Mercurial > repos > iuc > extract_metaphlan_database
changeset 2:b6ecdfac241f draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/metaphlan/ commit f1c6f4fe1e572ace84cf9106bc253603f55aac55"
| author | iuc | 
|---|---|
| date | Mon, 14 Jun 2021 12:47:06 +0000 | 
| parents | 1aaa9b943a83 | 
| children | c11805a111ea | 
| files | formatoutput.py macros.xml test-data/no_taxon_input.fasta | 
| diffstat | 3 files changed, 9 insertions(+), 3 deletions(-) [+] | 
line wrap: on
 line diff
--- a/formatoutput.py Mon May 17 20:08:58 2021 +0000 +++ b/formatoutput.py Mon Jun 14 12:47:06 2021 +0000 @@ -57,7 +57,9 @@ # skip headers if line.startswith("#"): continue - + # skip UNKNOWN lines in Predicted taxon relative abundances + if "UNKNOWN" in line: + continue # spit lines split_line = line[:-1].split('\t') taxo_n = split_line[0].split('|')
--- a/macros.xml Mon May 17 20:08:58 2021 +0000 +++ b/macros.xml Mon Jun 14 12:47:06 2021 +0000 @@ -1,6 +1,6 @@ <?xml version="1.0"?> <macros> - <token name="@TOOL_VERSION@">3.0.8</token> + <token name="@TOOL_VERSION@">3.0.9</token> <token name="@VERSION_SUFFIX@">0</token> <token name="@PROFILE@">20.01</token> <xml name="edam_ontology"> @@ -21,7 +21,7 @@ </xml> <xml name="citations"> <citations> - <citation type="doi">1101/2020.11.19.388223</citation> + <citation type="doi">10.7554/eLife.65088</citation> </citations> </xml> </macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/no_taxon_input.fasta Mon Jun 14 12:47:06 2021 +0000 @@ -0,0 +1,4 @@ +> seq1 +ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA +> seq2 +ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA
