Mercurial > repos > iuc > extract_genomic_dna
diff extract_genomic_dna.xml @ 0:8dd8e89c0603 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/extract_genomic_dna commit b'67cff25a50ba173b0468819204d0999496f68ea9'
| author | iuc |
|---|---|
| date | Tue, 19 Jan 2016 09:34:23 -0500 |
| parents | |
| children | 9af3f57e50b9 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/extract_genomic_dna.xml Tue Jan 19 09:34:23 2016 -0500 @@ -0,0 +1,202 @@ +<tool id="Extract genomic DNA 1" name="Extract Genomic DNA" version="3.0.0"> + <description>using coordinates from assembled/unassembled genomes</description> + <requirements> + <requirement type="package" version="0.7.1">bx-python</requirement> + <requirement type="package" version="35x1">faToTwoBit</requirement> + </requirements> + <command> + <![CDATA[ + #set genome = $input.metadata.dbkey + #set datatype = $input.datatype + mkdir -p output_dir && + python $__tool_directory__/extract_genomic_dna.py + --input "$input" + --genome "$genome" + #if $input.is_of_type("gff"): + --input_format "gff" + --columns "1,4,5,7" + --interpret_features $interpret_features + #else: + --input_format "interval" + --columns "${input.metadata.chromCol},${input.metadata.startCol},${input.metadata.endCol},${input.metadata.strandCol},${input.metadata.nameCol}" + #end if + --reference_genome_source $reference_genome_cond.reference_genome_source + #if str($reference_genome_cond.reference_genome_source) == "cached" + --reference_genome $reference_genome_cond.reference_genome.fields.path + #else: + --reference_genome $reference_genome_cond.reference_genome + #end if + --output_format $output_format + --output $output + ]]> + </command> + <inputs> + <param name="input" type="data" format="gff,interval" label="Fetch sequences for intervals in"> + <validator type="unspecified_build" /> + </param> + <param name="interpret_features" type="select" label="Interpret features when possible" help="Applicable only when input dataset format is in the gff family"> + <option value="yes">Yes</option> + <option value="no">No</option> + </param> + <conditional name="reference_genome_cond"> + <param name="reference_genome_source" type="select" label="Choose the source for the reference genome"> + <option value="cached">locally cached</option> + <option value="history">from history</option> + </param> + <when value="cached"> + <param name="reference_genome" type="select" label="Using reference genome"> + <options from_data_table="twobit"> + <filter type="data_meta" key="dbkey" ref="input" column="0"/> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> + <param name="reference_genome" type="data" format="fasta" label="Using reference genome"> + <options> + <filter type="data_meta" key="dbkey" ref="input"/> + </options> + <validator type="no_options" message="The current history does not include a fasta dataset with the build associated with the selected input file"/> + </param> + </when> + </conditional> + <param name="output_format" type="select" label="Select output format"> + <option value="fasta" selected="True">fasta</option> + <option value="interval">interval</option> + </param> + </inputs> + <outputs> + <data name="output" format="gff"> + <change_format> + <when output_format="interval" format="interval" /> + </change_format> + </data> + </outputs> + <tests> + <test> + <param name="input" value="1.bed" dbkey="hg17" ftype="bed" /> + <param name="interpret_features" value="yes"/> + <param name="index_source" value="cached"/> + <param name="out_format" value="fasta"/> + <output name="out_file1" file="extract_genomic_dna_out1.fasta" compare="contains" /> + </test> + <test> + <param name="input" value="droPer1.bed" dbkey="droPer1" ftype="bed" /> + <param name="interpret_features" value="yes"/> + <param name="index_source" value="cached"/> + <param name="out_format" value="fasta"/> + <output name="out_file1" file="extract_genomic_dna_out2.fasta" compare="contains" /> + </test> + <test> + <param name="input" value="1.bed" dbkey="hg17" ftype="bed" /> + <param name="interpret_features" value="yes"/> + <param name="index_source" value="cached"/> + <param name="out_format" value="interval"/> + <output name="out_file1" file="extract_genomic_dna_out3.interval" compare="contains" /> + </test> + <!