Mercurial > repos > iuc > falco
changeset 3:babbcf02d35c draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/falco commit 900be4eec6ed42fd9addf229406458bb75e3d69b
line wrap: on
line diff
--- a/falco.xml Sun Jun 30 11:28:30 2024 +0000 +++ b/falco.xml Tue Sep 10 19:02:42 2024 +0000 @@ -1,10 +1,14 @@ -<tool id="falco" name="Falco" version="1.2.2+galaxy1" profile="21.05"> +<tool id="falco" name="Falco" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05"> <description>An alternative, more performant implementation of FastQC for high throughput sequence quality control</description> + <macros> + <token name="@TOOL_VERSION@">1.2.3</token> + <token name="@VERSION_SUFFIX@">0</token> + </macros> <xrefs> <xref type="bio.tools">falco</xref> </xrefs> <requirements> - <requirement type="package" version="1.2.2">falco</requirement> + <requirement type="package" version="@TOOL_VERSION@">falco</requirement> </requirements> <command detect_errors="aggressive"><![CDATA[ #import re @@ -60,7 +64,7 @@ <param argument="-subsample" type="integer" value="1" min="1" label="Subsampling Factor" help="This makes falco faster (but possibly less accurate) by only processing reads that are multiple of this value (using 0-based indexing to number reads)"/> <param argument="-bisulfite" type="boolean" truevalue="-bisulfite" falsevalue="" checked="False" label="Bisulfite Sequencing" help="This parameter indicates whether the reads are from whole genome bisulfite sequencing. When enabled, Falco will account for the expected increase in Ts and decrease in Cs in the base content."/> <param argument="reverse_complement" type="boolean" truevalue="-reverse-complement" falsevalue="" checked="False" label="Reverse Complement" help="This parameter specifies whether the input sequences are reverse-complemented. When enabled, all modules in Falco will be tested by swapping A/T and C/G."/> - <param name="generate_summary" type="boolean" truevalue="" falsevalue="-skip-summary" checked="False" label="Generate summary output of QC test results" /> + <param name="generate_summary" type="boolean" truevalue="" falsevalue="-skip-summary" checked="False" label="Generate summary output of QC test results"/> </inputs> <outputs> <data format="html" name="html_file" from_work_dir="fastqc_report.html" label="${tool.name} on ${on_string}: Webpage"/> @@ -93,7 +97,6 @@ <output name="html_file" file="fastqc_report_customlimits.html" ftype="html" lines_diff="2"/> <output name="text_file" file="fastqc_data_customlimits.txt" ftype="txt"/> </test> - <!-- ## The kmers param is ignored in Falco and always set to 7. If this ever gets reconsidered, this test could be uncommented. <test expect_num_outputs="2"> <param name="input_file" value="1000trimmed.fastq" ftype="fastq"/> @@ -113,7 +116,6 @@ <output name="html_file" file="fastqc_report_min_length.html" ftype="html" lines_diff="2"/> <output name="text_file" file="fastqc_data_min_length.txt" ftype="txt"/> </test> --> - <test expect_num_outputs="3"> <param name="input_file" value="1000trimmed.fastq" ftype="fastq"/> <param name="nogroup" value="--nogroup"/>
--- a/test-data/fastqc_data.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_data.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.122324 0 0 0 0 -21 0.122324 0 0 0 0 -22 0.122324 0 0 0 0 -23 0.122324 0 0 0 0 -24 0.122324 0 0 0 0 -25 0.122324 0 0 0 0 -26 0.122324 0 0 0 0 -27 0.142712 0 0 0 0 -28 0.183486 0 0 0 0 -29 0.224261 0 0 0 0 -30 0.224261 0 0 0 0 -31 0.224261 0 0 0 0 -32 0.224261 0 0 0 0 -33 0.224261 0 0 0 0 -34 0.224261 0 0 0 0 -35 0.265036 0 0 0 0 -36 0.285423 0 0 0 0 -37 0.326198 0 0 0 0 -38 0.407747 0 0 0 0 -39 0.468909 0 0 0 0 -40 0.468909 0 0 0 0 -41 0.468909 0 0 0 0 -42 0.468909 0 0 0 0 -43 0.468909 0 0 0 0 -44 0.468909 0 0 0 0 -45 0.468909 0 0 0 0 -46 0.468909 0 0 0 0 -47 0.468909 0 0 0 0 -48 0.468909 0 0 0 0 -49 0.468909 0 0 0 0 -50 0.468909 0 0 0 0 -51 0.468909 0 0 0 0 -52 0.468909 0 0 0 0 -53 0.468909 0 0 0 0 -54 0.468909 0 0 0 0 -55 0.468909 0 0 0 0 -56 0.468909 0 0 0 0 -57 0.468909 0 0 0 0 -58 0.468909 0 0 0 0 -59 0.468909 0 0 0 0 -60 0.468909 0 0 0 0 -61 0.468909 0 0 0 0 -62 0.468909 0 0 0 0 -63 0.468909 0 0 0 0 -64 0.468909 0 0 0 0 -65 0.468909 0 0 0 0 -66 0.468909 0 0 0 0 -67 0.468909 0 0 0 0 -68 0.468909 0 0 0 0 -69 0.468909 0 0 0 0 -70 0.468909 0 0 0 0 -71 0.468909 0 0 0 0 -72 0.468909 0 0 0 0 -73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +>>Adapter Content warn +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0.0203874 0 +2 0 0 0 0 0.0815494 0 +3 0 0 0 0 0.142712 0 +4 0 0 0 0 0.183486 0 +5 0 0 0 0 0.285423 0 +6 0 0 0 0 0.38736 0 +7 0 0 0 0 0.489297 0 +8 0 0 0 0 0.591233 0 +9 0 0 0 0 0.672783 0 +10 0 0 0 0 0.754332 0 +11 0 0 0 0 0.835882 0 +12 0 0 0 0 0.917431 0 +13 0 0 0 0 1.01937 0 +14 0 0 0 0 1.1213 0 +15 0 0 0 0 1.24363 0 +16 0 0 0 0 1.34557 0 +17 0 0 0 0 1.46789 0 +18 0 0 0 0 1.59021 0 +19 0 0 0 0 1.67176 0 +20 0.122324 0 0 0 1.75331 0 +21 0.122324 0 0 0 1.83486 0 +22 0.122324 0 0 0 1.89602 0 +23 0.122324 0 0 0 1.95719 0 +24 0.122324 0 0 0 2.01835 0 +25 0.122324 0 0 0 2.07951 0 +26 0.122324 0 0 0 2.14067 0 +27 0.142712 0 0 0 2.20183 0 +28 0.183486 0 0 0 2.263 0 +29 0.224261 0 0 0 2.32416 0 +30 0.224261 0 0 0 2.38532 0 +31 0.224261 0 0 0 2.44648 0 +32 0.224261 0 0 0 2.50765 0 +33 0.224261 0 0 0 2.60958 0 +34 0.224261 0 0 0 2.71152 0 +35 0.265036 0 0 0 2.81346 0 +36 0.285423 0 0 0 2.89501 0 +37 0.326198 0 0 0 2.99694 0 +38 0.407747 0 0 0 3.09888 0 +39 0.468909 0 0 0 3.20082 0 +40 0.468909 0 0 0 3.30275 0 +41 0.468909 0 0 0 3.40469 0 +42 0.468909 0 0 0 3.48624 0 +43 0.468909 0 0 0 3.56779 0 +44 0.468909 0 0 0 3.60856 0 +45 0.468909 0 0 0 3.62895 0 +46 0.468909 0 0 0 3.64934 0 +47 0.468909 0 0 0 3.66972 0 +48 0.468909 0 0 0 3.69011 0 +49 0.468909 0 0 0 3.7105 0 +50 0.468909 0 0 0 3.7105 0 +51 0.468909 0 0 0 3.7105 0 +52 0.468909 0 0 0 3.7105 0 +53 0.468909 0 0 0 3.7105 0 +54 0.468909 0 0 0 3.7105 0 +55 0.468909 0 0 0 3.7105 0 +56 0.468909 0 0 0 3.7105 0 +57 0.468909 0 0 0 3.7105 0 +58 0.468909 0 0 0 3.7105 0 +59 0.468909 0 0 0 3.73089 0 +60 0.468909 0 0 0 3.75127 0 +61 0.468909 0 0 0 3.77166 0 +62 0.468909 0 0 0 3.81244 0 +63 0.468909 0 0 0 3.85321 0 +64 0.468909 0 0 0 3.89399 0 +65 0.468909 0 0 0 3.93476 0 +66 0.468909 0 0 0 3.97554 0 +67 0.468909 0 0 0 4.01631 0 +68 0.468909 0 0 0 4.05708 0 +69 0.468909 0 0 0 4.09786 0 +70 0.468909 0 0 0 4.13863 0 +71 0.468909 0 0 0 4.17941 0 +72 0.468909 0 0 0 4.22018 0 +73 0.468909 0 0 0 4.26096 0 +74 0.489297 0 0 0 4.32212 0 +75 0.489297 0 0 0 4.38328 0 +76 0.489297 0 0 0 4.42406 0 +77 0.489297 0 0 0 4.46483 0 +78 0.489297 0 0 0 4.50561 0 +79 0.489297 0 0 0 4.54638 0 +80 0.489297 0 0 0 4.58716 0 +81 0.489297 0 0 0 4.62793 0 +82 0.489297 0 0 0 4.66871 0 +83 0.509684 0 0 0 4.70948 0 +84 0.509684 0 0 0 4.75025 0 +85 0.509684 0 0 0 4.79103 0 +86 0.509684 0 0 0 4.8318 0 +87 0.509684 0 0 0 4.91335 0 +88 0.509684 0 0 0 4.9949 0 +89 0.509684 0 0 0 5.05607 0 +90 0.509684 0 0 0 5.09684 0 +91 0.509684 0 0 0 5.158 0 +92 0.570846 0 0 0 5.21916 0 +93 0.632008 0 0 0 5.28033 0 +94 0.632008 0 0 0 5.34149 0 +95 0.632008 0 0 0 5.40265 0 +96 0.632008 0 0 0 5.46381 0 +97 0.632008 0 0 0 5.52497 0 +98 0.632008 0 0 0 5.52497 0 +99 0.632008 0 0 0 5.52497 0 +100 0.632008 0 0 0 5.52497 0 +101 0.632008 0 0 0 5.52497 0 +102 0.632008 0 0 0 5.52497 0 +103 0.632008 0 0 0 5.52497 0 +104 0.632008 0 0 0 5.52497 0 +105 0.632008 0 0 0 5.52497 0 +106 0.632008 0 0 0 5.52497 0 +107 0.632008 0 0 0 5.52497 0 +108 0.632008 0 0 0 5.52497 0 >>END_MODULE
--- a/test-data/fastqc_data_adapters.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_data_adapters.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq
--- a/test-data/fastqc_data_contaminants.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_data_contaminants.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.122324 0 0 0 0 -21 0.122324 0 0 0 0 -22 0.122324 0 0 0 0 -23 0.122324 0 0 0 0 -24 0.122324 0 0 0 0 -25 0.122324 0 0 0 0 -26 0.122324 0 0 0 0 -27 0.142712 0 0 0 0 -28 0.183486 0 0 0 0 -29 0.224261 0 0 0 0 -30 0.224261 0 0 0 0 -31 0.224261 0 0 0 0 -32 0.224261 0 0 0 0 -33 0.224261 0 0 0 0 -34 0.224261 0 0 0 0 -35 0.265036 0 0 0 0 -36 0.285423 0 0 0 0 -37 0.326198 0 0 0 0 -38 0.407747 0 0 0 0 -39 0.468909 0 0 0 0 -40 0.468909 0 0 0 0 -41 0.468909 0 0 0 0 -42 0.468909 0 0 0 0 -43 0.468909 0 0 0 0 -44 0.468909 0 0 0 0 -45 0.468909 0 0 0 0 -46 0.468909 0 0 0 0 -47 0.468909 0 0 0 0 -48 0.468909 0 0 0 0 -49 0.468909 0 0 0 0 -50 0.468909 0 0 0 0 -51 0.468909 0 0 0 0 -52 0.468909 0 0 0 0 -53 0.468909 0 0 0 0 -54 0.468909 0 0 0 0 -55 0.468909 0 0 0 0 -56 0.468909 0 0 0 0 -57 0.468909 0 0 0 0 -58 0.468909 0 0 0 0 -59 0.468909 0 0 0 0 -60 0.468909 0 0 0 0 -61 0.468909 0 0 0 0 -62 0.468909 0 0 0 0 -63 0.468909 0 0 0 0 -64 0.468909 0 0 0 0 -65 0.468909 0 0 0 0 -66 0.468909 0 0 0 0 -67 0.468909 0 0 0 0 -68 0.468909 0 0 0 0 -69 0.468909 0 0 0 0 -70 0.468909 0 0 0 0 -71 0.468909 0 0 0 0 -72 0.468909 0 0 0 0 -73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +>>Adapter Content warn +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0.0203874 0 +2 0 0 0 0 0.0815494 0 +3 0 0 0 0 0.142712 0 +4 0 0 0 0 0.183486 0 +5 0 0 0 0 0.285423 0 +6 0 0 0 0 0.38736 0 +7 0 0 0 0 0.489297 0 +8 0 0 0 0 0.591233 0 +9 0 0 0 0 0.672783 0 +10 0 0 0 0 0.754332 0 +11 0 0 0 0 0.835882 0 +12 0 0 0 0 0.917431 0 +13 0 0 0 0 1.01937 0 +14 0 0 0 0 1.1213 0 +15 0 0 0 0 