view falco.xml @ 0:e462044ece67 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/falco commit 8593dacde03b50726e9ca12fa15e4a104531708c

<tool id="falco" name="Falco" version="1.2.2+galaxy0" profile="21.05">
    <description>A high throughput sequence QC analysis tool</description>
    <xrefs>
        <xref type="bio.tools">falco</xref>
    </xrefs>
    <requirements>
        <requirement type="package" version="1.2.2">falco</requirement>
    </requirements>
    <command detect_errors="aggressive"><![CDATA[
        #import re
        #set input_name = re.sub('[^\w\-\s]', '_', str($input_file.element_identifier))

        #if $input_file.ext.endswith('.gz'):
            #set input_file_sl = $input_name + '.gz'
        #elif $input_file.ext.endswith('.bz2'):
            #set input_file_sl = $input_name + '.bz2'
        #else
            #set input_file_sl = $input_name
        #end if

        #if 'bam' in $input_file.ext:
            #set format = 'bam'
        #elif 'sam' in $input_file.ext:
            #set format = 'sam'
        #else
            #set format = 'fastq'
        #end if

        ln -s '${input_file}' '${input_file_sl}' &&
        falco
            #if $contaminants:
                --contaminants '${contaminants}'
            #end if

            #if $adapters.dataset and str($adapters) > ''
                --adapters '${adapters}'
            #end if

            #if $limits.dataset and str($limits) > ''
                --limits '${limits}'
            #end if
            --threads \${GALAXY_SLOTS:-2}
            --quiet
            --extract
            ## #if $min_length:
            ##     --min_length $min_length
            ## #end if
            $nogroup
            ## --kmers $kmers
            -f '${format}'
            '${input_file_sl}'
            -subsample $subsample
            $bisulfite
            $reverse_complement

    ]]></command>
    <inputs>
        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Raw read data from your current history"/>
        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer&#x9;CAAGCAGAAGACGGCATACGA"/>
        <param argument="--adapters" type="data" format="tabular" optional="true" label="Adapter list" help="List of adapters adapter sequences which will be explicity searched against the library. It should be a tab-delimited file with 2 columns: name and sequence."/>
        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter."/>
        <param argument="--nogroup" type="boolean" truevalue="--nogroup" falsevalue="" checked="False" label="Disable grouping of bases for reads &gt;50bp" help=" Using this option, your plots may end up a ridiculous size. You have been warned!"/>
        <!-- Not implemented in falco yet <param argument="-min_length" type="integer" value="" optional="true" label="Lower limit on the length of the sequence to be shown in the report" help=" [NOT YET IMPLEMENTED IN FALCO]. Sets an artificial lower limit on the length of the sequence to be shown in the report. As long as you set this to a value greater or equal to your longest read length then this will be the sequence length used to create your read groups. This can be useful for making  directly comaparable statistics from datasets with somewhat variable read length."/> -->
        <!-- Ignored by falco and always set to 7 <param argument="-kmers" type="integer" value="7" min="2" max="10" label="Length of Kmer to look for" help="IGNORED BY FALCO AND ALWAYS SET TO 7. Specifies the length of Kmer to look for in the Kmer content module. Specified Kmer length must be between 2 and 10. Default length is 7 if not specified." /> -->
        <param argument="-subsample" type="integer" value="1" min="1" optional="true" label="Subsampling Factor" help="This makes falco faster (but possibly less accurate) by only processing reads that are multiple of this value (using 0-based indexing to number reads)"/>
        <param argument="-bisulfite" type="boolean" truevalue="-bisulfite" falsevalue="" checked="False" label="Bisulfite Sequencing" help="This parameter indicates whether the reads are from whole genome bisulfite sequencing. When enabled, Falco will account for the expected increase in Ts and decrease in Cs in the base content."/>
        <param argument="reverse_complement" type="boolean" truevalue="-reverse-complement" falsevalue="" checked="False" label="Reverse Complement" help="This parameter specifies whether the input sequences are reverse-complemented. When enabled, all modules in Falco will be tested by swapping A/T and C/G."/>
    </inputs>
    <outputs>
        <data format="html" name="html_file" from_work_dir="fastqc_report.html" label="${tool.name} on ${on_string}: Webpage"/>
        <data format="txt" name="text_file" from_work_dir="fastqc_data.txt" label="${tool.name} on ${on_string}: RawData"/>
        <data format="txt" name="summary_file" from_work_dir="summary.txt" label="${tool.name} on ${on_string}: SummaryData"/>
    </outputs>
    <tests>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data.txt" ftype="txt"/>
            <output name="summary_file" file="summary.txt" ftype="txt"/>
        </test>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="contaminants" value="contaminant_list.txt" ftype="tabular"/>
            <output name="html_file" file="fastqc_report_contaminants.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data_contaminants.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_data_contaminant_summary.txt" ftype="txt"/>
        </test>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="adapters" value="adapter_list.txt" ftype="tabular"/>
            <output name="html_file" file="fastqc_report_adapters.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data_adapters.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_data_adapters_summary.txt" ftype="txt"/>
        </test>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="limits" value="limits.txt" ftype="txt"/>
            <output name="html_file" file="fastqc_report_customlimits.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data_customlimits.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_data_customlimits_summary.txt" ftype="txt"/>
        </test>
        <!-- ## This feature has not yet been implemented in Falco, but if it is, it may go uncommented in the future.
        <test>
            <param name="input_file" value="1000trimmed.fastq" ftype="fastq"/>
            <param name="kmers" value="7"/>
            <param name="limits" value="limits.txt" ftype="txt"/>
            <output name="html_file" file="fastqc_report_kmer.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data_kmer.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_data_kmer_summary.txt" ftype="txt"/>
            <assert_command>
                <has_text text="kmers 7"/> 
            </assert_command>
        </test>  
        