-- Test GFF file support. --> + <test> + <param name="input" value="gff_filter_by_attribute_out1.gff" dbkey="mm9" ftype="gff" /> + <param name="interpret_features" value="no"/> + <param name="index_source" value="cached"/> + <param name="out_format" value="interval"/> + <output name="out_file1" file="extract_genomic_dna_out4.gff" compare="contains" /> + </test> + <test> + <param name="input" value="gff_filter_by_attribute_out1.gff" dbkey="mm9" ftype="gff" /> + <param name="interpret_features" value="no"/> + <param name="out_format" value="fasta"/> + <param name="index_source" value="cached"/> + <output name="out_file1" file="extract_genomic_dna_out5.fasta" compare="contains" /> + </test> + <!-- Test custom sequences support and GFF feature interpretation. --> + <test> + <param name="input" value="cufflinks_out1.gtf" dbkey="mm9" ftype="gff" /> + <param name="interpret_features" value="no"/> + <param name="index_source" value="history"/> + <param name="ref_file" value="tophat_in1.fasta"/> + <param name="out_format" value="fasta"/> + <output name="out_file1" file="extract_genomic_dna_out6.fasta" compare="contains" /> + </test> + <test> + <param name="input" value="cufflinks_out1.gtf" dbkey="mm9" ftype="gff" /> + <param name="interpret_features" value="yes"/> + <param name="index_source" value="history"/> + <param name="ref_file" value="tophat_in1.fasta"/> + <param name="out_format" value="fasta"/> + <output name="out_file1" file="extract_genomic_dna_out7.fasta" compare="contains" /> + </test> + </tests> + <help> + +.. class:: warningmark + +This tool requires interval or gff (special tabular formatted data). If your data is not TAB delimited, first use *Text Manipulation->Convert*. + +.. class:: warningmark + +Make sure that the genome build is specified for the dataset from which you are extracting sequences (click the pencil icon in the history item if it is not specified). + +.. class:: warningmark + +All of the following will cause a line from the input dataset to be skipped and a warning generated. The number of warnings and skipped lines is documented in the resulting history item. + - Any lines that do not contain at least 3 columns, a chromosome and numerical start and end coordinates. + - Sequences that fall outside of the range of a line's start and end coordinates. + - Chromosome, start or end coordinates that are invalid for the specified build. + - Any lines whose data columns are not separated by a **TAB** character ( other white-space characters are invalid ). + +.. class:: infomark + + **Extract genomic DNA using coordinates from ASSEMBLED genomes and UNassembled genomes** previously were achieved by two separate tools. + +----- + +**What it does** + +This tool uses coordinate, strand, and build information to fetch genomic DNAs in FASTA or interval format. + +If strand is not defined, the default value is "+". + +----- + +**Example** + +If the input dataset is:: + + chr7 127475281 127475310 NM_000230 0 + + chr7 127485994 127486166 NM_000230 0 + + chr7 127486011 127486166 D49487 0 + + +Extracting sequences with **FASTA** output data type returns:: + + >hg17_chr7_127475281_127475310_+ NM_000230 + GTAGGAATCGCAGCGCCAGCGGTTGCAAG + >hg17_chr7_127485994_127486166_+ NM_000230 + GCCCAAGAAGCCCATCCTGGGAAGGAAAATGCATTGGGGAACCCTGTGCG + GATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATC + CAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAG + GATCAATGACATTTCACACACG + >hg17_chr7_127486011_127486166_+ D49487 + TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGG + CCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGA + CACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCAC + ACACG + +Extracting sequences with **Interval** output data type returns:: + + chr7 127475281 127475310 NM_000230 0 + GTAGGAATCGCAGCGCCAGCGGTTGCAAG + chr7 127485994 127486166 NM_000230 0 + GCCCAAGAAGCCCATCCTGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG + chr7 127486011 127486166 D49487 0 + TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG + + </help> + <citations> + <citation type="bibtex"> + @unpublished{None, + author = {Guru Ananda,Greg Von Kuster}, + title = {None}, + year = {None}, + eprint = {None}, + url = {http://www.bx.psu.edu/~anton/labSite/} + }</citation> + </citations> +</tool>