Mercurial > repos > iuc > chopper
changeset 3:3f4f192666f4 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/chopper commit f25e203bf4e1d06d021b9a12007431c6e1a33347
| author | iuc |
|---|---|
| date | Thu, 11 Dec 2025 19:38:48 +0000 |
| parents | 08a6063d8c7c |
| children | |
| files | chopper.xml test-data/wrapping_as_sanger.fastqsanger test-data/wrapping_as_sanger.fastqsanger.gz |
| diffstat | 3 files changed, 134 insertions(+), 102 deletions(-) [+] |
line wrap: on
line diff
--- a/chopper.xml Mon Nov 17 12:23:42 2025 +0000 +++ b/chopper.xml Thu Dec 11 19:38:48 2025 +0000 @@ -1,52 +1,52 @@ <tool id="chopper" name="Chopper" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="23.2"> - <description>Filtering and trimming of long reads.</description> - <macros> - <token name="@TOOL_VERSION@">0.12.0</token> - <token name="@VERSION_SUFFIX@">0</token> - </macros> - <requirements> - <requirement type="package" version="@TOOL_VERSION@">chopper</requirement> - </requirements> - <version_command>chopper --version</version_command> - <command detect_errors="exit_code"><![CDATA[ + <description>Filtering and trimming of long reads.</description> + <macros> + <token name="@TOOL_VERSION@">0.12.0</token> + <token name="@VERSION_SUFFIX@">1</token> + </macros> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">chopper</requirement> + </requirements> + <version_command>chopper --version</version_command> + <command detect_errors="exit_code"><![CDATA[ chopper --input $input #if $contam - --contam $contam + --contam $contam #end if #if $option_params.quality - --quality $option_params.quality.value + --quality $option_params.quality.value #end if #if $option_params.maxqual - --maxqual $option_params.maxqual.value + --maxqual $option_params.maxqual.value #end if #if $option_params.minlength - --minlength $option_params.minlength.value + --minlength $option_params.minlength.value #end if #if $option_params.maxlength - --maxlength $option_params.maxlength.value + --maxlength $option_params.maxlength.value #end if #if $option_params.headcrop - --headcrop $option_params.headcrop.value + --headcrop $option_params.headcrop.value #end if #if $option_params.tailcrop - --tailcrop $option_params.tailcrop.value + --tailcrop $option_params.tailcrop.value #end if #if $option_params.mingc - --mingc $option_params.mingc.value + --mingc $option_params.mingc.value #end if #if $option_params.maxgc - --maxgc $option_params.maxgc.value + --maxgc $option_params.maxgc.value #end if ##output capture @@ -54,90 +54,110 @@ $output_params.inverse #end if - #if $output_params.gzip == "no" - > $fq_filt + + #if str($input.ext).endswith("gz") + | gzip > $fq_filt #else - | gzip > $fq_filt_gz + > $fq_filt #end if ]]></command> - <inputs> - <param argument="--input" type="data" label="FASTQ file to check" format="fastq,fastq.gz,fastqsanger.gz,fastqsanger" /> - <param argument="--contam" type="data" format="fasta" optional="True" label="Reference FASTA" help="FASTA file with reference to check potential contaminants against."/> - - <section name="option_params" title="Optional Parameters" expanded="True"> - <param argument="--quality" type="integer" label="Minimal quality score" value="0" min="0" max="60" help="Sets a minimum Phred average quality score."/> - <param argument="--maxqual" type="integer" label="Maximal quality score" value="60" min="0" max="60" help="Sets a maximum Phred average quality score."/> - <param argument="--minlength" type="integer" label="Sets a minimum read length" value="1" min="1" help="Minimal length of read to keep." optional="True"/> - <param argument="--maxlength" type="integer" label="Sets a maximum read length" help="Maximal length of read to keep" optional="True"/> - <param argument="--headcrop" type="integer" optional="True" label="Headcrop" value="0" min="0" help="Trim N nucleotides from the start of a read."/> - <param argument="--tailcrop" type="integer" optional="True" label="Tailcrop" value="0" min="0" help="Trim N nucleotides from the end of a read."/> - <param argument="--mingc" type="float" optional="True" label="Minimum GC content" value="0.0" min="0.0" max="1.0" help="Sets a minimum GC content for reads to keep."/> - <param argument="--maxgc" type="float" optional="True" label="Maximum GC content" value="1.0" min="0.0" max="1.0" help="Sets a maximum GC content for reads to keep."