1.0 0 +1 4753350.0 624 270 1 2087324.0 0.0 1.0 1.0 0 +1 4753350.0 624 271 1 2107688.0 0.0 1.0 1.0 0 +1 4753350.0 624 272 1 2123723.0 0.0 1.0 1.0 0 +1 4753350.0 624 273 1 2131233.0 0.0 1.0 1.0 0 +1 4753350.0 624 274 1 2137357.0 0.0 1.0 1.0 0 +1 4753350.0 624 275 1 2155018.5 0.0 1.0 1.0 0 +1 4753350.0 624 276 1 2157418.0 0.0 1.0 1.0 0 +1 4753350.0 624 277 1 2158003.0 0.0 1.0 1.0 0 +1 4753350.0 624 278 1 2162229.0 0.0 1.0 1.0 0 +1 4753350.0 624 279 1 2163364.0 0.0 1.0 1.0 0 +1 4753350.0 624 280 1 2179644.0 0.0 1.0 1.0 0 +1 4753350.0 624 281 1 2180219.0 0.0 1.0 1.0 0 +1 4753350.0 624 282 1 2181049.0 0.0 1.0 1.0 0 +1 4753350.0 624 283 1 2185384.0 0.0 1.0 1.0 0 +1 4753350.0 624 284 1 2193391.0 0.0 1.0 1.0 0 +1 4753350.0 624 285 1 2196931.0 0.0 1.0 1.0 0 +1 4753350.0 624 286 1 2198046.0 0.0 1.0 1.0 0 +1 4753350.0 624 287 1 2212757.0 0.0 1.0 1.0 0 +1 4753350.0 624 288 1 2222278.5 0.0 1.0 1.0 0 +1 4753350.0 624 289 1 2236311.0 0.0 1.0 0.0 0 +1 4753350.0 624 290 1 2237533.0 0.0 1.0 1.0 0 +1 4753350.0 624 291 1 2242354.0 0.0 1.0 1.0 0 +1 4753350.0 624 292 1 2243467.0 0.0 1.0 1.0 0 +1 4753350.0 624 293 1 2252876.0 0.0 1.0 1.0 0 +1 4753350.0 624 294 1 2261808.0 0.0 1.0 1.0 0 +1 4753350.0 624 295 1 2263578.0 0.0 1.0 1.0 0 +1 4753350.0 624 296 1 2265285.0 0.0 1.0 1.0 0 +1 4753350.0 624 297 1 2269662.0 0.0 1.0 1.0 0 +1 4753350.0 624 298 1 2273470.0 0.0 1.0 1.0 0 +1 4753350.0 624 299 1 2309523.0 0.0 1.0 1.0 0 +1 4753350.0 624 300 1 2320083.0 0.0 1.0 1.0 0 +1 4753350.0 624 301 1 2338777.0 0.0 1.0 1.0 0 +1 4753350.0 624 302 1 2351212.0 0.0 1.0 1.0 0 +1 4753350.0 624 303 1 2353671.0 0.0 1.0 1.0 0 +1 4753350.0 624 304 1 2356999.0 0.0 1.0 1.0 0 +1 4753350.0 624 305 1 2361318.0 0.0 1.0 1.0 0 +1 4753350.0 624 306 1 2363573.0 0.0 1.0 1.0 0 +1 4753350.0 624 307 1 2371737.0 0.0 1.0 1.0 0 +1 4753350.0 624 308 1 2374197.0 0.0 1.0 1.0 0 +1 4753350.0 624 309 1 2397082.0 0.0 1.0 1.0 0 +1 4753350.0 624 310 1 2404413.0 0.0 1.0 1.0 0 +1 4753350.0 624 311 1 2421749.0 0.0 1.0 1.0 0 +1 4753350.0 624 312 1 2440188.0 0.0 1.0 1.0 0 +1 4753350.0 624 313 1 2442946.0 0.0 1.0 1.0 0 +1 4753350.0 624 314 1 2443848.0 0.0 1.0 1.0 0 +1 4753350.0 624 315 1 2447921.0 0.0 1.0 1.0 0 +1 4753350.0 624 316 1 2450213.0 0.0 1.0 1.0 0 +1 4753350.0 624 317 1 2465443.0 0.0 1.0 1.0 0 +1 4753350.0 624 318 1 2468644.5 0.0 1.0 1.0 0 +1 4753350.0 624 319 1 2474340.0 0.0 1.0 1.0 0 +1 4753350.0 624 320 1 2477236.0 0.0 1.0 1.0 0 +1 4753350.0 624 321 1 2484210.0 0.0 1.0 1.0 0 +1 4753350.0 624 322 1 2489494.0 0.0 1.0 1.0 0 +1 4753350.0 624 323 1 2490113.0 0.0 1.0 0.0 0 +1 4753350.0 624 324 1 2497328.0 0.0 1.0 1.0 0 +1 4753350.0 624 325 1 2517158.0 0.0 1.0 1.0 0 +1 4753350.0 624 326 1 2539365.0 0.0 1.0 1.0 0 +1 4753350.0 624 327 1 2571467.0 0.0 1.0 1.0 0 +1 4753350.0 624 328 1 2581683.5 0.0 1.0 0.0 0 +1 4753350.0 624 329 1 2583009.0 0.0 1.0 1.0 0 +1 4753350.0 624 330 1 2583548.0 0.0 1.0 1.0 0 +1 4753350.0 624 331 1 2593922.0 0.0 1.0 1.0 0 +1 4753350.0 624 332 1 2603285.5 0.0 1.0 1.0 0 +1 4753350.0 624 333 1 2609419.0 0.0 1.0 1.0 0 +1 4753350.0 624 334 1 2615243.0 0.0 1.0 1.0 0 +1 4753350.0 624 335 1 2616084.0 0.0 1.0 1.0 0 +1 4753350.0 624 336 1 2619949.0 0.0 1.0 1.0 0 +1 4753350.0 624 337 1 2686490.0 0.0 1.0 1.0 0 +1 4753350.0 624 338 1 2690434.0 0.0 1.0 1.0 0 +1 4753350.0 624 339 1 2693446.0 0.0 1.0 1.0 0 +1 4753350.0 624 340 1 2696290.0 0.0 1.0 1.0 0 +1 4753350.0 624 341 1 2696756.0 0.0 1.0 1.0 0 +1 4753350.0 624 342 1 2701387.0 0.0 1.0 1.0 0 +1 4753350.0 624 343 1 2706377.0 0.0 1.0 1.0 0 +1 4753350.0 624 344 1 2714755.0 0.0 1.0 1.0 0 +1 4753350.0 624 345 1 2722749.0 0.0 1.0 1.0 0 +1 4753350.0 624 346 1 2728060.0 0.0 1.0 1.0 0 +1 4753350.0 624 347 1 2729019.0 0.0 1.0 1.0 0 +1 4753350.0 624 348 1 2735530.0 0.0 1.0 1.0 0 +1 4753350.0 624 349 1 2742763.0 0.0 1.0 1.0 0 +1 4753350.0 624 350 1 2743680.0 0.0 1.0 1.0 0 +1 4753350.0 624 351 1 2744769.0 0.0 1.0 1.0 0 +1 4753350.0 624 352 1 2747375.5 0.0 1.0 1.0 0 +1 4753350.0 624 353 1 2781059.0 0.0 1.0 1.0 0 +1 4753350.0 624 354 1 2792133.0 0.0 1.0 1.0 0 +1 4753350.0 624 355 1 2800460.5 0.0 1.0 1.0 0 +1 4753350.0 624 356 1 2814169.0 0.0 1.0 1.0 0 +1 4753350.0 624 357 1 2820078.0 0.0 1.0 1.0 0 +1 4753350.0 624 358 1 2822391.0 0.0 1.0 1.0 0 +1 4753350.0 624 359 1 2824851.0 0.0 1.0 1.0 0 +1 4753350.0 624 360 1 2840253.0 0.0 1.0 1.0 0 +1 4753350.0 624 361 1 2847987.0 0.0 1.0 1.0 0 +1 4753350.0 624 362 1 2862670.0 0.0 1.0 1.0 0 +1 4753350.0 624 363 1 2864554.0 0.0 1.0 1.0 0 +1 4753350.0 624 364 1 2865879.5 0.0 1.0 1.0 0 +1 4753350.0 624 365 1 2879444.5 0.0 1.0 1.0 0 +1 4753350.0 624 366 1 2887886.0 0.0 1.0 1.0 0 +1 4753350.0 624 367 1 2890709.0 0.0 1.0 1.0 0 +1 4753350.0 624 368 1 2897559.0 0.0 1.0 1.0 0 +1 4753350.0 624 369 1 2898702.0 0.0 1.0 1.0 0 +1 4753350.0 624 370 1 2899575.0 0.0 1.0 0.0 0 +1 4753350.0 624 371 1 2912270.0 0.0 1.0 1.0 0 +1 4753350.0 624 372 1 2914496.0 0.0 1.0 1.0 0 +1 4753350.0 624 373 1 2920370.0 0.0 1.0 1.0 0 +1 4753350.0 624 374 1 2923801.0 0.0 1.0 1.0 0 +1 4753350.0 624 375 1 2924679.0 0.0 1.0 1.0 0 +1 4753350.0 624 376 1 2932607.0 0.0 1.0 1.0 0 +1 4753350.0 624 377 1 2938320.0 0.0 1.0 1.0 0 +1 4753350.0 624 378 1 2943388.0 0.0 1.0 1.0 0 +1 4753350.0 624 379 1 2944925.0 0.0 1.0 1.0 0 +1 4753350.0 624 380 1 2952740.0 0.0 1.0 1.0 0 +1 4753350.0 624 381 1 2963166.0 0.0 1.0 1.0 0 +1 4753350.0 624 382 1 2972848.0 0.0 1.0 1.0 0 +1 4753350.0 624 383 1 2981868.0 0.0 1.0 1.0 0 +1 4753350.0 624 384 1 2987736.0 0.0 1.0 1.0 0 +1 4753350.0 624 385 1 2988553.0 0.0 1.0 1.0 0 +1 4753350.0 624 386 1 2998344.0 0.0 1.0 1.0 0 +1 4753350.0 624 387 1 3000672.0 0.0 1.0 1.0 0 +1 4753350.0 624 388 1 3001299.0 0.0 1.0 1.0 0 +1 4753350.0 624 389 1 3013747.0 0.0 1.0 1.0 0 +1 4753350.0 624 390 1 3016755.0 0.0 1.0 1.0 0 +1 4753350.0 624 391 1 3021444.0 0.0 1.0 1.0 0 +1 4753350.0 624 392 1 3038684.0 0.0 1.0 1.0 0 +1 4753350.0 624 393 1 3050840.0 0.0 1.0 1.0 0 +1 4753350.0 624 394 1 3058648.0 0.0 1.0 1.0 0 +1 4753350.0 624 395 1 3060537.0 0.0 1.0 1.0 0 +1 4753350.0 624 396 1 3077132.5 0.0 1.0 1.0 0 +1 4753350.0 624 397 1 3085239.0 0.0 1.0 1.0 0 +1 4753350.0 624 398 1 3093465.0 0.0 1.0 1.0 0 +1 4753350.0 624 399 1 3095285.0 0.0 1.0 1.0 0 +1 4753350.0 624 400 1 3096094.0 