1.24363 0 +16 0 0 0 0 1.34557 0 +17 0 0 0 0 1.46789 0 +18 0 0 0 0 1.59021 0 +19 0 0 0 0 1.67176 0 +20 0.122324 0 0 0 1.75331 0 +21 0.122324 0 0 0 1.83486 0 +22 0.122324 0 0 0 1.89602 0 +23 0.122324 0 0 0 1.95719 0 +24 0.122324 0 0 0 2.01835 0 +25 0.122324 0 0 0 2.07951 0 +26 0.122324 0 0 0 2.14067 0 +27 0.142712 0 0 0 2.20183 0 +28 0.183486 0 0 0 2.263 0 +29 0.224261 0 0 0 2.32416 0 +30 0.224261 0 0 0 2.38532 0 +31 0.224261 0 0 0 2.44648 0 +32 0.224261 0 0 0 2.50765 0 +33 0.224261 0 0 0 2.60958 0 +34 0.224261 0 0 0 2.71152 0 +35 0.265036 0 0 0 2.81346 0 +36 0.285423 0 0 0 2.89501 0 +37 0.326198 0 0 0 2.99694 0 +38 0.407747 0 0 0 3.09888 0 +39 0.468909 0 0 0 3.20082 0 +40 0.468909 0 0 0 3.30275 0 +41 0.468909 0 0 0 3.40469 0 +42 0.468909 0 0 0 3.48624 0 +43 0.468909 0 0 0 3.56779 0 +44 0.468909 0 0 0 3.60856 0 +45 0.468909 0 0 0 3.62895 0 +46 0.468909 0 0 0 3.64934 0 +47 0.468909 0 0 0 3.66972 0 +48 0.468909 0 0 0 3.69011 0 +49 0.468909 0 0 0 3.7105 0 +50 0.468909 0 0 0 3.7105 0 +51 0.468909 0 0 0 3.7105 0 +52 0.468909 0 0 0 3.7105 0 +53 0.468909 0 0 0 3.7105 0 +54 0.468909 0 0 0 3.7105 0 +55 0.468909 0 0 0 3.7105 0 +56 0.468909 0 0 0 3.7105 0 +57 0.468909 0 0 0 3.7105 0 +58 0.468909 0 0 0 3.7105 0 +59 0.468909 0 0 0 3.73089 0 +60 0.468909 0 0 0 3.75127 0 +61 0.468909 0 0 0 3.77166 0 +62 0.468909 0 0 0 3.81244 0 +63 0.468909 0 0 0 3.85321 0 +64 0.468909 0 0 0 3.89399 0 +65 0.468909 0 0 0 3.93476 0 +66 0.468909 0 0 0 3.97554 0 +67 0.468909 0 0 0 4.01631 0 +68 0.468909 0 0 0 4.05708 0 +69 0.468909 0 0 0 4.09786 0 +70 0.468909 0 0 0 4.13863 0 +71 0.468909 0 0 0 4.17941 0 +72 0.468909 0 0 0 4.22018 0 +73 0.468909 0 0 0 4.26096 0 +74 0.489297 0 0 0 4.32212 0 +75 0.489297 0 0 0 4.38328 0 +76 0.489297 0 0 0 4.42406 0 +77 0.489297 0 0 0 4.46483 0 +78 0.489297 0 0 0 4.50561 0 +79 0.489297 0 0 0 4.54638 0 +80 0.489297 0 0 0 4.58716 0 +81 0.489297 0 0 0 4.62793 0 +82 0.489297 0 0 0 4.66871 0 +83 0.509684 0 0 0 4.70948 0 +84 0.509684 0 0 0 4.75025 0 +85 0.509684 0 0 0 4.79103 0 +86 0.509684 0 0 0 4.8318 0 +87 0.509684 0 0 0 4.91335 0 +88 0.509684 0 0 0 4.9949 0 +89 0.509684 0 0 0 5.05607 0 +90 0.509684 0 0 0 5.09684 0 +91 0.509684 0 0 0 5.158 0 +92 0.570846 0 0 0 5.21916 0 +93 0.632008 0 0 0 5.28033 0 +94 0.632008 0 0 0 5.34149 0 +95 0.632008 0 0 0 5.40265 0 +96 0.632008 0 0 0 5.46381 0 +97 0.632008 0 0 0 5.52497 0 +98 0.632008 0 0 0 5.52497 0 +99 0.632008 0 0 0 5.52497 0 +100 0.632008 0 0 0 5.52497 0 +101 0.632008 0 0 0 5.52497 0 +102 0.632008 0 0 0 5.52497 0 +103 0.632008 0 0 0 5.52497 0 +104 0.632008 0 0 0 5.52497 0 +105 0.632008 0 0 0 5.52497 0 +106 0.632008 0 0 0 5.52497 0 +107 0.632008 0 0 0 5.52497 0 +108 0.632008 0 0 0 5.52497 0 >>END_MODULE
--- a/test-data/fastqc_data_customlimits.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_data_customlimits.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.122324 0 0 0 0 -21 0.122324 0 0 0 0 -22 0.122324 0 0 0 0 -23 0.122324 0 0 0 0 -24 0.122324 0 0 0 0 -25 0.122324 0 0 0 0 -26 0.122324 0 0 0 0 -27 0.142712 0 0 0 0 -28 0.183486 0 0 0 0 -29 0.224261 0 0 0 0 -30 0.224261 0 0 0 0 -31 0.224261 0 0 0 0 -32 0.224261 0 0 0 0 -33 0.224261 0 0 0 0 -34 0.224261 0 0 0 0 -35 0.265036 0 0 0 0 -36 0.285423 0 0 0 0 -37 0.326198 0 0 0 0 -38 0.407747 0 0 0 0 -39 0.468909 0 0 0 0 -40 0.468909 0 0 0 0 -41 0.468909 0 0 0 0 -42 0.468909 0 0 0 0 -43 0.468909 0 0 0 0 -44 0.468909 0 0 0 0 -45 0.468909 0 0 0 0 -46 0.468909 0 0 0 0 -47 0.468909 0 0 0 0 -48 0.468909 0 0 0 0 -49 0.468909 0 0 0 0 -50 0.468909 0 0 0 0 -51 0.468909 0 0 0 0 -52 0.468909 0 0 0 0 -53 0.468909 0 0 0 0 -54 0.468909 0 0 0 0 -55 0.468909 0 0 0 0 -56 0.468909 0 0 0 0 -57 0.468909 0 0 0 0 -58 0.468909 0 0 0 0 -59 0.468909 0 0 0 0 -60 0.468909 0 0 0 0 -61 0.468909 0 0 0 0 -62 0.468909 0 0 0 0 -63 0.468909 0 0 0 0 -64 0.468909 0 0 0 0 -65 0.468909 0 0 0 0 -66 0.468909 0 0 0 0 -67 0.468909 0 0 0 0 -68 0.468909 0 0 0 0 -69 0.468909 0 0 0 0 -70 0.468909 0 0 0 0 -71 0.468909 0 0 0 0 -72 0.468909 0 0 0 0 -73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +>>Adapter Content warn +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0.0203874 0 +2 0 0 0 0 0.0815494 0 +3 0 0 0 0 0.142712 0 +4 0 0 0 0 0.183486 0 +5 0 0 0 0 0.285423 0 +6 0 0 0 0 0.38736 0 +7 0 0 0 0 0.489297 0 +8 0 0 0 0 0.591233 0 +9 0 0 0 0 0.672783 0 +10 0 0 0 0 0.754332 0 +11 0 0 0 0 0.835882 0 +12 0 0 0 0 0.917431 0 +13 0 0 0 0 1.01937 0 +14 0 0 0 0 1.1213 0 +15 0 0 0 0 1.24363 0 +16 0 0 0 0 1.34557 0 +17 0 0 0 0 1.46789 0 +18 0 0 0 0 1.59021 0 +19 0 0 0 0 1.67176 0 +20 0.122324 0 0 0 1.75331 0 +21 0.122324 0 0 0 1.83486 0 +22 0.122324 0 0 0 1.89602 0 +23 0.122324 0 0 0 1.95719 0 +24 0.122324 0 0 0 2.01835 0 +25 0.122324 0 0 0 2.07951 0 +26 0.122324 0 0 0 2.14067 0 +27 0.142712 0 0 0 2.20183 0 +28 0.183486 0 0 0 2.263 0 +29 0.224261 0 0 0 2.32416 0 +30 0.224261 0 0 0 2.38532 0 +31 0.224261 0 0 0 2.44648 0 +32 0.224261 0 0 0 2.50765 0 +33 0.224261 0 0 0 2.60958 0 +34 0.224261 0 0 0 2.71152 0 +35 0.265036 0 0 0 2.81346 0 +36 0.285423 0 0 0 2.89501 0 +37 0.326198 0 0 0 2.99694 0 +38 0.407747 0 0 0 3.09888 0 +39 0.468909 0 0 0 3.20082 0 +40 0.468909 0 0 0 3.30275 0 +41 0.468909 0 0 0 3.40469 0 +42 0.468909 0 0 0 3.48624 0 +43 0.468909 0 0 0 3.56779 0 +44 0.468909 0 0 0 3.60856 0 +45 0.468909 0 0 0 3.62895 0 +46 0.468909 0 0 0 3.64934 0 +47 0.468909 0 0 0 3.66972 0 +48 0.468909 0 0 0 3.69011 0 +49 0.468909 0 0 0 3.7105 0 +50 0.468909 0 0 0 3.7105 0 +51 0.468909 0 0 0 3.7105 0 +52 0.468909 0 0 0 3.7105 0 +53 0.468909 0 0 0 3.7105 0 +54 0.468909 0 0 0 3.7105 0 +55 0.468909 0 0 0 3.7105 0 +56 0.468909 0 0 0 3.7105 0 +57 0.468909 0 0 0 3.7105 0 +58 0.468909 0 0 0 3.7105 0 +59 0.468909 0 0 0 3.73089 0 +60 0.468909 0 0 0 3.75127 0 +61 0.468909 0 0 0 3.77166 0 +62 0.468909 0 0 0 3.81244 0 +63 0.468909 0 0 0 3.85321 0 +64 0.468909 0 0 0 3.89399 0 +65 0.468909 0 0 0 3.93476 0 +66 0.468909 0 0 0 3.97554 0 +67 0.468909 0 0 0 4.01631 0 +68 0.468909 0 0 0 4.05708 0 +69 0.468909 0 0 0 4.09786 0 +70 0.468909 0 0 0 4.13863 0 +71 0.468909 0 0 0 4.17941 0 +72 0.468909 0 0 0 4.22018 0 +73 0.468909 0 0 0 4.26096 0 +74 0.489297 0 0 0 4.32212 0 +75 0.489297 0 0 0 4.38328 0 +76 0.489297 0 0 0 4.42406 0 +77 0.489297 0 0 0 4.46483 0 +78 0.489297 0 0 0 4.50561 0 +79 0.489297 0 0 0 4.54638 0 +80 0.489297 0 0 0 4.58716 0 +81 0.489297 0 0 0 4.62793 0 +82 0.489297 0 0 0 4.66871 0 +83 0.509684 0 0 0 4.70948 0 +84 0.509684 0 0 0 4.75025 0 +85 0.509684 0 0 0 4.79103 0 +86 0.509684 0 0 0 4.8318 0 +87 0.509684 0 0 0 4.91335 0 +88 0.509684 0 0 0 4.9949 0 +89 0.509684 0 0 0 5.05607 0 +90 0.509684 0 0 0 5.09684 0 +91 0.509684 0 0 0 5.158 0 +92 0.570846 0 0 0 5.21916 0 +93 0.632008 0 0 0 5.28033 0 +94 0.632008 0 0 0 5.34149 0 +95 0.632008 0 0 0 5.40265 0 +96 0.632008 0 0 0 5.46381 0 +97 0.632008 0 0 0 5.52497 0 +98 0.632008 0 0 0 5.52497 0 +99 0.632008 0 0 0 5.52497 0 +100 0.632008 0 0 0 5.52497 0 +101 0.632008 0 0 0 5.52497 0 +102 0.632008 0 0 0 5.52497 0 +103 0.632008 0 0 0 5.52497 0 +104 0.632008 0 0 0 5.52497 0 +105 0.632008 0 0 0 5.52497 0 +106 0.632008 0 0 0 5.52497 0 +107 0.632008 0 0 0 5.52497 0 +108 0.632008 0 0 0 5.52497 0 >>END_MODULE
--- a/test-data/fastqc_data_nogroup.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_data_nogroup.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1744,114 +1744,114 @@ #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.122324 0 0 0 0 -21 0.122324 0 0 0 0 -22 0.122324 0 0 0 0 -23 0.122324 0 0 0 0 -24 0.122324 0 0 0 0 -25 0.122324 0 0 0 0 -26 0.122324 0 0 0 0 -27 0.142712 0 0 0 0 -28 0.183486 0 0 0 0 -29 0.224261 0 0 0 0 -30 0.224261 0 0 0 0 -31 0.224261 0 0 0 0 -32 0.224261 0 0 0 0 -33 0.224261 0 0 0 0 -34 0.224261 0 0 0 0 -35 0.265036 0 0 0 0 -36 0.285423 0 0 0 0 -37 0.326198 0 0 0 0 -38 0.407747 0 0 0 0 -39 0.468909 0 0 0 0 -40 0.468909 0 0 0 0 -41 0.468909 0 0 0 0 -42 0.468909 0 0 0 0 -43 0.468909 0 0 0 0 -44 0.468909 0 0 0 0 -45 0.468909 0 0 0 0 -46 0.468909 0 0 0 0 -47 0.468909 0 0 0 0 -48 0.468909 0 0 0 0 -49 0.468909 0 0 0 0 -50 0.468909 0 0 0 0 -51 0.468909 0 0 0 0 -52 0.468909 0 0 0 0 -53 0.468909 0 0 0 0 -54 0.468909 0 0 0 0 -55 0.468909 0 0 0 0 -56 0.468909 0 0 0 0 -57 0.468909 0 0 0 0 -58 0.468909 0 0 0 0 -59 0.468909 0 0 0 0 -60 0.468909 0 0 0 0 -61 0.468909 0 0 0 0 -62 0.468909 0 0 0 0 -63 0.468909 0 0 0 0 -64 0.468909 0 0 0 0 -65 0.468909 0 0 0 0 -66 0.468909 0 0 0 0 -67 0.468909 0 0 0 0 -68 0.468909 0 0 0 0 -69 0.468909 0 0 0 0 -70 0.468909 0 0 0 0 -71 0.468909 0 0 0 0 -72 0.468909 0 0 0 0 -73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +>>Adapter Content warn +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0.0203874 0 +2 0 0 0 0 0.0815494 0 +3 0 0 0 0 0.142712 0 +4 0 0 0 0 0.183486 0 +5 0 0 0 0 0.285423 0 +6 0 0 0 0 0.38736 0 +7 0 0 0 0 0.489297 0 +8 0 0 0 0 0.591233 0 +9 0 0 0 0 0.672783 0 +10 0 0 0 0 0.754332 0 +11 0 0 0 0 0.835882 0 +12 0 0 0 0 0.917431 0 +13 0 0 0 0 1.01937 0 +14 0 0 0 0 1.1213 0 +15 0 0 0 0 1.24363 0 +16 0 0 0 0 1.34557 0 +17 0 0 0 0 1.46789 0 +18 0 0 0 0 1.59021 0 +19 0 0 0 0 1.67176 0 +20 0.122324 0 0 0 1.75331 0 +21 0.122324 0 0 0 1.83486 0 +22 0.122324 0 0 0 1.89602 0 +23 0.122324 0 0 0 1.95719 0 +24 0.122324 0 0 0 2.01835 0 +25 0.122324 0 0 0 2.07951 0 +26 0.122324 0 0 0 2.14067 0 +27 0.142712 0 0 0 2.20183 0 +28 0.183486 0 0 0 2.263 0 +29 0.224261 0 0 0 2.32416 0 +30 0.224261 0 0 0 2.38532 0 +31 0.224261 0 0 0 2.44648 0 +32 0.224261 0 0 0 2.50765 0 +33 0.224261 0 0 