diff test-data/fastqc_contaminants.txt @ 0:e462044ece67 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/falco commit 8593dacde03b50726e9ca12fa15e4a104531708c

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastqc_contaminants.txt	Tue Jun 04 14:14:49 2024 +0000
@@ -0,0 +1,17 @@
+# This file contains a list of potential contaminants which are
+# frequently found in high throughput sequencing reactions.  These
+# are mostly sequences of adapters / primers used in the various
+# sequencing chemistries.
+# 
+# Please DO NOT rely on these sequences to design your own oligos, some
+# of them are truncated at ambiguous positions, and none of them are
+# definitive sequences from the manufacturers so don't blame us if you
+# try to use them and they don't work.
+#
+# You can add more sequences to the file by putting one line per entry
+# and specifying a name[tab]sequence.  If the contaminant you add is 
+# likely to be of use to others please consider sending it to the FastQ
+# authors, either via a bug report at www.bioinformatics.bbsrc.ac.uk/bugzilla/
+# or by directly emailing [e-mail] so other users of
+# the program can benefit.
+TestContaminant	ATGCATGCATGCATGCATGCATGC