0.0 1.0 0.0 0 +1 4753350.0 624 401 1 3099592.0 0.0 1.0 1.0 0 +1 4753350.0 624 402 1 3100887.0 0.0 1.0 1.0 0 +1 4753350.0 624 403 1 3103930.0 0.0 1.0 1.0 0 +1 4753350.0 624 404 1 3113616.0 0.0 1.0 1.0 0 +1 4753350.0 624 405 1 3117537.0 0.0 1.0 1.0 0 +1 4753350.0 624 406 1 3120144.0 0.0 1.0 1.0 0 +1 4753350.0 624 407 1 3123136.0 0.0 1.0 1.0 0 +1 4753350.0 624 408 1 3128911.0 0.0 1.0 1.0 0 +1 4753350.0 624 409 1 3129628.0 0.0 1.0 1.0 0 +1 4753350.0 624 410 1 3139029.0 0.0 1.0 1.0 0 +1 4753350.0 624 411 1 3152764.0 0.0 1.0 1.0 0 +1 4753350.0 624 412 1 3154730.0 0.0 1.0 1.0 0 +1 4753350.0 624 413 1 3188180.0 0.0 1.0 1.0 0 +1 4753350.0 624 414 1 3200949.0 0.0 1.0 1.0 0 +1 4753350.0 624 415 1 3211941.0 0.0 1.0 1.0 0 +1 4753350.0 624 416 1 3214944.0 0.0 1.0 1.0 0 +1 4753350.0 624 417 1 3256336.0 0.0 1.0 1.0 0 +1 4753350.0 624 418 1 3261460.0 0.0 1.0 0.0 0 +1 4753350.0 624 419 1 3262782.0 0.0 1.0 0.0 0 +1 4753350.0 624 420 1 3280389.0 0.0 1.0 0.0 0 +1 4753350.0 624 421 1 3281810.0 0.0 1.0 0.0 0 +1 4753350.0 624 422 1 3286595.0 0.0 1.0 0.0 0 +1 4753350.0 624 423 1 3301019.0 0.0 1.0 0.0 0 +1 4753350.0 624 424 1 3308320.0 0.0 1.0 0.0 0 +1 4753350.0 624 425 1 3314209.0 0.0 1.0 0.0 0 +1 4753350.0 624 426 1 3325201.0 0.0 1.0 0.0 0 +1 4753350.0 624 427 1 3328204.0 0.0 1.0 0.0 0 +1 4753350.0 624 428 1 3369596.0 0.0 1.0 0.0 0 +1 4753350.0 624 429 1 3374720.0 0.0 1.0 0.0 0 +1 4753350.0 624 430 1 3376042.0 0.0 1.0 1.0 0 +1 4753350.0 624 431 1 3393649.0 0.0 1.0 1.0 0 +1 4753350.0 624 432 1 3395070.0 0.0 1.0 1.0 0 +1 4753350.0 624 433 1 3399855.0 0.0 1.0 1.0 0 +1 4753350.0 624 434 1 3414279.0 0.0 1.0 1.0 0 +1 4753350.0 624 435 1 3421580.0 0.0 1.0 1.0 0 +1 4753350.0 624 436 1 3453060.0 0.0 1.0 1.0 0 +1 4753350.0 624 437 1 3480533.0 0.0 1.0 1.0 0 +1 4753350.0 624 438 1 3483858.0 0.0 1.0 1.0 0 +1 4753350.0 624 439 1 3486171.0 0.0 1.0 1.0 0 +1 4753350.0 624 440 1 3488090.0 0.0 1.0 1.0 0 +1 4753350.0 624 441 1 3495680.0 0.0 1.0 1.0 0 +1 4753350.0 624 442 1 3496195.0 0.0 1.0 1.0 0 +1 4753350.0 624 443 1 3500014.0 0.0 1.0 1.0 0 +1 4753350.0 624 444 1 3513426.5 0.0 1.0 1.0 0 +1 4753350.0 624 445 1 3519405.0 0.0 1.0 1.0 0 +1 4753350.0 624 446 1 3520228.0 0.0 1.0 1.0 0 +1 4753350.0 624 447 1 3521426.0 0.0 1.0 1.0 0 +1 4753350.0 624 448 1 3523293.0 0.0 1.0 1.0 0 +1 4753350.0 624 449 1 3541393.0 0.0 1.0 1.0 0 +1 4753350.0 624 450 1 3546342.0 0.0 1.0 1.0 0 +1 4753350.0 624 451 1 3550034.5 0.0 1.0 1.0 0 +1 4753350.0 624 452 1 3553337.0 0.0 1.0 1.0 0 +1 4753350.0 624 453 1 3554698.0 0.0 1.0 1.0 0 +1 4753350.0 624 454 1 3560540.0 0.0 1.0 1.0 0 +1 4753350.0 624 455 1 3561800.0 0.0 1.0 0.0 0 +1 4753350.0 624 456 1 3567496.0 0.0 1.0 1.0 0 +1 4753350.0 624 457 1 3569095.5 0.0 1.0 1.0 0 +1 4753350.0 624 458 1 3570163.5 0.0 1.0 1.0 0 +1 4753350.0 624 459 1 3580895.0 0.0 1.0 1.0 0 +1 4753350.0 624 460 1 3583282.0 0.0 1.0 1.0 0 +1 4753350.0 624 461 1 3587709.0 0.0 1.0 0.0 0 +1 4753350.0 624 462 1 3588931.0 0.0 1.0 1.0 0 +1 4753350.0 624 463 1 3590608.0 0.0 1.0 1.0 0 +1 4753350.0 624 464 1 3601254.0 0.0 1.0 0.0 0 +1 4753350.0 624 465 1 3614149.0 0.0 1.0 1.0 0 +1 