0 2.60958 0 +34 0.224261 0 0 0 2.71152 0 +35 0.265036 0 0 0 2.81346 0 +36 0.285423 0 0 0 2.89501 0 +37 0.326198 0 0 0 2.99694 0 +38 0.407747 0 0 0 3.09888 0 +39 0.468909 0 0 0 3.20082 0 +40 0.468909 0 0 0 3.30275 0 +41 0.468909 0 0 0 3.40469 0 +42 0.468909 0 0 0 3.48624 0 +43 0.468909 0 0 0 3.56779 0 +44 0.468909 0 0 0 3.60856 0 +45 0.468909 0 0 0 3.62895 0 +46 0.468909 0 0 0 3.64934 0 +47 0.468909 0 0 0 3.66972 0 +48 0.468909 0 0 0 3.69011 0 +49 0.468909 0 0 0 3.7105 0 +50 0.468909 0 0 0 3.7105 0 +51 0.468909 0 0 0 3.7105 0 +52 0.468909 0 0 0 3.7105 0 +53 0.468909 0 0 0 3.7105 0 +54 0.468909 0 0 0 3.7105 0 +55 0.468909 0 0 0 3.7105 0 +56 0.468909 0 0 0 3.7105 0 +57 0.468909 0 0 0 3.7105 0 +58 0.468909 0 0 0 3.7105 0 +59 0.468909 0 0 0 3.73089 0 +60 0.468909 0 0 0 3.75127 0 +61 0.468909 0 0 0 3.77166 0 +62 0.468909 0 0 0 3.81244 0 +63 0.468909 0 0 0 3.85321 0 +64 0.468909 0 0 0 3.89399 0 +65 0.468909 0 0 0 3.93476 0 +66 0.468909 0 0 0 3.97554 0 +67 0.468909 0 0 0 4.01631 0 +68 0.468909 0 0 0 4.05708 0 +69 0.468909 0 0 0 4.09786 0 +70 0.468909 0 0 0 4.13863 0 +71 0.468909 0 0 0 4.17941 0 +72 0.468909 0 0 0 4.22018 0 +73 0.468909 0 0 0 4.26096 0 +74 0.489297 0 0 0 4.32212 0 +75 0.489297 0 0 0 4.38328 0 +76 0.489297 0 0 0 4.42406 0 +77 0.489297 0 0 0 4.46483 0 +78 0.489297 0 0 0 4.50561 0 +79 0.489297 0 0 0 4.54638 0 +80 0.489297 0 0 0 4.58716 0 +81 0.489297 0 0 0 4.62793 0 +82 0.489297 0 0 0 4.66871 0 +83 0.509684 0 0 0 4.70948 0 +84 0.509684 0 0 0 4.75025 0 +85 0.509684 0 0 0 4.79103 0 +86 0.509684 0 0 0 4.8318 0 +87 0.509684 0 0 0 4.91335 0 +88 0.509684 0 0 0 4.9949 0 +89 0.509684 0 0 0 5.05607 0 +90 0.509684 0 0 0 5.09684 0 +91 0.509684 0 0 0 5.158 0 +92 0.570846 0 0 0 5.21916 0 +93 0.632008 0 0 0 5.28033 0 +94 0.632008 0 0 0 5.34149 0 +95 0.632008 0 0 0 5.40265 0 +96 0.632008 0 0 0 5.46381 0 +97 0.632008 0 0 0 5.52497 0 +98 0.632008 0 0 0 5.52497 0 +99 0.632008 0 0 0 5.52497 0 +100 0.632008 0 0 0 5.52497 0 +101 0.632008 0 0 0 5.52497 0 +102 0.632008 0 0 0 5.52497 0 +103 0.632008 0 0 0 5.52497 0 +104 0.632008 0 0 0 5.52497 0 +105 0.632008 0 0 0 5.52497 0 +106 0.632008 0 0 0 5.52497 0 +107 0.632008 0 0 0 5.52497 0 +108 0.632008 0 0 0 5.52497 0 >>END_MODULE
--- a/test-data/fastqc_data_nogroup_summary.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_data_nogroup_summary.txt Tue Sep 10 19:02:42 2024 +0000 @@ -8,4 +8,4 @@ WARN Sequence Length Distribution 1000trimmed_fastq PASS Sequence Duplication Levels 1000trimmed_fastq WARN Overrepresented sequences 1000trimmed_fastq -PASS Adapter Content 1000trimmed_fastq +WARN Adapter Content 1000trimmed_fastq
--- a/test-data/fastqc_report.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 16:50:45 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:39:03 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="warn" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="warn" id="adaptercontent"> Adapter Content : warn </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0.0203874,0.0815494,0.142712,0.183486,0.285423,0.38736,0.489297,0.591233,0.672783,0.754332,0.835882,0.917431,1.01937,1.1213,1.24363,1.34557,1.46789,1.59021,1.67176,1.75331,1.83486,1.89602,1.95719,2.01835,2.07951,2.14067,2.20183,2.263,2.32416,2.38532,2.44648,2.50765,2.60958,2.71152,2.81346,2.89501,2.99694,3.09888,3.20082,3.30275,3.40469,3.48624,3.56779,3.60856,3.62895,3.64934,3.66972,3.69011,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.73089,3.75127,3.77166,3.81244,3.85321,3.89399,3.93476,3.97554,4.01631,4.05708,4.09786,4.13863,4.17941,4.22018,4.26096,4.32212,4.38328,4.42406,4.46483,4.50561,4.54638,4.58716,4.62793,4.66871,4.70948,4.75025,4.79103,4.8318,4.91335,4.9949,5.05607,5.09684,5.158,5.21916,5.28033,5.34149,5.40265,5.46381,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_adapters.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_adapters.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 16:55:06 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:39:42 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_bisulfite.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_bisulfite.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 17:08:30 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="warn" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="warn" id="perbasesequencecontent"> Per base sequence content : warn </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [54.2304, 55.1816, 50.5827, 49.8458, 51.425, 51.0705, 51.91, 50.2033, 49.1661, 50.7122, 49.8647, 49.2153, 49.2351, 48.717, 49.5119, 51.0104, 49.5842, 48.921, 50.1685, 49.8311, 48.4897, 49.3806, 50.2975, 49.0344, 48.5403, 47.8864, 49.1336, 48.3155, 49.2508, 48.7641, 47.6093, 49.5249, 50.2023, 49.7425, 50.5887, 48.2708, 49.8344, 47.4227, 47.6436, 45.4713, 45.729, 46.3918, 48.38, 47.1649, 47.3122, 48.0118, 48.5272, 45.3976, 49.1532, 49.3373, 47.7909, 47.3859, 45.8395, 47.5019, 47.6226, 47.8491, 46.717, 46.6361, 46.4349], mode : 'lines', name : 'A+G', line :{ color : '#CCCCCC', dash : 'dash'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [45.7696, 44.8184, 49.4173, 50.1542, 48.575, 48.9295, 48.09, 49.7967, 50.8339, 49.2878, 50.1353, 50.7847, 50.7649, 51.283, 50.4881, 48.9896, 50.4158, 51.079, 49.8315, 50.1689, 51.5103, 50.6194, 49.7025, 50.9656, 51.4597, 52.1136, 50.8664, 51.6845, 50.7492, 51.2359, 52.3907, 50.4751, 49.7977, 50.2575, 49.4113, 51.7292, 50.1656, 52.5773, 52.3564, 54.5287, 54.271, 53.6082, 51.62, 52.8351, 52.6878, 51.9882, 51.4728, 54.6024, 50.8468, 50.6627, 52.2091, 52.6141, 54.1605, 52.4981, 52.3774, 52.1509, 53.283, 53.3639, 53.5651], mode : 'lines', name : 'C+T', line :{ color : '#999999', dash : 'dash'}} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:40:53 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="warn" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="warn" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="warn" id="perbasesequencecontent"> Per base sequence content : warn </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="warn" id="adaptercontent"> Adapter Content : warn </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [54.2304, 55.1816, 50.5827, 49.8458, 51.425, 51.0705, 51.91, 50.2033, 49.1661, 50.7122, 49.8647, 49.2153, 49.2351, 48.717, 49.5119, 51.0104, 49.5842, 48.921, 50.1685, 49.8311, 48.4897, 49.3806, 50.2975, 49.0344, 48.5403, 47.8864, 49.1336, 48.3155, 49.2508, 48.7641, 47.6093, 49.5249, 50.2023, 49.7425, 50.5887, 48.2708, 49.8344, 47.4227, 47.6436, 45.4713, 45.729, 46.3918, 48.38, 47.1649, 47.3122, 48.0118, 48.5272, 45.3976, 49.1532, 49.3373, 47.7909, 47.3859, 45.8395, 47.5019, 47.6226, 47.8491, 46.717, 46.6361, 46.4349], mode : 'lines', name : 'A+G', line :{ color : '#CCCCCC', dash : 'dash'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [45.7696, 44.8184, 49.4173, 50.1542, 48.575, 48.9295, 48.09, 49.7967, 50.8339, 49.2878, 50.1353, 50.7847, 50.7649, 51.283, 50.4881, 48.9896, 50.4158, 51.079, 49.8315, 50.1689, 51.5103, 50.6194, 49.7025, 50.9656, 51.4597, 52.1136, 50.8664, 51.6845, 50.7492, 51.2359, 52.3907, 50.4751, 49.7977, 50.2575, 49.4113, 51.7292, 50.1656, 52.5773, 52.3564, 54.5287, 54.271, 53.6082, 51.62, 52.8351, 52.6878, 51.9882, 51.4728, 54.6024, 50.8468, 50.6627, 52.2091, 52.6141, 54.1605, 52.4981, 52.3774, 52.1509, 53.283, 53.3639, 53.5651], mode : 'lines', name : 'C+T', line :{ color : '#999999', dash : 'dash'}} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0.0203874,0.0815494,0.142712,0.183486,0.285423,0.38736,0.489297,0.591233,0.672783,0.754332,0.835882,0.917431,1.01937,1.1213,1.24363,1.34557,1.46789,1.59021,1.67176,1.75331,1.83486,1.89602,1.95719,2.01835,2.07951,2.14067,2.20183,2.263,2.32416,2.38532,2.44648,2.50765,2.60958,2.71152,2.81346,2.89501,2.99694,3.09888,3.20082,3.30275,3.40469,3.48624,3.56779,3.60856,3.62895,3.64934,3.66972,3.69011,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.73089,3.75127,3.77166,3.81244,3.85321,3.89399,3.93476,3.97554,4.01631,4.05708,4.09786,4.13863,4.17941,4.22018,4.26096,4.32212,4.38328,4.42406,4.46483,4.50561,4.54638,4.58716,4.62793,4.66871,4.70948,4.75025,4.79103,4.8318,4.91335,4.9949,5.05607,5.09684,5.158,5.21916,5.28033,5.34149,5.40265,5.46381,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_bisulfite.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_bisulfite.