/> - <param argument="--trim" type="integer" label="Q-score cutoff to trim read ends" value="0" min="0" max="60" help="Takes a quality score and will trim the ends of the reads if they are below the specified cut-off (window-size = 1)."/> - </section> - - <section name="output_params" title="Output Parameters" expanded="False"> - <param argument="--inverse" type="boolean" checked="false" truevalue="--inverse" falsevalue="" label="Output the opposite of the normal results" help="Reverse the output results (aka, the 'failed reads')"/> - <param name="gzip" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Gzip output data" help="Set to 'no' to NOT gzip the output file [default gzip output]."/> - </section> - </inputs> + <inputs> + <param argument="--input" type="data" label="FASTQ file to check" format="fastqsanger.gz,fastqsanger" /> + <param argument="--contam" type="data" format="fasta" optional="True" label="Reference FASTA" help="FASTA file with reference to check potential contaminants against."/> - <outputs> - <data name="fq_filt_gz" format="fastq.gz" label="${tool.name} on ${input.name} ($on_string), gzipped" > - <filter> output_params['gzip'] is True </filter> - </data> - <data name="fq_filt" format="fastq" label="${tool.name} on ${input.name} ($on_string)" > - <filter> output_params['gzip'] is False </filter> - </data> - </outputs> - - <tests> - <test expect_num_outputs="1"> - <param name="input" value="other-test.fastq"/> - <section name="output_params"> - <param name="gzip" value="false"/> - </section> - <output name="fq_filt"> - <assert_contents> - <has_text text="@35febf09-dcbc-424c-987e-9f3f80fe73a5"/> - <has_text text="@3fda06e9-62ef-4448-9993-b90124a793d5"/> - <has_text text="@19d9337f-4fb6-46e5-b484-14d05f562506"/> - </assert_contents> - </output> - </test> - <test expect_num_outputs="1"> - <param name="input" value="other-test.fastq"/> - <param name="contam" value="random_contam.fa"/> - <output name="fq_filt" ftype="fastq.gz" decompress="true"> <!-- file="out2.fq.gz"/> --> - <assert_contents> - <has_text text="@35febf09-dcbc-424c-987e-9f3f80fe73a5"/> - <has_text text="@3fda06e9-62ef-4448-9993-b90124a793d5"/> - <has_text text="@19d9337f-4fb6-46e5-b484-14d05f562506"/> - </assert_contents> - </output> - </test> - <test expect_num_outputs="1"> - <param name="input" value="testGC.fastq"/> - <section name="option_params"> - <param name="mingc" value="0.3"/> - <param name="maxgc" value="0.8"/> - </section> - <section name="output_params"> - <param name="gzip" value="false"/> - </section> - <output name="fq_filt" > - <assert_contents> - <not_has_text text='@GC20'/> - <not_has_text text='@GC0'/> - <not_has_text text='@GC100'/> - <has_text text='@GC50'/> - <has_text text='@GC80'/> - </assert_contents> - </output> - </test> - </tests> - <help><![CDATA[ + <section name="option_params" title="Optional Parameters" expanded="True"> + <param argument="--quality" type="integer" label="Minimal quality score" value="0" min="0" max="60" help="Sets a minimum Phred average quality score."/> + <param argument="--maxqual" type="integer" label="Maximal quality score" value="60" min="0" max="60" help="Sets a maximum Phred average quality score."/> + <param argument="--minlength" type="integer" label="Sets a minimum read length" value="1" min="1" help="Minimal length of read to keep." optional="True"/> + <param argument="--maxlength" type="integer" label="Sets a maximum read length" help="Maximal length of read to keep" optional="True"/> + <param argument="--headcrop" type="integer" optional="True" label="Headcrop" value="0" min="0" help="Trim N nucleotides from the start of a read."/> + <param argument="--tailcrop" type="integer" optional="True" label="Tailcrop" value="0" min="0" help="Trim N nucleotides from the end of a read."/> + <param argument="--mingc" type="float" optional="True" label="Minimum GC content" value="0.0" min="0.0" max="1.0" help="Sets a minimum GC content for reads to keep."/> + <param argument="--maxgc" type="float" optional="True" label="Maximum GC content" value="1.0" min="0.0" max="1.0" help="Sets a maximum GC content for reads to keep."/> + <param argument="--trim" type="integer" label="Q-score cutoff to trim read ends" value="0" min="0" max="60" help="Takes a quality score and will trim the ends of the reads if they are below the specified cut-off (window-size = 1)."