4753350.0 624 466 1 3615799.0 0.0 1.0 1.0 0 +1 4753350.0 624 467 1 3618404.0 0.0 1.0 1.0 0 +1 4753350.0 624 468 1 3629017.0 0.0 1.0 1.0 0 +1 4753350.0 624 469 1 3630572.0 0.0 1.0 1.0 0 +1 4753350.0 624 470 1 3631597.0 0.0 1.0 1.0 0 +1 4753350.0 624 471 1 3653692.0 0.0 1.0 1.0 0 +1 4753350.0 624 472 1 3658051.0 0.0 1.0 1.0 0 +1 4753350.0 624 473 1 3661560.0 0.0 1.0 1.0 0 +1 4753350.0 624 474 1 3670223.0 0.0 1.0 1.0 0 +1 4753350.0 624 475 1 3672317.0 0.0 1.0 1.0 0 +1 4753350.0 624 476 1 3675287.0 0.0 1.0 1.0 0 +1 4753350.0 624 477 1 3713109.0 0.0 1.0 1.0 0 +1 4753350.0 624 478 1 3713748.0 0.0 1.0 1.0 0 +1 4753350.0 624 479 1 3715176.0 0.0 1.0 1.0 0 +1 4753350.0 624 480 1 3731188.0 0.0 1.0 1.0 0 +1 4753350.0 624 481 1 3734313.0 0.0 1.0 1.0 0 +1 4753350.0 624 482 1 3741685.0 0.0 1.0 1.0 0 +1 4753350.0 624 483 1 3743571.0 0.0 1.0 1.0 0 +1 4753350.0 624 484 1 3749771.0 0.0 1.0 1.0 0 +1 4753350.0 624 485 1 3756229.0 0.0 1.0 1.0 0 +1 4753350.0 624 486 1 3758814.0 0.0 1.0 1.0 0 +1 4753350.0 624 487 1 3761839.0 0.0 1.0 1.0 0 +1 4753350.0 624 488 1 3773601.0 0.0 1.0 1.0 0 +1 4753350.0 624 489 1 3777520.0 0.0 1.0 1.0 0 +1 4753350.0 624 490 1 3778518.0 0.0 1.0 1.0 0 +1 4753350.0 624 491 1 3806149.0 0.0 1.0 1.0 0 +1 4753350.0 624 492 1 3813529.0 0.0 1.0 1.0 0 +1 4753350.0 624 493 1 3818162.0 0.0 1.0 1.0 0 +1 4753350.0 624 494 1 3832215.0 0.0 1.0 1.0 0 +1 4753350.0 624 495 1 3834396.0 0.0 1.0 1.0 0 +1 4753350.0 624 496 1 3848434.0 0.0 1.0 0.0 0 +1 4753350.0 624 497 1 3858858.0 0.0 1.0 1.0 0 +1 4753350.0 624 498 1 3860274.0 0.0 1.0 0.0 0 +1 4753350.0 624 499 1 3878173.0 0.0 1.0 1.0 0 +1 4753350.0 624 500 1 3879001.0 0.0 1.0 1.0 0 +1 4753350.0 624 501 1 3879472.0 0.0 1.0 1.0 0 +1 4753350.0 624 502 1 3881251.0 0.0 1.0 1.0 0 +1 4753350.0 624 503 1 3882711.0 0.0 1.0 1.0 0 +1 4753350.0 624 504 1 3883755.0 0.0 1.0 1.0 0 +1 4753350.0 624 505 1 3886474.0 0.0 1.0 1.0 0 +1 4753350.0 624 506 1 3893366.0 0.0 1.0 1.0 0 +1 4753350.0 624 507 1 3901348.0 0.0 1.0 1.0 0 +1 4753350.0 624 508 1 3902819.0 0.0 1.0 1.0 0 +1 4753350.0 624 509 1 3906431.0 0.0 1.0 1.0 0 +1 4753350.0 624 510 1 3910189.0 0.0 1.0 1.0 0 +1 4753350.0 624 511 1 3922088.0 0.0 1.0 1.0 0 +1 4753350.0 624 512 1 3924932.0 0.0 1.0 1.0 0 +1 4753350.0 624 513 1 3946291.0 0.0 1.0 1.0 0 +1 4753350.0 624 514 1 3946849.0 0.0 1.0 1.0 0 +1 4753350.0 624 515 1 3950267.5 0.0 1.0 1.0 0 +1 4753350.0 624 516 1 3953454.0 0.0 1.0 1.0 0 +1 4753350.0 624 517 1 3958759.0 0.0 1.0 1.0 0 +1 4753350.0 624 518 1 3971446.0 0.0 1.0 1.0 0 +1 4753350.0 624 519 1 3978854.0 0.0 1.0 1.0 0 +1 4753350.0 624 520 1 3985895.0 0.0 1.0 1.0 0 +1 4753350.0 624 521 1 3989489.0 0.0 1.0 1.0 0 +1 4753350.0 624 522 1 3998452.0 0.0 1.0 1.0 0 +1 4753350.0 624 523 1 4006315.0 0.0 1.0 1.0 0 +1 4753350.0 624 524 1 4007728.0 0.0 1.0 1.0 0 +1 4753350.0 624 525 1 4014243.0 0.0 1.0 1.0 0 +1 4753350.0 624 526 1 4014767.0 0.0 1.0 1.0 0 +1 4753350.0 624 527 1 4017011.0 0.0 1.0 1.0 0 +1 4753350.0 624 528 1 4018421.0 0.0 1.0 0.0 0 +1 4753350.0 624 529 1 4028600.0 0.0 1.0 0.0 0 +1 4753350.0 624 530 1 4036577.5 0.0 1.0 0.0 0 +1 4753350.0 624 531 1 4037700.5 0.0 1.0 0.0 0 +1 4753350.0 624 532 1 4045541.0 0.0 1.0 0.0 0 +1 4753350.0 624 533 1 4055113.0 0.0 1.0 0.0 0 +1 4753350.0 624 534 1 4056067.0 0.0 1.0 0.0 0 +1 4753350.0 624 535 1 4056638.0 0.0 1.0 0.0 0 +1 4753350.0 624 536 1 4060186.0 0.0 1.0 0.0 0 +1 4753350.0 624 537 1 4070547.0 0.0 1.0 0.0 0 +1 4753350.0 624 538 1 4071780.0 0.0 1.0 0.0 0 +1 4753350.0 624 539 1 4072258.0 0.0 1.0 0.0 0 +1 4753350.0 624 540 1 4078175.0 0.0 1.0 1.0 0 +1 4753350.0 624 541 1 4103399.0 0.0 1.0 1.0 0 +1 4753350.0 624 542 1 4105588.0 0.0 1.0 1.0 0 +1 4753350.0 624 543 1 4116024.0 0.0 1.0 1.0 0 +1 4753350.0 624 544 1 4119395.0 0.0 1.0 1.0 0 +1 4753350.0 624 545 1 4128486.5 0.0 1.0 1.0 0 +1 4753350.0 624 546 1 4130043.0 0.0 1.0 1.0 0 +1 4753350.0 624 547 1 4132997.0 0.0 1.0 1.0 0 +1 4753350.0 624 548 1 4134603.0 0.0 1.0 1.0 0 +1 4753350.0 624 549 1 4143994.0 0.0 1.0 1.0 0 +1 4753350.0 624 550 1 4146204.0 0.0 1.0 1.0 0 +1 4753350.0 624 551 1 4154254.0 0.0 1.0 1.0 0 +1 4753350.0 624 552 1 4167571.0 0.0 1.0 1.0 0 +1 4753350.0 624 553 1 4168084.0 0.0 1.0 1.0 0 +1 4753350.0 624 554 1 4174150.0 0.0 1.0 1.0 0 +1 4753350.0 624 555 1 4174929.0 0.0 1.0 1.0 0 +1 4753350.0 624 556 1 4184615.0 0.0 1.0 1.0 0 +1 4753350.0 624 557 1 4200229.0 0.0 1.0 1.0 0 +1 4753350.0 624 558 1 4208724.0 0.0 1.0 1.0 0 +1 4753350.0 624 559 1 4213813.0 0.0 1.0 1.0 0 +1 4753350.0 624 560 1 4216996.0 0.0 1.0 1.0 0 +1 4753350.0 624 561 1 4230831.0 0.0 1.0 1.0 0 +1 4753350.0 624 562 1 4233860.0 0.0 1.0 1.0 0 +1 4753350.0 624 563 1 4236701.0 0.0 1.0 1.0 0 +1 4753350.0 624 564 1 4244962.0 0.0 1.0 1.0 0 +1 4753350.0 624 565 1 4253166.0 0.0 1.0 1.0 0 +1 4753350.0 624 566 1 4254649.0 0.0 1.0 1.0 0 +1 4753350.0 624 567 1 4255627.0 0.0 1.0 1.0 0 +1 4753350.0 624 568 1 4256548.0 0.0 1.0 1.0 0 +1 4753350.0 624 569 1 4282081.0 0.0 1.0 1.0 0 +1 4753350.0 624 570 1 4307180.0 0.0 1.0 1.0 0 +1 4753350.0 624 571 1 4307943.0 0.0 1.0 1.0 0 +1 4753350.0 624 572 1 4344738.0 0.0 1.0 1.0 0 +1 4753350.0 624 573 1 4348150.0 0.0 1.0 1.0 0 +1 4753350.0 624 574 1 4378210.0 0.0 1.0 1.0 0 +1 4753350.0 624 575 1 4388767.0 0.0 1.0 1.0 0 +1 4753350.0 624 576 1 4393246.5 0.0 1.0 1.0 0 +1 4753350.0 624 577 1 4396436.0 0.0 1.0 1.0 0 +1 4753350.0 624 578 1 4425979.0 0.0 1.0 1.0 0 +1 4753350.0 624 579 1 4430102.0 0.0 1.0 1.0 0 +1 4753350.0 624 580 1 4434980.0 0.0 1.0 1.0 0 +1 4753350.0 624 581 1 4441066.0 0.0 1.0 1.0 0 +1 4753350.0 624 582 1 4447044.0 0.0 1.0 1.0 0 +1 4753350.0 624 583 1 4455184.0 0.0 1.0 1.0 0 +1 4753350.0 624 584 1 4458855.0 0.0 1.0 1.0 0 +1 4753350.0 624 585 1 4465699.0 0.0 1.0 1.0 0 +1 4753350.0 624 586 1 4470564.0 0.0 1.0 1.0 0 +1 4753350.0 624 587 1 4477348.0 0.0 1.0 1.0 0 +1 4753350.0 624 588 1 4496647.0 0.0 1.0 1.0 0 +1 4753350.0 624 589 1 4500425.0 0.0 1.0 1.0 0 +1 4753350.0 624 590 1 4503201.5 0.0 1.0 1.0 0 +1 4753350.0 624 591 1 4504903.0 0.0 1.0 0.0 0 +1 4753350.0 624 592 1 4517141.0 0.0 1.0 1.0 0 +1 4753350.0 624 593 1 4531397.0 0.0 1.0 1.0 0 +1 4753350.0 624 594 1 4541380.0 0.0 1.0 1.0 0 +1 4753350.0 624 595 1 4567270.0 0.0 1.0 1.0 0 +1 4753350.0 624 596 1 4569921.0 0.0 1.0 1.0 