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.122324 0 0 0 0 -21 0.122324 0 0 0 0 -22 0.122324 0 0 0 0 -23 0.122324 0 0 0 0 -24 0.122324 0 0 0 0 -25 0.122324 0 0 0 0 -26 0.122324 0 0 0 0 -27 0.142712 0 0 0 0 -28 0.183486 0 0 0 0 -29 0.224261 0 0 0 0 -30 0.224261 0 0 0 0 -31 0.224261 0 0 0 0 -32 0.224261 0 0 0 0 -33 0.224261 0 0 0 0 -34 0.224261 0 0 0 0 -35 0.265036 0 0 0 0 -36 0.285423 0 0 0 0 -37 0.326198 0 0 0 0 -38 0.407747 0 0 0 0 -39 0.468909 0 0 0 0 -40 0.468909 0 0 0 0 -41 0.468909 0 0 0 0 -42 0.468909 0 0 0 0 -43 0.468909 0 0 0 0 -44 0.468909 0 0 0 0 -45 0.468909 0 0 0 0 -46 0.468909 0 0 0 0 -47 0.468909 0 0 0 0 -48 0.468909 0 0 0 0 -49 0.468909 0 0 0 0 -50 0.468909 0 0 0 0 -51 0.468909 0 0 0 0 -52 0.468909 0 0 0 0 -53 0.468909 0 0 0 0 -54 0.468909 0 0 0 0 -55 0.468909 0 0 0 0 -56 0.468909 0 0 0 0 -57 0.468909 0 0 0 0 -58 0.468909 0 0 0 0 -59 0.468909 0 0 0 0 -60 0.468909 0 0 0 0 -61 0.468909 0 0 0 0 -62 0.468909 0 0 0 0 -63 0.468909 0 0 0 0 -64 0.468909 0 0 0 0 -65 0.468909 0 0 0 0 -66 0.468909 0 0 0 0 -67 0.468909 0 0 0 0 -68 0.468909 0 0 0 0 -69 0.468909 0 0 0 0 -70 0.468909 0 0 0 0 -71 0.468909 0 0 0 0 -72 0.468909 0 0 0 0 -73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +>>Adapter Content warn +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0.0203874 0 +2 0 0 0 0 0.0815494 0 +3 0 0 0 0 0.142712 0 +4 0 0 0 0 0.183486 0 +5 0 0 0 0 0.285423 0 +6 0 0 0 0 0.38736 0 +7 0 0 0 0 0.489297 0 +8 0 0 0 0 0.591233 0 +9 0 0 0 0 0.672783 0 +10 0 0 0 0 0.754332 0 +11 0 0 0 0 0.835882 0 +12 0 0 0 0 0.917431 0 +13 0 0 0 0 1.01937 0 +14 0 0 0 0 1.1213 0 +15 0 0 0 0 1.24363 0 +16 0 0 0 0 1.34557 0 +17 0 0 0 0 1.46789 0 +18 0 0 0 0 1.59021 0 +19 0 0 0 0 1.67176 0 +20 0.122324 0 0 0 1.75331 0 +21 0.122324 0 0 0 1.83486 0 +22 0.122324 0 0 0 1.89602 0 +23 0.122324 0 0 0 1.95719 0 +24 0.122324 0 0 0 2.01835 0 +25 0.122324 0 0 0 2.07951 0 +26 0.122324 0 0 0 2.14067 0 +27 0.142712 0 0 0 2.20183 0 +28 0.183486 0 0 0 2.263 0 +29 0.224261 0 0 0 2.32416 0 +30 0.224261 0 0 0 2.38532 0 +31 0.224261 0 0 0 2.44648 0 +32 0.224261 0 0 0 2.50765 0 +33 0.224261 0 0 0 2.60958 0 +34 0.224261 0 0 0 2.71152 0 +35 0.265036 0 0 0 2.81346 0 +36 0.285423 0 0 0 2.89501 0 +37 0.326198 0 0 0 2.99694 0 +38 0.407747 0 0 0 3.09888 0 +39 0.468909 0 0 0 3.20082 0 +40 0.468909 0 0 0 3.30275 0 +41 0.468909 0 0 0 3.40469 0 +42 0.468909 0 0 0 3.48624 0 +43 0.468909 0 0 0 3.56779 0 +44 0.468909 0 0 0 3.60856 0 +45 0.468909 0 0 0 3.62895 0 +46 0.468909 0 0 0 3.64934 0 +47 0.468909 0 0 0 3.66972 0 +48 0.468909 0 0 0 3.69011 0 +49 0.468909 0 0 0 3.7105 0 +50 0.468909 0 0 0 3.7105 0 +51 0.468909 0 0 0 3.7105 0 +52 0.468909 0 0 0 3.7105 0 +53 0.468909 0 0 0 3.7105 0 +54 0.468909 0 0 0 3.7105 0 +55 0.468909 0 0 0 3.7105 0 +56 0.468909 0 0 0 3.7105 0 +57 0.468909 0 0 0 3.7105 0 +58 0.468909 0 0 0 3.7105 0 +59 0.468909 0 0 0 3.73089 0 +60 0.468909 0 0 0 3.75127 0 +61 0.468909 0 0 0 3.77166 0 +62 0.468909 0 0 0 3.81244 0 +63 0.468909 0 0 0 3.85321 0 +64 0.468909 0 0 0 3.89399 0 +65 0.468909 0 0 0 3.93476 0 +66 0.468909 0 0 0 3.97554 0 +67 0.468909 0 0 0 4.01631 0 +68 0.468909 0 0 0 4.05708 0 +69 0.468909 0 0 0 4.09786 0 +70 0.468909 0 0 0 4.13863 0 +71 0.468909 0 0 0 4.17941 0 +72 0.468909 0 0 0 4.22018 0 +73 0.468909 0 0 0 4.26096 0 +74 0.489297 0 0 0 4.32212 0 +75 0.489297 0 0 0 4.38328 0 +76 0.489297 0 0 0 4.42406 0 +77 0.489297 0 0 0 4.46483 0 +78 0.489297 0 0 0 4.50561 0 +79 0.489297 0 0 0 4.54638 0 +80 0.489297 0 0 0 4.58716 0 +81 0.489297 0 0 0 4.62793 0 +82 0.489297 0 0 0 4.66871 0 +83 0.509684 0 0 0 4.70948 0 +84 0.509684 0 0 0 4.75025 0 +85 0.509684 0 0 0 4.79103 0 +86 0.509684 0 0 0 4.8318 0 +87 0.509684 0 0 0 4.91335 0 +88 0.509684 0 0 0 4.9949 0 +89 0.509684 0 0 0 5.05607 0 +90 0.509684 0 0 0 5.09684 0 +91 0.509684 0 0 0 5.158 0 +92 0.570846 0 0 0 5.21916 0 +93 0.632008 0 0 0 5.28033 0 +94 0.632008 0 0 0 5.34149 0 +95 0.632008 0 0 0 5.40265 0 +96 0.632008 0 0 0 5.46381 0 +97 0.632008 0 0 0 5.52497 0 +98 0.632008 0 0 0 5.52497 0 +99 0.632008 0 0 0 5.52497 0 +100 0.632008 0 0 0 5.52497 0 +101 0.632008 0 0 0 5.52497 0 +102 0.632008 0 0 0 5.52497 0 +103 0.632008 0 0 0 5.52497 0 +104 0.632008 0 0 0 5.52497 0 +105 0.632008 0 0 0 5.52497 0 +106 0.632008 0 0 0 5.52497 0 +107 0.632008 0 0 0 5.52497 0 +108 0.632008 0 0 0 5.52497 0 >>END_MODULE
--- a/test-data/fastqc_report_bisulfite_summary.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_bisulfite_summary.txt Tue Sep 10 19:02:42 2024 +0000 @@ -8,4 +8,4 @@ WARN Sequence Length Distribution 1000trimmed_fastq PASS Sequence Duplication Levels 1000trimmed_fastq WARN Overrepresented sequences 1000trimmed_fastq -PASS Adapter Content 1000trimmed_fastq +WARN Adapter Content 1000trimmed_fastq
--- a/test-data/fastqc_report_contaminants.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_contaminants.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 16:52:55 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:39:23 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="warn" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="warn" id="adaptercontent"> Adapter Content : warn </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0.0203874,0.0815494,0.142712,0.183486,0.285423,0.38736,0.489297,0.591233,0.672783,0.754332,0.835882,0.917431,1.01937,1.1213,1.24363,1.34557,1.46789,1.59021,1.67176,1.75331,1.83486,1.89602,1.95719,2.01835,2.07951,2.14067,2.20183,2.263,2.32416,2.38532,2.44648,2.50765,2.60958,2.71152,2.81346,2.89501,2.99694,3.09888,3.20082,3.30275,3.40469,3.48624,3.56779,3.60856,3.62895,3.64934,3.66972,3.69011,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.73089,3.75127,3.77166,3.81244,3.85321,3.89399,3.93476,3.97554,4.01631,4.05708,4.09786,4.13863,4.17941,4.22018,4.26096,4.32212,4.38328,4.42406,4.46483,4.50561,4.54638,4.58716,4.62793,4.66871,4.70948,4.75025,4.79103,4.8318,4.91335,4.9949,5.05607,5.09684,5.158,5.21916,5.28033,5.34149,5.40265,5.46381,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_customlimits.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_customlimits.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 16:57:19 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:40:01 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="warn" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="warn" id="adaptercontent"> Adapter Content : warn </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0.0203874,0.0815494,0.142712,0.183486,0.285423,0.38736,0.489297,0.591233,0.672783,0.754332,0.835882,0.917431,1.01937,1.1213,1.24363,1.34557,1.46789,1.59021,1.67176,1.75331,1.83486,1.89602,1.95719,2.01835,2.07951,2.14067,2.20183,2.263,2.32416,2.38532,2.44648,2.50765,2.60958,2.71152,2.81346,2.89501,2.99694,3.09888,3.20082,3.30275,3.40469,3.48624,3.56779,3.60856,3.62895,3.64934,3.66972,3.69011,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.73089,3.75127,3.77166,3.81244,3.85321,3.89399,3.93476,3.97554,4.01631,4.05708,4.09786,4.13863,4.17941,4.22018,4.26096,4.32212,4.38328,4.42406,4.46483,4.50561,4.54638,4.58716,4.62793,4.66871,4.70948,4.75025,4.79103,4.8318,4.91335,4.9949,5.05607,5.09684,5.158,5.21916,5.28033,5.34149,5.40265,5.46381,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_nogroup.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_nogroup.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 17:04:08 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 10bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 11bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 12bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 34], type : 'box', name : ' 14bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 17bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 18bp', marker : {color : 'green'}}, {y : [23, 26, 30, 32, 33], type : 'box', name : ' 19bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 20bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 23bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 24bp', marker : {color : 'green'}}, {y : [21, 26, 29, 32, 33], type : 'box', name : ' 25bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 26bp', marker : {color : 'green'}}, {y : [21, 26, 29, 32, 33], type : 'box', name : ' 27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 30bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31, 33], type : 'box', name : ' 31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 33bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 34bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 35bp', marker : {color : 'green'}}, {y : [20, 24, 28, 31, 33], type : 'box', name : ' 36bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 39bp', marker : {color : 'green'}}, {y : [20, 24, 28, 31, 33], type : 'box', name : ' 40bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 41bp', marker : {color : 'green'}}, {y : [21, 24, 27, 31, 33], type : 'box', name : ' 42bp', marker : {color : 'green'}}, {y : [20, 24, 27, 31, 33], type : 'box', name : ' 43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 45bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 32], type : 'box', name : ' 46bp', marker : {color : 'green'}}, {y : [20, 24, 27, 31, 32], type : 'box', name : ' 47bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 48bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 51bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 52bp', marker : {color : 'green'}}, {y : [19, 22, 26, 29, 31], type : 'box', name : ' 53bp', marker : {color : 'green'}}, {y : [17, 22, 27, 30, 32], type : 'box', name : ' 54bp', marker : {color : 'green'}}, {y : [24, 29, 32, 33, 34], type : 'box', name : ' 55bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 56bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 57bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 58bp', marker : {color : 'green'}}, {y : [26, 28, 31, 33, 34], type : 'box', name : ' 59bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 60bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 61bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 62bp', marker : {color : 'green'}}, {y : [25, 29, 32, 33, 34], type : 'box', name : ' 63bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 64bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 65bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 66bp', marker : {color : 'green'}}, {y : [25, 29, 32, 33, 34], type : 'box', name : ' 67bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 68bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 