diff detect_circular_sequences.xml @ 0:faec698e3f98 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/detect_circular_sequences commit 7ea9f729b44c6351c52b6295c780f496d239488e

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/detect_circular_sequences.xml	Thu Dec 11 08:53:37 2025 +0000
@@ -0,0 +1,65 @@
+<tool id="detect_circular_sequences" name="Detect circular sequences" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+    <description>(e.g. circular contigs) in a FASTA file</description>
+    <macros>
+        <token name="@TOOL_VERSION@">1.0</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+        <token name="@PROFILE@">24.0</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="3.13">python</requirement>
+        <requirement type="package" version="1.86">biopython</requirement>
+    </requirements>
+    <command><![CDATA[
+python '${__tool_directory__}/detect_circular_sequences.py'
+    --fasta-in '$fasta_in'
+    --subseq-length $subseq_length
+    --duplication-length $duplication_length
+    --verbose $verbose
+    --fasta-out '$fasta_out'
+    --id-out '$id_out'
+    ]]></command>
+    <inputs>
+        <param argument="--fasta-in" type="data" format="fasta" label="Input FASTA file"/>
+        <param argument="--subseq-length" type="integer" min="0" value="10" label="Length of 3' fragment to check on the 5' end"/>
+        <param argument="--duplication-length" type="integer" min="0" value="1000" label="Length of the 3' end fragment to duplicate and add on the 5' end"/>
+        <param argument="--verbose" type="select" label="Verbosity level">
+            <option value="0">CRITICAL</option>
+            <option value="1">ERROR</option>
+            <option value="2">WARN</option>
+            <option value="3" selected="true">INFO</option>
+            <option value="4">DEBUG</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="fasta_out" format="fasta" label="${tool.name} on ${on_string}: Extended circular sequences"/>
+        <data name="id_out" format="txt" label="${tool.name} on ${on_string}: Circular sequence IDs"/>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="2">
+            <param name="fasta_in" value="input.fasta"/>
+            <param name="subseq_length" value="10"/>
+            <param name="duplication_length" value="1000"/>
+            <param name="verbose" value="3"/>
+            <output name="fasta_out">
+                <assert_contents>
+                    <has_text text=">SRR17300492_25544"/>
+                    <has_text text="GCGATCCAACTGAACCGGATCTAGAGCCGTGGGGTCAACCGC"/>
+                </assert_contents>
+            </output>
+            <output name="id_out">
+                <assert_contents>
+                    <has_text text="SRR17300492_25544"/>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help><![CDATA[
+This tool detects circular contigs by looking for exact identical subsequences at the two
+ends of the sequences provided in a FASTA file and output the circular contigs 
+extended on 5' end by duplication of the first nucleotides on 3' end to be able 
+to predict genes spanning the origin of circular contigs.
+
+Inspired by Simon Roux work for Metavir2 (2014) and Corentin Hochart work in PlasSuite
+    ]]></help>
+</tool>
\ No newline at end of file