0 +1 4753350.0 624 597 1 4577868.0 0.0 1.0 1.0 0 +1 4753350.0 624 598 1 4590892.0 0.0 1.0 0.0 0 +1 4753350.0 624 599 1 4592022.0 0.0 1.0 1.0 0 +1 4753350.0 624 600 1 4604106.0 0.0 1.0 1.0 0 +1 4753350.0 624 601 1 4632897.0 0.0 1.0 1.0 0 +1 4753350.0 624 602 1 4653877.0 0.0 1.0 1.0 0 +1 4753350.0 624 603 1 4657868.0 0.0 1.0 1.0 0 +1 4753350.0 624 604 1 4658400.0 0.0 1.0 1.0 0 +1 4753350.0 624 605 1 4665746.0 0.0 1.0 1.0 0 +1 4753350.0 624 606 1 4668337.0 0.0 1.0 1.0 0 +1 4753350.0 624 607 1 4677111.0 0.0 1.0 1.0 0 +1 4753350.0 624 608 1 4680578.5 0.0 1.0 1.0 0 +1 4753350.0 624 609 1 4681147.0 0.0 1.0 1.0 0 +1 4753350.0 624 610 1 4683691.0 0.0 1.0 1.0 0 +1 4753350.0 624 611 1 4698978.0 0.0 1.0 1.0 0 +1 4753350.0 624 612 1 4700428.0 0.0 1.0 1.0 0 +1 4753350.0 624 613 1 4702436.5 0.0 1.0 1.0 0 +1 4753350.0 624 614 1 4705006.0 0.0 1.0 1.0 0 +1 4753350.0 624 615 1 4708196.0 0.0 1.0 1.0 0 +1 4753350.0 624 616 1 4724778.0 0.0 1.0 1.0 0 +1 4753350.0 624 617 1 4725417.0 0.0 1.0 1.0 0 +1 4753350.0 624 618 1 4727183.0 0.0 1.0 1.0 0 +1 4753350.0 624 619 1 4727700.0 0.0 1.0 1.0 0 +1 4753350.0 624 620 1 4731209.0 0.0 1.0 1.0 0 +1 4753350.0 624 621 1 4732628.0 0.0 1.0 0.0 0 +1 4753350.0 624 622 1 4740112.0 0.0 1.0 1.0 0 +1 4753350.0 624 623 1 4743710.0 0.0 1.0 1.0 0 +1 4753350.0 624 624 1 4747257.5 0.0 1.0 1.0 0 +1 4753350.0 624 625 0 4753350.0 0.0 1.0 1.0 10
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/xml_configuration_file.xmap Fri Jan 06 22:10:44 2023 +0000 @@ -0,0 +1,12 @@ +# hostname=6d61d934e61b +# $ cd /HybridScaffold; /RefAligner/amd2/RefAligner -o /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD -stdout -stderr -i /data/jwd03f/main/053/913/53913897/working/assignAlignType/assignAlignType_q.cmap -ref /data/jwd03f/main/053/913/53913897/working/align_final/step2.hybrid.cmap -maxmem 250 -maxthreads 24 -maxvirtmem 250 -RAmem 3 1 -res 2.9 -FP 0.6 -FN 0.06 -sf 0.20 -sd 0.0 -sr 0.01 -extend 1 -outlier 0.0001 -endoutlier 0.001 -PVendoutlier -deltaX 6 -deltaY 6 -xmapchim 12 -hashgen 5 7 2.4 1.5 0.05 5.0 1 1 4 -hash -hashdelta 26 10 46 -hashMultiMatch 30 10 -insertThreads 24 -nosplit 2 -biaswt 0 -T 1e-10 -S -1000 -indel -PVres 2 -rres 0.9 -MaxSE 0.5 -HSDrange 1.0 -outlierBC -xmapUnique 14 -AlignRes 2. -outlierExtend 6 24 -Kmax 6 -resEstimate -BestRef 1 -f -mres 0.9 +# CompileDir= /home/users/sqa01/RefAlignerBuild/branches/12432.12463rel/12432.12463rel CompileCmd=/opt/gcc-9.3.0/bin/g++ -B/opt/binutils-2.34 -fopenmp -Ofast -march=znver2 -mavx2 -mfpmath=sse -DUSE_PFLOAT=1 -DUSE_RFLOAT=1 -DUSE_SSE=1 -DUSE_MFLOAT=1 -DUSE_EPOW=2 -I/home/users8/tanantharaman/sleef-081120/build/include -I/opt/glibc-2.31/include -DUSE_STATIC -freciprocal-math -fno-signed-zeros -fno-trapping-math -fno-tree-vectorize -mtune=znver2 -fno-lto-odr-type-merging -DRELEASE=1 -std=gnu++98 -Wl,--dynamic-linker=/opt/glibc-2.31/lib/ld-linux-x86-64.so.2 -Wl,--rpath=/opt/glibc-2.31/lib -Wl,--rpath=/opt/gcc-9.3.0/lib64 -lsleefinline -lrt -lmvec -L/home/users8/tanantharaman/sleef-081120/build/lib -L/opt/glibc-2.31/lib -L/opt/gcc-9.3.0/lib64 -static -static-libstdc++ -static-libgcc -s SVNversion=12463 $Header: http://svn.bnm.local:81/svn/Informatics/RefAligner/branches/12432/RefAligner.cpp 12458 2021-10-24 00:56:45Z tanantharaman $ +# FLAGS: USE_SSE=1 USE_AVX=1 USE_MIC=0 USE_PFLOAT=1 USE_RFLOAT=1 USE_MFLOAT=1 USE_EPOW=2 DEBUG=1 VERB=1 +# XMAP File Version: 0.2 +# Label Channels: 1 +# Reference Maps From: /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD_r.cmap +# Query Maps From: /data/jwd03f/main/053/913/53913897/working/align_final/bionano_bppAdjust_cmap_ngs_fasta_BNGcontigs_HYBRID_SCAFFOLD_q.cmap +#h XmapEntryID QryContigID RefContigID QryStartPos QryEndPos RefStartPos RefEndPos Orientation Confidence HitEnum QryLen RefLen LabelChannel Alignment +#f int int int float float float float string float string float float int string +1 4 1 20.0 715071.0 19489.5 743436.5 + 92.15 7M1D12M1D8M1D2M1D9M1D4M1D10M1D1M1D23M1D2M1D5M 715091.0 4753350.0 1 (3,1)(4,2)(5,3)(6,4)(7,5)(8,6)(9,7)(10,8)(11,8)(12,9)(13,10)(14,11)(15,12)(16,13)(17,14)(18,15)(19,16)(20,17)(21,18)(22,19)(24,20)(25,21)(26,22)(27,23)(28,24)(29,25)(30,26)(31,27)(33,28)(34,29)(35,30)(36,30)(37,31)(38,32)(39,33)(40,34)(41,35)(42,36)(43,37)(44,38)(45,39)(46,39)(47,40)(48,41)(49,42)(51,43)(52,44)(53,45)(54,46)(55,47)(56,48)(57,49)(58,50)(59,51)(60,52)(62,53)(63,54)(64,54)(65,55)(66,56)(67,57)(68,58)(69,59)(70,60)(71,61)(72,62)(73,63)(74,64)(75,65)(76,66)(77,67)(78,68)(79,69)(80,70)(81,71)(82,72)(83,73)(84,74)(85,75)(86,76)(87,77)(88,77)(89,78)(90,79)(91,79)(92,80)(93,81)(94,82)(95,83) +2 1 1 20.0 3855049.5 765981.0 4747257.5 + 455.85 10M1D5M1D8M1D5M1I1D16M2I3D1M1D6M1D1M1D19M1D6M1D27M1D8M1D14M1D10M1D3M1I1M1D1M1D4M1D2M1D13M1D1M1D1M2D3M1D3M1D1M1D21M1D9M1D4M4I2D4M1D5M1D5M1D2M1D2M4I11M1D6M1D3M1D3M1D5M1D1M3I1M1D12M1D7M1D9M12D11M1D3M1D6M1D2M1D1M1D3M1D2M1D4M1D7M1D11M1D6M1D1M3D1M2D9M2I1D9M1D1M1D2M12D5M1D6M1D1M1D10M1D1M1D2M1D20M1D6M1D4M1D4M1D2M1D4M1D1M1D2M1D3M 3879935.1 4753350.0 1 (96,1)(97,2)(98,3)(99,4)(100,5)(101,6)(102,7)(103,8)(104,9)(105,10)(106,11)(107,11)(108,12)(109,13)(110,14)(111,15)(112,16)(113,16)(114,17)(115,18)(116,19)(117,20)(118,21)(119,22)(120,23)(121,24)(122,24)(123,25)(124,26)(125,27)(126,28)(127,30)(128,30)(129,31)(130,32)(131,33)(132,34)(133,35)(134,36)(135,37)(136,38)(137,39)(138,40)(139,41)(140,42)(141,43)(142,44)(143,45)(146,48)(147,48)(148,49)(149,49)(150,50)(151,51)(152,52)(153,53)(154,54)(155,55)(156,55)(157,56)(158,56)(159,57)(160,58)(161,59)(162,60)(163,61)(164,62)(165,63)(166,64)(167,65)(168,66)(169,67)(170,68)(171,69)(172,70)(173,71)(174,72)(175,73)(176,74)(177,75)(178,75)(179,76)(180,77)(181,78)(182,79)(183,80)(184,81)(185,81)(186,82)(187,83)(188,84)(189,85)(190,86)(191,87)(192,88)(193,89)(194,90)(195,91)(196,92)(197,93)(198,94)(199,95)(200,96)(201,97)(202,98)(203,99)(204,100)(205,101)(206,102)(207,103)(208,104)(209,105)(210,106)(211,107)(212,108)(213,108)(214,109)(215,110)(216,111)(217,112)(218,113)(219,114)(220,115)(221,116)(222,116)(223,117)(224,118)(225,119)(226,120)(227,121)(228,122)(229,123)(230,124)(231,125)(232,126)(233,127)(234,128)(235,129)(236,130)(237,130)(238,131)(239,132)(240,133)(241