71bp', marker : {color : 'green'}}, {y : [25, 29, 32, 33, 34], type : 'box', name : ' 72bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 73bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 74bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 75bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 76bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 77bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 78bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 79bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 80bp', marker : {color : 'green'}}, {y : [24, 27, 31, 33, 34], type : 'box', name : ' 81bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 82bp', marker : {color : 'green'}}, {y : [25, 28, 31, 32, 34], type : 'box', name : ' 83bp', marker : {color : 'green'}}, {y : [24, 27, 31, 32, 34], type : 'box', name : ' 84bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32, 34], type : 'box', name : ' 85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 33, 34], type : 'box', name : ' 86bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32, 34], type : 'box', name : ' 87bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 88bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 89bp', marker : {color : 'green'}}, {y : [23, 26, 30, 32, 33], type : 'box', name : ' 90bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 93bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 94bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 95bp', marker : {color : 'green'}}, {y : [22, 25, 29, 31, 33], type : 'box', name : ' 96bp', marker : {color : 'green'}}, {y : [22, 26, 29, 31, 33], type : 'box', name : ' 97bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 98bp', marker : {color : 'green'}}, {y : [22, 25, 28, 31, 33], type : 'box', name : ' 99bp', marker : {color : 'green'}}, {y : [22, 25, 28, 31, 33], type : 'box', name : ' 100bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 101bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 102bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 103bp', marker : {color : 'green'}}, {y : [20, 24, 27, 31, 32], type : 'box', name : ' 104bp', marker : {color : 'green'}}, {y : [20, 24, 28, 31, 33], type : 'box', name : ' 105bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 106bp', marker : {color : 'green'}}, {y : [20, 23, 26, 29, 31], type : 'box', name : ' 107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 30.6342, 28.2889, 28.3374, 29.7438, 29.2716, 28.6744, 29.2148, 29.5802, 27.6766, 28.0689, 28.8983, 29.0501, 31.2628, 28.9749, 28.1416, 30.027, 28.0299, 28.0806, 30.6353, 31.0539, 29.7821, 28.5848, 28.5714, 29.4599, 30, 29.4178, 29.4995, 30.2198, 27.7947, 28.2967, 27.6113, 29.7828, 27.3002, 28.4688, 29.5709, 30.8362, 27.7694, 28.4971, 27.95, 31.5014, 28.2067, 28.3114, 30.0727, 29.7527, 28.7172, 35.9238, 31.1765, 30.6107, 30.2428, 29.2127, 31.273, 35.0993, 29.5806, 29.8749, 32.2296, 33.6524, 28.2032, 29.6024, 29.3814, 31.3697, 28.3505, 27.2459, 28.4242, 30.6333, 26.8778, 29.1605, 31.8851, 31.5169, 26.8778, 29.8969, 29.0869, 32.7688, 30.9278, 30.9278, 31.9588, 31.2224, 28.056, 27.7614, 31.4433, 33.2842, 30.4124, 29.0869, 29.0869, 31.0015, 28.4242, 28.4978, 27.8351, 31.0015, 30.14, 28.5283, 28.9811, 30.717, 28.2264, 30.7925, 29.1321, 28.2264, 30.3396, 28.3501, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.0445, 22.1778, 20.9334, 20.9703, 20.9345, 21.6977, 21.1507, 21.1355, 21.8014, 20.8118, 21.5618, 21.1892, 19.9949, 19.3776, 22.4973, 20.2162, 21.0293, 20.4429, 22.4253, 19.6566, 21.0351, 20.293, 22.6722, 21.5712, 21.1706, 19.6349, 20.1278, 18.022, 20.6084, 21.1538, 22.1862, 20.0501, 21.1231, 21.4639, 21.5951, 20.203, 21.0025, 19.3968, 23.5998, 20.2833, 21.3183, 19.5857, 21.2161, 19.788, 21.6472, 20.2346, 19.4118, 18.3959, 17.2185, 20.4562, 21.7807, 18.028, 20.0147, 18.911, 21.3392, 18.6303, 19.6613, 19.8822, 20.9131, 20.4713, 19.1458, 19.2194, 21.944, 18.8513, 19.2931, 18.8513, 22.3122, 17.4521, 21.3549, 19.0722, 21.7231, 17.8203, 20.0295, 18.8513, 21.2813, 18.7776, 20.5449, 20.2504, 21.7968, 17.7467, 18.2622, 15.9794, 21.8704, 19.8822, 19.3667, 19.0722, 22.5331, 20.8395, 18.7915, 19.9245, 20, 18.1887, 22.1132, 20.3774, 21.8113, 21.2075, 19.5472, 20.1394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6059, 27.7556, 29.3695, 28.9957, 30.0275, 28.907, 29.875, 29.3655, 30.9541, 28.9791, 29.8931, 28.3195, 28.3111, 30.3086, 28.6209, 29.4865, 30.6032, 30.0681, 27.8213, 29.7513, 29.0557, 29.9564, 30.1658, 28.5761, 29.2642, 31.1746, 30.1384, 31.0989, 30.8365, 29.3171, 30.1215, 30.5347, 31.9222, 29.6812, 30.084, 29.8212, 31.3784, 31.5653, 28.5481, 29.0085, 30.7007, 30.8223, 30.4032, 33.4276, 31.414, 27.6393, 29.4118, 32.3767, 33.7013, 29.1391, 27.5938, 31.4202, 33.1862, 31.3466, 29.0655, 31.296, 35.1988, 30.4124, 32.6215, 30.7069, 36.6716, 34.0206, 34.3152, 33.4315, 37.1134, 31.9588, 29.0869, 34.3888, 34.1679, 31.0751, 32.0324, 33.7997, 32.9897, 32.106, 29.8233, 33.0633, 36.4507, 31.9588, 30.1178, 32.0324, 33.0633, 34.0206, 31.3697, 31.296, 35.2725, 31.5169, 32.7688, 32.1797, 33.972, 32.3019, 33.1321, 33.434, 29.9623, 31.8491, 31.0189, 32.5283, 32.3774, 34.7018, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 20.7154, 21.7778, 21.3597, 20.2902, 19.7664, 20.7209, 19.7595, 19.9189, 19.5679, 22.1402, 19.6469, 21.4412, 20.4312, 21.3389, 20.7401, 20.2703, 20.3376, 21.4083, 19.1181, 19.5382, 20.1271, 21.1658, 18.5906, 20.3928, 19.5652, 19.7726, 20.2343, 20.6593, 20.7605, 21.2323, 20.081, 19.6324, 19.6544, 20.3862, 18.75, 19.1397, 19.8496, 20.5408, 19.9021, 19.2068, 19.7743, 21.2806, 18.308, 17.0318, 18.2216, 16.2023, 20, 18.6166, 18.8374, 21.1921, 19.3525, 15.4525, 17.2185, 19.8675, 17.3657, 16.4212, 16.9367, 20.1031, 17.0839, 17.4521, 15.8321, 19.514, 15.3166, 17.0839, 16.7158, 20.0295, 16.7158, 16.6421, 17.5994, 19.9558, 17.1576, 15.6112, 16.053, 18.1149, 16.9367, 16.9367, 14.9485, 20.0295, 16.6421, 16.9367, 18.2622, 20.9131, 17.673, 17.8203, 16.9367, 20.9131, 16.863, 15.9794, 17.0965, 19.2453, 17.8868, 17.6604, 19.6981, 16.9811, 18.0377, 18.0377, 17.7358, 16.8087, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10", "11", "12", "13", "14", "15", "16", "17", "18", "19", "20", "21", "22", "23", "24", "25", "26", "27", "28", "29", "30", "31", "32", "33", "34", "35", "36", "37", "38", "39", "40", "41", "42", "43", "44", "45", "46", "47", "48", "49", "50", "51", "52", "53", "54", "55", "56", "57", "58", "59", "60", "61", "62", "63", "64", "65", "66", "67", "68", "69", "70", "71", "72", "73", "74", "75", "76", "77", "78", "79", "80", "81", "82", "83", "84", "85", "86", "87", "88", "89", "90", "91", "92", "93", "94", "95", "96", "97", "98", "99", "100", "101", "102", "103", "104", "105", "106", "107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:40:19 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="warn" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="warn" id="adaptercontent"> Adapter Content : warn </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 10bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 11bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 12bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 34], type : 'box', name : ' 14bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 17bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 18bp', marker : {color : 'green'}}, {y : [23, 26, 30, 32, 33], type : 'box', name : ' 19bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 20bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 23bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 24bp', marker : {color : 'green'}}, {y : [21, 26, 29, 32, 33], type : 'box', name : ' 25bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 26bp', marker : {color : 'green'}}, {y : [21, 26, 29, 32, 33], type : 'box', name : ' 27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 30bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31, 33], type : 'box', name : ' 31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 33bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 34bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 35bp', marker : {color : 'green'}}, {y : [20, 24, 28, 31, 33], type : 'box', name : ' 36bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 39bp', marker : {color : 'green'}}, {y : [20, 24, 28, 31, 33], type : 'box', name : ' 40bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 41bp', marker : {color : 'green'}}, {y : [21, 24, 27, 31, 33], type : 'box', name : ' 42bp', marker : {color : 'green'}}, {y : [20, 24, 27, 31, 33], type : 'box', name : ' 43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 45bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 32], type : 'box', name : ' 46bp', marker : {color : 'green'}}, {y : [20, 24, 27, 31, 32], type : 'box', name : ' 47bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 48bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 51bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 52bp', marker : {color : 'green'}}, {y : [19, 22, 26, 29, 31], type : 'box', name : ' 53bp', marker : {color : 'green'}}, {y : [17, 22, 27, 30, 32], type : 'box', name : ' 54bp', marker : {color : 'green'}}, {y : [24, 29, 32, 33, 34], type : 'box', name : ' 55bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 56bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 57bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 58bp', marker : {color : 'green'}}, {y : [26, 28, 31, 33, 34], type : 'box', name : ' 59bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 60bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 61bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 62bp', marker : {color : 'green'}}, {y : [25, 29, 32, 33, 34], type : 'box', name : ' 63bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 64bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 65bp', marker : {color : 'green'}}, {y : [26, 29, 32, 33, 34], type : 'box', name : ' 66bp', marker : {color : 'green'}}, {y : [25, 29, 32, 33, 34], type : 'box', name : ' 67bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 68bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 71bp', marker : {color : 'green'}}, {y : [25, 29, 32, 33, 34], type : 'box', name : ' 72bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 73bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 74bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 75bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 76bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 77bp', marker : {color : 'green'}}, {y : [25, 28, 31, 33, 34], type : 'box', name : ' 78bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 79bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 80bp', marker : {color : 'green'}}, {y : [24, 27, 31, 33, 34], type : 'box', name : ' 81bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 82bp', marker : {color : 'green'}}, {y : [25, 28, 31, 32, 34], type : 'box', name : ' 83bp', marker : {color : 'green'}}, {y : [24, 27, 31, 32, 34], type : 'box', name : ' 84bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32, 34], type : 'box', name : ' 85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 33, 34], type : 'box', name : ' 86bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32, 34], type : 'box', name : ' 87bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 88bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 89bp', marker : {color : 'green'}}, {y : [23, 26, 30, 32, 33], type : 'box', name : ' 90bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 93bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 94bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 95bp', marker : {color : 'green'}}, {y : [22, 25, 29, 31, 33], type : 'box', name : ' 96bp', marker : {color : 'green'}}, {y : [22, 26, 29, 31, 33], type : 'box', name : ' 97bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 98bp', marker : {color : 'green'}}, {y : [22, 25, 28, 31, 33], type : 'box', name : ' 99bp', marker : {color : 'green'}}, {y : [22, 25, 28, 31, 33], type : 'box', name : ' 100bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 101bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 102bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 103bp', marker : {color : 'green'}}, {y : [20, 24, 27, 31, 32], type : 'box', name : ' 104bp', marker : {color : 'green'}}, {y : [20, 24, 28, 31, 33], type : 'box', name : ' 105bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 106bp', marker : {color : 'green'}}, {y : [20, 23, 26, 29, 31], type : 'box', name : ' 107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 30.6342, 28.2889, 28.3374, 29.7438, 29.2716, 28.6744, 29.2148, 29.5802, 27.6766, 28.0689, 28.8983, 29.0501, 31.2628, 28.9749, 28.1416, 30.027, 28.0299, 28.0806, 30.6353, 31.0539, 29.7821, 28.5848, 28.5714, 29.4599, 30, 29.4178, 29.4995, 30.2198, 27.7947, 28.2967, 27.6113, 29.7828, 27.3002, 28.4688, 29.5709, 30.8362, 27.7694, 28.4971, 27.95, 31.5014, 28.2067, 28.3114, 30.0727, 29.7527, 28.7172, 35.9238, 31.1765, 30.6107, 30.2428, 29.2127, 31.273, 35.0993, 29.5806, 29.8749, 32.2296, 33.6524, 28.2032, 29.6024, 29.3814, 31.3697, 28.3505, 27.2459, 28.4242, 30.6333, 26.8778, 29.1605, 31.8851, 31.5169, 26.8778, 29.8969, 29.0869, 32.7688, 30.9278, 30.9278, 31.9588, 31.2224, 28.056, 27.7614, 31.4433, 33.2842, 30.4124, 29.0869, 29.0869, 31.0015, 28.4242, 28.4978, 27.8351, 31.0015, 30.14, 28.5283, 28.9811, 30.717, 28.2264, 30.7925, 29.1321, 28.2264, 30.3396, 28.3501, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.0445, 22.1778, 20.9334, 20.9703, 20.9345, 21.6977, 21.1507, 21.1355, 21.8014, 20.8118, 21.5618, 21.1892, 19.9949, 19.3776, 22.4973, 20.2162, 21.0293, 20.4429, 22.4253, 19.6566, 21.0351, 20.293, 22.6722, 21.5712, 21.1706, 19.6349, 20.1278, 18.022, 20.6084, 21.1538, 22.1862, 20.0501, 21.1231, 21.4639, 21.5951, 20.203, 21.0025, 19.3968, 23.5998, 20.2833, 21.3183, 19.5857, 21.2161, 19.788, 21.6472, 20.2346, 19.4118, 18.3959, 17.2185, 20.4562, 21.7807, 18.028, 20.0147, 18.911, 21.3392, 18.6303, 19.6613, 19.8822, 20.9131, 20.4713, 19.1458, 19.2194, 21.944, 18.8513, 19.2931, 18.8513, 22.3122, 17.4521, 21.3549, 19.0722, 21.7231, 17.8203, 20.0295, 18.8513, 21.2813, 18.7776, 20.5449, 20.2504, 21.7968, 17.7467, 18.2622, 15.9794, 21.8704, 19.8822, 19.3667, 19.0722, 22.5331, 20.8395, 18.7915, 19.9245, 20, 18.1887, 22.1132, 20.3774, 21.8113, 21.2075, 19.5472, 20.1394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6059, 27.7556, 29.3695, 28.9957, 30.0275, 28.907, 29.875, 29.3655, 30.9541, 28.9791, 29.8931, 28.3195, 28.3111, 30.3086, 28.6209, 29.4865, 30.6032, 30.0681, 27.8213, 29.7513, 29.0557, 29.9564, 30.1658, 28.5761, 29.2642, 31.1746, 30.1384, 31.0989, 30.8365, 29.3171, 30.1215, 30.5347, 31.9222, 29.6812, 30.084, 29.8212, 31.3784, 31.5653, 28.5481, 29.0085, 30.7007, 30.8223, 30.4032, 33.4276, 31.414, 27.6393, 29.4118, 32.3767, 33.7013, 29.1391, 27.5938, 31.4202, 33.1862, 31.3466, 29.0655, 31.296, 35.1988, 30.4124, 32.6215, 30.7069, 36.6716, 34.0206, 34.3152, 33.4315, 37.1134, 31.9588, 29.0869, 34.3888, 34.1679, 31.0751, 32.0324, 33.7997, 32.9897, 32.106, 29.8233, 33.0633, 36.4507, 31.9588, 30.1178, 32.0324, 33.0633, 34.0206, 31.3697, 31.296, 35.2725, 31.5169, 32.7688, 32.1797, 33.972, 32.3019, 33.1321, 33.434, 29.9623, 31.8491, 31.0189, 32.5283, 32.3774, 34.7018, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 20.7154, 21.7778, 21.3597, 20.2902, 19.7664, 20.7209, 19.7595, 19.9189, 19.5679, 22.1402, 19.6469, 21.4412, 20.4312, 21.3389, 20.7401, 20.2703, 20.3376, 21.4083, 19.1181, 19.5382, 20.1271, 21.1658, 18.5906, 20.3928, 19.5652, 19.7726, 20.2343, 20.6593, 20.7605, 21.2323, 20.081, 19.6324, 19.6544, 20.3862, 18.75, 19.1397, 19.8496, 20.5408, 19.9021, 19.2068, 19.7743, 21.2806, 18.308, 17.0318, 18.2216, 16.2023, 20, 18.6166, 18.8374, 21.1921, 19.3525, 15.4525, 17.2185, 19.8675, 17.3657, 16.4212, 16.9367, 20.1031, 17.0839, 17.4521, 15.8321, 19.514, 15.3166, 17.0839, 16.7158, 20.0295, 16.7158, 16.6421, 17.5994, 19.9558, 17.1576, 15.6112, 16.053, 18.1149, 16.9367, 16.9367, 14.9485, 20.0295, 16.6421, 16.9367, 18.2622, 20.9131, 17.673, 17.8203, 16.9367, 20.9131, 16.863, 15.9794, 17.0965, 19.2453, 17.8868, 17.6604, 19.6981, 16.9811, 18.0377, 18.0377, 17.7358, 16.8087, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10", "11", "12", "13", "14", "15", "16", "17", "18", "19", "20", "21", "22", "23", "24", "25", "26", "27", "28", "29", "30", "31", "32", "33", "34", "35", "36", "37", "38", "39", "40", "41", "42", "43", "44", "45", "46", "47", "48", "49", "50", "51", "52", "53", "54", "55", "56", "57", "58", "59", "60", "61", "62", "63", "64", "65", "66", "67", "68", "69", "70", "71", "72", "73", "74", "75", "76", "77", "78", "79", "80", "81", "82", "83", "84", "85", "86", "87", "88", "89", "90", "91", "92", "93", "94", "95", "96", "97", "98", "99", "100", "101", "102", "103", "104", "105", "106", "107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0.0203874,0.0815494,0.142712,0.183486,0.285423,0.38736,0.489297,0.591233,0.672783,0.754332,0.835882,0.917431,1.01937,1.1213,1.24363,1.34557,1.46789,1.59021,1.67176,1.75331,1.83486,1.89602,1.95719,2.01835,2.07951,2.14067,2.20183,2.263,2.32416,2.38532,2.44648,2.50765,2.60958,2.71152,2.81346,2.89501,2.99694,3.09888,3.20082,3.30275,3.40469,3.48624,3.56779,3.60856,3.62895,3.64934,3.66972,3.69011,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.73089,3.75127,3.77166,3.81244,3.85321,3.89399,3.93476,3.97554,4.01631,4.05708,4.09786,4.13863,4.17941,4.22018,4.26096,4.32212,4.38328,4.42406,4.46483,4.50561,4.54638,4.58716,4.62793,4.66871,4.70948,4.75025,4.79103,4.8318,4.91335,4.9949,5.05607,5.09684,5.158,5.21916,5.28033,5.34149,5.40265,5.46381,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_reverse_complement.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_reverse_complement.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 17:10:44 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:41:08 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="warn" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="warn" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="warn" id="overrepresentedsequences"> Overrepresented sequences : warn</h2> <table><thead><tr><th>Sequence</th><th>Count</th><th>Percentage</th><th>Possible Source</th></tr></thead><tbody><tr><td>ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT</td><td>33</td><td>0.672783</td><td>No Hit</td></tr></tbody></table></div><div class="module"> <h2 class="warn" id="adaptercontent"> Adapter Content : warn </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [23, 27, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 34], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 34], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [21.5, 26, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 28, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24, 28, 31, 33], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 31, 33], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 23.5, 27, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20, 23, 27, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29.5, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [20.