        <test> ##This feature is ignored in Falco and always set to 7. If this will be considered, may go uncommented in the future"
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="min_length" value="108"/>
            <output name="html_file" file="fastqc_report_min_length.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data_min_length.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_data_min_length_summary.txt" ftype="txt"/>
        </test> -->

        <test>
            <param name="input_file" value="1000trimmed.fastq" ftype="fastq"/>
            <param name="nogroup" value="--nogroup"/>
            <output name="html_file" file="fastqc_report_nogroup.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_data_nogroup.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_data_nogroup_summary.txt" ftype="txt"/>
            <assert_command>
                <has_text text="--nogroup"/>
            </assert_command>
        </test>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="subsample" value="10"/>
            <output name="html_file" file="fastqc_report_subsample.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_report_subsample.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_report_subsample_summary.txt" ftype="txt"/>
        </test>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="bisulfite" value="-bisulfite"/>
            <output name="html_file" file="fastqc_report_bisulfite.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_report_bisulfite.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_report_bisulfite_summary.txt" ftype="txt"/>
        </test>
        <test>
            <param name="input_file" value="1000trimmed.fastq"/>
            <param name="reverse_complement" value="-reverse-complement"/>
            <output name="html_file" file="fastqc_report_reverse_complement.html" ftype="html" lines_diff="2"/>
            <output name="text_file" file="fastqc_report_reverse_complement.txt" ftype="txt"/>
            <output name="summary_file" file="fastqc_report_reverse_complement_summary.txt" ftype="txt"/>
        </test>
    </tests>
    <help><![CDATA[
.. class:: infomark

**Purpose**

Falco is an emulation of the popular FastQC software to check large sequencing reads for common problems.

The main functions of Falco are:

- Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant),
- Providing a quick overview to tell you in which areas there may be problems
- Summary graphs and tables to quickly assess your data
- Export of results to an HTML based permanent report
- Offline operation to allow automated generation of reports without running the interactive application

-----

.. class:: infomark

**Inputs and outputs**

Falco_ is the best place to look for documentation - it's very good.
A summary follows below for those in a tearing hurry.

This wrapper will accept a Galaxy fastq, fastq.gz, sam or bam as the input read file to check.
It will also take an optional file containing a list of contaminants information, in the form of
a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom
limits.txt file that allows setting the warning thresholds for the different modules and also specifies
which modules to include in the output.

The tool produces a basic text and a HTML output file that contain all of the results, including the following:

- Basic Statistics
- Per base sequence quality
- Per sequence quality scores
- Per base sequence content
- Per base GC content
- Per sequence GC content
- Per base N content
- Sequence Length Distribution
- Sequence Duplication Levels
- Overrepresented sequences
- Adapter Content

All except Basic Statistics and Overrepresented sequences are plots.
 .. _Falco: https://github.com/smithlabcode/falco/
 .. _Picard-tools: https://broadinstitute.github.io/picard/
    ]]></help>
    <citations>
        <citation type="bibtex">
            @article{deSenaBrandine2021,
            author = {de Sena Brandine, Gabriel and Smith, Andrew D.},
            title = {Falco: high-speed FastQC emulation for quality control of sequencing data},
            journal = {F1000Research},
            year = {2021},
            volume = {8},
            pages = {1874},
            url = {https://doi.org/10.12688/f1000research.21142.2},
            doi = {10.12688/f1000research.21142.2},
            note = {Version 2; peer review: 2 approved},
          }
          
        </citation>
    </citations>
</tool>