/> + </section> + <section name="output_params" title="Output Parameters" expanded="False"> + <param argument="--inverse" type="boolean" checked="false" truevalue="--inverse" falsevalue="" label="Output the opposite of the normal results" help="Reverse the output results (aka, the 'failed reads')"/> + </section> + </inputs> + <outputs> + <data name="fq_filt" format_source="input" label="${tool.name} on ${on_string}" /> + </outputs> + <tests> + <!-- 1) --> + <test expect_num_outputs="1"> + <param name="input" ftype="fastqsanger" value="other-test.fastq"/> + <output name="fq_filt" ftype="fastqsanger"> + <assert_contents> + <has_text text="@35febf09-dcbc-424c-987e-9f3f80fe73a5"/> + <has_text text="@3fda06e9-62ef-4448-9993-b90124a793d5"/> + <has_text text="@19d9337f-4fb6-46e5-b484-14d05f562506"/> + </assert_contents> + </output> + </test> + <!-- 2) --> + <test expect_num_outputs="1"> + <param name="input" ftype="fastqsanger" value="other-test.fastq"/> + <param name="contam" value="random_contam.fa"/> + <output name="fq_filt" ftype="fastqsanger"> + <assert_contents> + <has_text text="@35febf09-dcbc-424c-987e-9f3f80fe73a5"/> + <has_text text="@3fda06e9-62ef-4448-9993-b90124a793d5"/> + <has_text text="@19d9337f-4fb6-46e5-b484-14d05f562506"/> + </assert_contents> + </output> + </test> + <!-- 3) --> + <test expect_num_outputs="1"> + <param name="input" ftype="fastqsanger" value="testGC.fastq"/> + <section name="option_params"> + <param name="mingc" value="0.3"/> + <param name="maxgc" value="0.8"/> + </section> + <output name="fq_filt" ftype="fastqsanger"> + <assert_contents> + <not_has_text text='@GC20'/> + <not_has_text text='@GC0'/> + <not_has_text text='@GC100'/> + <has_text text='@GC50'/> + <has_text text='@GC80'/> + </assert_contents> + </output> + </test> + <!-- 4) fastqsanger --> + <test expect_num_outputs="1"> + <param name="input" ftype="fastqsanger" value="wrapping_as_sanger.fastqsanger"/> + <section name="option_params"> + <param name="maxlength" value="136"/> + </section> + <output name="fq_filt" ftype="fastqsanger"> + <assert_contents> + <not_has_text text='@SRR014849.203935'/> + <has_text text='@SRR014849.50939'/> + <has_text text='@SRR014849.110027'/> + </assert_contents> + </output> + </test> + <!-- 5) fastqsanger.gz --> + <test expect_num_outputs="1"> + <param name="input" ftype="fastqsanger.gz" value="wrapping_as_sanger.fastqsanger.gz"/> + <section name="option_params"> + <param name="maxlength" value="136"/> + </section> + <output name="fq_filt" ftype="fastqsanger.gz" decompress="true"> + <assert_contents> + <not_has_text text='@SRR014849.203935'/> + <has_text text='@SRR014849.50939'/> + <has_text text='@SRR014849.110027'/> + </assert_contents> + </output> + <assert_stderr> + <has_text text="Kept 2 reads out of 3 reads"/> + </assert_stderr> + </test> + </tests> + <help><![CDATA[ **Chopper** Rust implementation of NanoFilt+NanoLyse, both originally written in Python. This tool, intended for long read sequencing such as PacBio or ONT, filters and trims a fastq file. @@ -151,8 +171,8 @@ .. _Chopper on GitHub: https://github.com/wdecoster/chopper - ]]></help> - <citations> - <citation type="doi">10.1093/bioinformatics/btad311</citation> - </citations> + ]]></help> + <citations> + <citation type="doi">10.1093/bioinformatics/btad311</citation> + </citations> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/wrapping_as_sanger.fastqsanger Thu Dec 11 19:38:48 2025 +0000 @@ -0,0 +1,12 @@ +@SRR014849.50939 EIXKN4201BA2EC length=135 +GAAATTTCAGGGCCACCTTTTTTTTGATAGAATAATGGAGAAAATTAAAAGCTGTACATATACCAATGAACAATAAATCAATACATAAAAAAGGAGAAGTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGG ++ +;C?-EA/=<EA/B;<B;D>60,)%"<=:5<@8<B;=B;<;EA4'@8FB6*<:=<<===<=;=B:A9<<B;=B;=EA0:<B:<<=<<FA81+$?6;<A9=<3>5@7@8<A<(B=*A=)<<2?57B=*B=*D?-:=4 +@SRR014849.110027 EIXKN4201APUB0 length=131 +CTTCAAATGATTCCGGGACTGTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTTCGGTTCCAACTCGCCGTCCGAATAATCCGTTCAAAATCTTGGCCTGTCAAAACGACTTTACGACCAGAACGATCCG ++ +=B::@<':=5A9?7EA0:=<<?6@7<3?5<@;%D?-B=)::0=4<D?-EA/D@2";B;B:B:A9;;=<B;;<B;<B;<B;:A;<A;8FB7+=<B;B:A9<1:=FB6(<=<<EA0956;<2==A8===:@8= +@SRR014849.203935 EIXKN4201B4HU6 length=144 +AACCCGTCCCATCAAAGATTTTGGTTGGAACCCGAAAGGGTTTTGAATTCAAACCCCTTTCGGTTCCAACTATTCAATTGTTTAACTTTTTTTAAATTGATGGTCTGTTGGACCATTTGTAATAATCCCCATCGGAATTTCTTT ++ +A;@;%75?:#<<9EA1;=EA3%B;B;A;B;@;%9EA1EA1EA3%<B;A;8EA0D@3$EA1=B;A;B;B;:=:B;:B:A9:EA0A9<FA81+&"D?-B;4<::/<;=:A98-5?6=C>+8<<3;=4:DA3%<;=8-9.A=):B=*