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [26, 28.5, 31.5, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31.5, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 29, 32, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25, 29, 31, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31, 33, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [24.5, 28, 31, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24, 27, 30.5, 32, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [24, 27, 30, 32.5, 34], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22.5, 27, 30, 32, 33.5], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [23, 26, 29.5, 32, 33], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [23, 26, 29, 32, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 32, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 24.5, 28, 31, 33], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20, 24, 27.5, 31, 32.5], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30, 32], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 28, 31, 33], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32,33,34], y : [7,24,47,78,226,513,830,1017,947,645,352,157,55,6,1], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [33.0071, 31.4157, 28.7058, 28.2953, 30.2059, 28.9463, 29.966, 28.8252, 29.0882, 29.4689, 29.037, 28.9753, 29.3964, 27.8715, 28.9737, 30.1295, 29.0773, 28.0549, 30.8425, 29.1923, 29.0099, 29.7132, 29.854, 28.0417, 28.6801, 27.8732, 30.1923, 28.1266, 29.6892, 28.2576, 29.918, 32.3099, 30.8937, 29.7277, 33.1862, 29.7277, 32.9407, 28.9028, 30.3756, 27.7982, 29.5287, 28.0191, 31.701, 28.3873, 30.9278, 30.9278, 31.5906, 27.9087, 32.3638, 29.7496, 30.0442, 28.461, 29.4183, 29.3438, 29.8491, 29.5094, 28.6792, 29.3578, 26.3815], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7961, 17.5031, 19.955, 21.3037, 20.3037, 22.5651, 19.6944, 21.9345, 22.1789, 21.6076, 20.9517, 21.3132, 21.1431, 21.3099, 21.3767, 19.6891, 21.3653, 20.7399, 21.0549, 20.6695, 22.1289, 20.4141, 19.0914, 20.8768, 21.1349, 21.2902, 20.9115, 20.2144, 21.9756, 20.476, 20.526, 20.943, 18.904, 18.8374, 19.9043, 19.4628, 19.9853, 19.7717, 20.6922, 19.1826, 20.3976, 19.0722, 19.8822, 20.2135, 19.7717, 19.4404, 20.0295, 20.3976, 19.7717, 17.1208, 20.8763, 19.2194, 21.6863, 19.3512, 19.0943, 21.2453, 21.5094, 19.8394, 21.836], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [25.9735, 27.3154, 29.4623, 28.8505, 28.2713, 26.3644, 28.3956, 27.8622, 28.655, 27.6802, 29.1836, 29.4715, 29.6217, 29.9731, 29.1114, 29.3005, 29.0504, 30.3391, 28.7766, 29.4994, 29.3814, 30.2053, 30.6111, 30.0888, 30.3248, 30.8234, 29.9549, 31.4701, 28.7736, 30.7598, 31.8648, 29.5322, 30.8937, 31.4202, 29.507, 32.2664, 30.1803, 32.8056, 31.6642, 35.3461, 33.8733, 34.5361, 31.7378, 32.6215, 32.9161, 32.5479, 31.4433, 34.2047, 31.0751, 33.542, 31.3328, 33.3947, 32.4742, 33.1469, 33.283, 30.9057, 31.7736, 33.5245, 31.7291], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [21.2232, 23.7658, 21.8769, 21.5505, 21.2191, 22.1243, 21.944, 21.3781, 20.078, 21.2432, 20.8277, 20.24, 19.8387, 20.8456, 20.5382, 20.8808, 20.507, 20.866, 19.326, 20.6388, 19.4799, 19.6674, 20.4435, 20.9927, 19.8602, 20.0132, 18.9414, 20.1889, 19.5616, 20.5066, 17.6913, 17.2149, 19.3086, 20.0147, 17.4025, 18.543, 16.8936, 18.5199, 17.268, 17.673, 16.2003, 18.3726, 16.6789, 18.7776, 16.3844, 17.0839, 16.9367, 17.489, 16.7894, 19.5876, 17.7467, 18.9249, 16.4212, 18.1581, 17.7736, 18.3396, 18.0377, 17.2783, 20.0535], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [15, 15.5, 16.5, 17, 18, 21.5, 26.5, 30, 33.5, 36, 41, 47, 47.5, 56, 65.5, 69, 72.5, 77.5, 85.5, 94.5, 105.5, 113, 120, 131.5, 150, 172.5, 198, 217.5, 244.5, 281.5, 314.5, 337, 365, 402.5, 436, 463, 481.5, 505, 525, 510.5, 490.5, 493, 487, 483.5, 488, 475.5, 468, 468.5, 477, 473, 437.5, 416, 405.5, 397, 386, 365, 346, 343, 334, 320, 319, 301.5, 276.5, 245.5, 207.5, 191, 182, 173, 167, 151.5, 131.5, 121, 117.5, 110.5, 104, 90.5, 75, 67.5, 62.5, 61.5, 59, 57, 55, 47, 39, 38, 36.5, 35.5, 28.5, 21, 19, 17, 15.5, 14.5, 14, 13.5, 14.5, 15.5, 15.5, 16, 15, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [28.0542, 32.1238, 36.6593, 41.6938, 47.2594, 53.3867, 60.1047, 67.4392, 75.4129, 84.0443, 93.347, 103.329, 113.991, 125.329, 137.329, 149.968, 163.218, 177.037, 191.378, 206.18, 221.376, 236.889, 252.632, 268.511, 284.423, 300.259, 315.905, 331.242, 346.151, 360.507, 374.189, 387.078, 399.057, 410.016, 419.851, 428.469, 435.786, 441.729, 446.24, 449.272, 450.796, 450.796, 449.272, 446.24, 441.729, 435.786, 428.469, 419.851, 410.016, 399.057, 387.078, 374.189, 360.507, 346.151, 331.242, 315.905, 300.259, 284.423, 268.511, 252.632, 236.889, 221.376, 206.18, 191.378, 177.037, 163.218, 149.968, 137.329, 125.329, 113.991, 103.329, 93.347, 84.0443, 75.4129, 67.4392, 60.1047, 53.3867, 47.2594, 41.6938, 36.6593, 32.1238, 28.0542, 24.4174, 21.1802, 18.31, 15.7753, 13.5455, 11.5916, 9.88599, 8.40284, 7.11805, 6.00933, 5.05614, 4.23977, 3.54319, 2.95105, 2.44956, 2.02641, 1.6707, 1.37277, 1.12415, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","2 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","55 bp","56 bp","64 bp","97 bp","98 bp","106 bp","107 bp","108 bp"], y : [3,11,28,56,43,52,39,56,60,57,43,46,45,66,59,49,73,54,44,52,73,72,68,56,86,92,75,69,74,96,72,81,65,87,86,87,100,82,78,76,79,88,83,75,74,72,84,74,81,91,80,98,43,8,4,1,1,1,32,34,169,1122], text : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,64,97,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [98.1855, 0.937819, 0.122324, 0.0815494, 0, 0, 0, 0, 0, 0.672783, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.4425, 0.474912, 0.0412967, 0.0206484, 0, 0, 0, 0, 0, 0.0206484, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.142712,0.183486,0.224261,0.224261,0.224261,0.224261,0.224261,0.224261,0.265036,0.285423,0.326198,0.407747,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.468909,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.489297,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.509684,0.570846,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008,0.632008], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0.0203874,0.0815494,0.142712,0.183486,0.285423,0.38736,0.489297,0.591233,0.672783,0.754332,0.835882,0.917431,1.01937,1.1213,1.24363,1.34557,1.46789,1.59021,1.67176,1.75331,1.83486,1.89602,1.95719,2.01835,2.07951,2.14067,2.20183,2.263,2.32416,2.38532,2.44648,2.50765,2.60958,2.71152,2.81346,2.89501,2.99694,3.09888,3.20082,3.30275,3.40469,3.48624,3.56779,3.60856,3.62895,3.64934,3.66972,3.69011,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.7105,3.73089,3.75127,3.77166,3.81244,3.85321,3.89399,3.93476,3.97554,4.01631,4.05708,4.09786,4.13863,4.17941,4.22018,4.26096,4.32212,4.38328,4.42406,4.46483,4.50561,4.54638,4.58716,4.62793,4.66871,4.70948,4.75025,4.79103,4.8318,4.91335,4.9949,5.05607,5.09684,5.158,5.21916,5.28033,5.34149,5.40265,5.46381,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497,5.52497], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_reverse_complement.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_reverse_complement.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1597,114 +1597,114 @@ #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672783 No Hit >>END_MODULE ->>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.122324 0 0 0 0 -21 0.122324 0 0 0 0 -22 0.122324 0 0 0 0 -23 0.122324 0 0 0 0 -24 0.122324 0 0 0 0 -25 0.122324 0 0 0 0 -26 0.122324 0 0 0 0 -27 0.142712 0 0 0 0 -28 0.183486 0 0 0 0 -29 0.224261 0 0 0 0 -30 0.224261 0 0 0 0 -31 0.224261 0 0 0 0 -32 0.224261 0 0 0 0 -33 0.224261 0 0 0 0 -34 0.224261 0 0 0 0 -35 0.265036 0 0 0 0 -36 0.285423 0 0 0 0 -37 0.326198 0 0 0 0 -38 0.407747 0 0 0 0 -39 0.468909 0 0 0 0 -40 0.468909 0 0 0 0 -41 0.468909 0 0 0 0 -42 0.468909 0 0 0 0 -43 0.468909 0 0 0 0 -44 0.468909 0 0 0 0 -45 0.468909 0 0 0 0 -46 0.468909 0 0 0 0 -47 0.468909 0 0 0 0 -48 0.468909 0 0 0 0 -49 0.468909 0 0 0 0 -50 0.468909 0 0 0 0 -51 0.468909 0 0 0 0 -52 0.468909 0 0 0 0 -53 0.468909 0 0 0 0 -54 0.468909 0 0 0 0 -55 0.468909 0 0 0 0 -56 0.468909 0 0 0 0 -57 0.468909 0 0 0 0 -58 0.468909 0 0 0 0 -59 0.468909 0 0 0 0 -60 0.468909 0 0 0 0 -61 0.468909 0 0 0 0 -62 0.468909 0 0 0 0 -63 0.468909 0 0 0 0 -64 0.468909 0 0 0 0 -65 0.468909 0 0 0 0 -66 0.468909 0 0 0 0 -67 0.468909 0 0 0 0 -68 0.468909 0 0 0 0 -69 0.468909 0 0 0 0 -70 0.468909 0 0 0 0 -71 0.468909 0 0 0 0 -72 0.468909 0 0 0 0 -73 0.468909 0 0 0 0 -74 0.489297 0 0 0 0 -75 0.489297 0 0 0 0 -76 0.489297 0 0 0 0 -77 0.489297 0 0 0 0 -78 0.489297 0 0 0 0 -79 0.489297 0 0 0 0 -80 0.489297 0 0 0 0 -81 0.489297 0 0 0 0 -82 0.489297 0 0 0 0 -83 0.509684 0 0 0 0 -84 0.509684 0 0 0 0 -85 0.509684 0 0 0 0 -86 0.509684 0 0 0 0 -87 0.509684 0 0 0 0 -88 0.509684 0 0 0 0 -89 0.509684 0 0 0 0 -90 