,134)(242,135)(243,136)(244,137)(245,138)(246,139)(248,140)(249,141)(250,142)(251,144)(252,145)(253,145)(254,146)(255,146)(256,147)(257,148)(258,149)(259,150)(260,150)(261,151)(263,152)(264,153)(265,154)(266,155)(267,156)(268,157)(269,158)(270,159)(271,160)(272,161)(273,162)(274,163)(275,164)(276,165)(277,165)(278,166)(279,166)(280,167)(282,167)(283,168)(284,169)(285,170)(286,170)(287,171)(288,172)(290,173)(291,174)(292,174)(293,175)(294,176)(295,177)(296,178)(297,179)(298,180)(299,181)(300,182)(301,183)(302,184)(303,185)(304,186)(305,187)(306,188)(307,189)(308,190)(309,191)(310,192)(311,193)(312,194)(313,195)(314,195)(315,196)(316,197)(317,198)(318,199)(319,200)(320,201)(321,202)(322,203)(324,204)(325,205)(326,206)(327,207)(329,212)(330,212)(331,213)(332,214)(333,215)(334,216)(335,216)(336,217)(337,218)(338,219)(339,220)(340,221)(341,221)(342,222)(343,223)(344,224)(345,225)(346,226)(347,226)(348,227)(349,228)(350,228)(351,229)(352,234)(353,235)(354,236)(355,237)(356,238)(357,239)(358,240)(359,241)(360,242)(361,243)(362,244)(363,245)(364,245)(365,246)(366,247)(367,248)(368,249)(369,250)(371,251)(372,252)(373,253)(374,254)(375,254)(376,255)(377,256)(378,257)(379,257)(380,258)(381,259)(382,260)(383,261)(384,262)(385,262)(386,266)(387,267)(388,267)(389,268)(390,269)(391,270)(392,271)(393,272)(394,273)(395,274)(396,275)(397,276)(398,277)(399,278)(401,279)(402,280)(403,281)(404,282)(405,283)(406,284)(407,285)(408,286)(409,286)(410,287)(411,288)(412,289)(413,290)(414,291)(415,292)(416,293)(417,294)(430,295)(431,296)(432,297)(433,298)(434,299)(435,300)(436,301)(437,302)(438,303)(439,304)(440,305)(441,306)(442,306)(443,307)(444,308)(445,309)(446,309)(447,310)(448,311)(449,312)(450,313)(451,314)(452,315)(453,315)(454,316)(456,317)(457,318)(458,318)(459,319)(460,320)(462,321)(463,322)(465,323)(466,324)(467,325)(468,326)(469,327)(470,327)(471,328)(472,329)(473,330)(474,331)(475,332)(476,333)(477,334)(478,334)(479,335)(480,336)(481,337)(482,338)(483,339)(484,340)(485,341)(486,342)(487,343)(488,344)(489,345)(490,345)(491,346)(492,347)(493,348)(494,349)(495,350)(497,351)(499,352)(501,352)(502,353)(504,353)(505,354)(506,355)(507,356)(508,357)(509,358)(510,359)(511,360)(512,361)(513,364)(514,364)(515,365)(516,366)(517,367)(518,368)(519,369)(520,370)(521,371)(522,372)(523,373)(524,373)(525,374)(526,374)(527,375)(540,376)(541,377)(542,378)(543,379)(544,380)(545,381)(546,381)(547,382)(548,383)(549,384)(550,385)(551,386)(552,387)(553,387)(554,388)(555,388)(556,389)(557,390)(558,391)(559,392)(560,393)(561,394)(562,395)(563,396)(564,397)(565,398)(566,398)(567,399)(568,399)(569,400)(570,401)(571,401)(572,402)(573,403)(574,404)(575,405)(576,406)(577,407)(578,408)(579,409)(580,410)(581,411)(582,412)(583,413)(584,414)(585,415)(586,416)(587,417)(588,418)(589,419)(590,420)(592,421)(593,422)(594,423)(595,424)(596,425)(597,426)(599,427)(600,428)(601,429)(602,430)(603,431)(604,431)(605,432)(606,433)(607,434)(608,435)(609,435)(610,436)(611,437)(612,437)(613,438)(614,439)(615,440)(616,441)(617,441)(618,442)(619,442)(620,443)(622,444)(623,445)(624,446)