0.509684 0 0 0 0 -91 0.509684 0 0 0 0 -92 0.570846 0 0 0 0 -93 0.632008 0 0 0 0 -94 0.632008 0 0 0 0 -95 0.632008 0 0 0 0 -96 0.632008 0 0 0 0 -97 0.632008 0 0 0 0 -98 0.632008 0 0 0 0 -99 0.632008 0 0 0 0 -100 0.632008 0 0 0 0 -101 0.632008 0 0 0 0 -102 0.632008 0 0 0 0 -103 0.632008 0 0 0 0 -104 0.632008 0 0 0 0 -105 0.632008 0 0 0 0 -106 0.632008 0 0 0 0 -107 0.632008 0 0 0 0 -108 0.632008 0 0 0 0 +>>Adapter Content warn +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0.0203874 0 +2 0 0 0 0 0.0815494 0 +3 0 0 0 0 0.142712 0 +4 0 0 0 0 0.183486 0 +5 0 0 0 0 0.285423 0 +6 0 0 0 0 0.38736 0 +7 0 0 0 0 0.489297 0 +8 0 0 0 0 0.591233 0 +9 0 0 0 0 0.672783 0 +10 0 0 0 0 0.754332 0 +11 0 0 0 0 0.835882 0 +12 0 0 0 0 0.917431 0 +13 0 0 0 0 1.01937 0 +14 0 0 0 0 1.1213 0 +15 0 0 0 0 1.24363 0 +16 0 0 0 0 1.34557 0 +17 0 0 0 0 1.46789 0 +18 0 0 0 0 1.59021 0 +19 0 0 0 0 1.67176 0 +20 0.122324 0 0 0 1.75331 0 +21 0.122324 0 0 0 1.83486 0 +22 0.122324 0 0 0 1.89602 0 +23 0.122324 0 0 0 1.95719 0 +24 0.122324 0 0 0 2.01835 0 +25 0.122324 0 0 0 2.07951 0 +26 0.122324 0 0 0 2.14067 0 +27 0.142712 0 0 0 2.20183 0 +28 0.183486 0 0 0 2.263 0 +29 0.224261 0 0 0 2.32416 0 +30 0.224261 0 0 0 2.38532 0 +31 0.224261 0 0 0 2.44648 0 +32 0.224261 0 0 0 2.50765 0 +33 0.224261 0 0 0 2.60958 0 +34 0.224261 0 0 0 2.71152 0 +35 0.265036 0 0 0 2.81346 0 +36 0.285423 0 0 0 2.89501 0 +37 0.326198 0 0 0 2.99694 0 +38 0.407747 0 0 0 3.09888 0 +39 0.468909 0 0 0 3.20082 0 +40 0.468909 0 0 0 3.30275 0 +41 0.468909 0 0 0 3.40469 0 +42 0.468909 0 0 0 3.48624 0 +43 0.468909 0 0 0 3.56779 0 +44 0.468909 0 0 0 3.60856 0 +45 0.468909 0 0 0 3.62895 0 +46 0.468909 0 0 0 3.64934 0 +47 0.468909 0 0 0 3.66972 0 +48 0.468909 0 0 0 3.69011 0 +49 0.468909 0 0 0 3.7105 0 +50 0.468909 0 0 0 3.7105 0 +51 0.468909 0 0 0 3.7105 0 +52 0.468909 0 0 0 3.7105 0 +53 0.468909 0 0 0 3.7105 0 +54 0.468909 0 0 0 3.7105 0 +55 0.468909 0 0 0 3.7105 0 +56 0.468909 0 0 0 3.7105 0 +57 0.468909 0 0 0 3.7105 0 +58 0.468909 0 0 0 3.7105 0 +59 0.468909 0 0 0 3.73089 0 +60 0.468909 0 0 0 3.75127 0 +61 0.468909 0 0 0 3.77166 0 +62 0.468909 0 0 0 3.81244 0 +63 0.468909 0 0 0 3.85321 0 +64 0.468909 0 0 0 3.89399 0 +65 0.468909 0 0 0 3.93476 0 +66 0.468909 0 0 0 3.97554 0 +67 0.468909 0 0 0 4.01631 0 +68 0.468909 0 0 0 4.05708 0 +69 0.468909 0 0 0 4.09786 0 +70 0.468909 0 0 0 4.13863 0 +71 0.468909 0 0 0 4.17941 0 +72 0.468909 0 0 0 4.22018 0 +73 0.468909 0 0 0 4.26096 0 +74 0.489297 0 0 0 4.32212 0 +75 0.489297 0 0 0 4.38328 0 +76 0.489297 0 0 0 4.42406 0 +77 0.489297 0 0 0 4.46483 0 +78 0.489297 0 0 0 4.50561 0 +79 0.489297 0 0 0 4.54638 0 +80 0.489297 0 0 0 4.58716 0 +81 0.489297 0 0 0 4.62793 0 +82 0.489297 0 0 0 4.66871 0 +83 0.509684 0 0 0 4.70948 0 +84 0.509684 0 0 0 4.75025 0 +85 0.509684 0 0 0 4.79103 0 +86 0.509684 0 0 0 4.8318 0 +87 0.509684 0 0 0 4.91335 0 +88 0.509684 0 0 0 4.9949 0 +89 0.509684 0 0 0 5.05607 0 +90 0.509684 0 0 0 5.09684 0 +91 0.509684 0 0 0 5.158 0 +92 0.570846 0 0 0 5.21916 0 +93 0.632008 0 0 0 5.28033 0 +94 0.632008 0 0 0 5.34149 0 +95 0.632008 0 0 0 5.40265 0 +96 0.632008 0 0 0 5.46381 0 +97 0.632008 0 0 0 5.52497 0 +98 0.632008 0 0 0 5.52497 0 +99 0.632008 0 0 0 5.52497 0 +100 0.632008 0 0 0 5.52497 0 +101 0.632008 0 0 0 5.52497 0 +102 0.632008 0 0 0 5.52497 0 +103 0.632008 0 0 0 5.52497 0 +104 0.632008 0 0 0 5.52497 0 +105 0.632008 0 0 0 5.52497 0 +106 0.632008 0 0 0 5.52497 0 +107 0.632008 0 0 0 5.52497 0 +108 0.632008 0 0 0 5.52497 0 >>END_MODULE
--- a/test-data/fastqc_report_reverse_complement_summary.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_reverse_complement_summary.txt Tue Sep 10 19:02:42 2024 +0000 @@ -8,4 +8,4 @@ WARN Sequence Length Distribution 1000trimmed_fastq PASS Sequence Duplication Levels 1000trimmed_fastq WARN Overrepresented sequences 1000trimmed_fastq -PASS Adapter Content 1000trimmed_fastq +WARN Adapter Content 1000trimmed_fastq
--- a/test-data/fastqc_report_subsample.html Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_subsample.html Tue Sep 10 19:02:42 2024 +0000 @@ -1,2 +1,2 @@ -<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Mon May 27 17:06:18 2024 -<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="pass" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="pass" id="overrepresentedsequences"> Overrepresented sequences : pass</h2> No overrepresented sequences</div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.2</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [24, 28, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 34], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22.5, 26.5, 30, 32, 33.5], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [21.5, 26, 30, 32, 33.5], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33.5], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [21.5, 25.5, 29, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21.5, 25.5, 28.5, 31.5, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21.5, 24.5, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24.5, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 32], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24.5, 28, 31, 32.5], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [21, 24, 27.5, 30.5, 32.5], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30.5, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 22.5, 26.5, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20.5, 23, 26.5, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [18.5, 22, 26, 29, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [21.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [23.5, 28, 30.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25, 28, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [23.5, 27.5, 30.5, 32.5, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 27.5, 30, 32, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [23.5, 27.5, 30.5, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [23.5, 27, 30, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24.5, 27, 30.5, 32.5, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [23.5, 28, 30, 32.5, 33], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22, 26.5, 29.5, 32, 33], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33.5], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 31.5, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31.5, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [21.5, 25, 28.5, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32.5], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 23.5, 27.5, 30.5, 32.5], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 26.5, 30, 32], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29, 31.5], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 27, 30, 32], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32], y : [1,1,3,10,37,48,79,100,92,68,33,16,3], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [32.9939, 29.7959, 31.0204, 29.6907, 32.3529, 33.121, 27.897, 28.1996, 27.3128, 29.5045, 29.1284, 26.0613, 27.6156, 26.8015, 27.1429, 32.5333, 29.2985, 29.9281, 27.451, 30.3544, 28.0449, 30.5509, 30.8511, 27.1881, 29.2157, 27.027, 29.5195, 30.1703, 31.8059, 29.4671, 27.9863, 32.2695, 31.7857, 33.2143, 37.8571, 27.1429, 35.8423, 27.3381, 25.8993, 25.1799, 28.4173, 27.3381, 32.7338, 30.5755, 30.5755, 26.259, 30.5755, 29.1367, 35.6115, 30.9353, 30.9353, 30.2158, 26.259, 28.3636, 31.9853, 29.0441, 29.0441, 28.5185, 27.2727], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [18.3299, 18.1633, 20, 20.6186, 19.958, 21.6561, 21.03, 21.9089, 23.5683, 20.8333, 21.789, 20.7547, 21.4112, 21.3654, 21.2987, 18.9333, 22.2834, 22.1583, 20.8145, 18.1818, 21.9551, 19.6995, 18.0851, 20.4842, 22.549, 23.0769, 20.595, 15.8151, 20.2156, 18.4953, 22.1843, 18.0851, 17.1429, 17.1429, 18.9286, 20, 18.9964, 19.0647, 17.9856, 20.8633, 17.2662, 21.9424, 18.705, 23.741, 19.4245, 20.8633, 19.4245, 19.4245, 20.8633, 16.5468, 16.1871, 19.0647, 24.1007, 18.9091, 12.8676, 21.6912, 19.8529, 21.1111, 19.0083], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [28.9206, 26.5306, 27.1429, 27.4227, 25.4202, 24.6285, 26.6094, 27.3319, 29.2952, 28.3784, 27.0642, 31.7217, 30.5353, 29.8357, 29.2208, 27.7333, 29.1609, 28.6331, 29.2609, 30.5085, 31.7308, 31.5526, 33.3333, 31.6574, 28.8235, 29.106, 30.2059, 35.2798, 26.9542, 29.7806, 31.7406, 31.9149, 28.5714, 29.6429, 25.3571, 31.7857, 30.8244, 32.7338, 39.5683, 36.6906, 35.9712, 30.5755, 32.0144, 31.295, 30.9353, 33.0935, 32.7338, 35.9712, 29.4964, 36.6906, 32.3741, 32.0144, 32.0144, 34.5455, 37.8676, 29.0441, 31.6176, 32.5926, 29.7521], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7556, 25.5102, 21.8367, 22.268, 22.2689, 20.5945, 24.4635, 22.5597, 19.8238, 21.2838, 22.0183, 21.4623, 20.438, 21.9975, 22.3377, 20.8, 19.2572, 19.2806, 22.4736, 20.9553, 18.2692, 18.197, 17.7305, 20.6704, 19.4118, 20.79, 19.6796, 18.7348, 21.0243, 22.2571, 18.0887, 17.7305, 22.5, 20, 17.8571, 21.0714, 14.3369, 20.8633, 16.5468, 17.2662, 18.3453, 20.1439, 16.5468, 14.3885, 19.0647, 19.7842, 17.2662, 15.4676, 14.0288, 15.8273, 20.5036, 18.705, 17.6259, 18.1818, 17.2794, 20.2206, 19.4853, 17.7778, 23.9669], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [2, 2, 2, 2.5, 3, 3, 3.5, 4.5, 5.5, 5.5, 5, 5, 5, 7, 9.5, 10.5, 11, 12.5, 13, 12, 15, 18.5, 20, 19, 17, 16.5, 19, 22.5, 23, 25, 32, 36, 36.5, 40.5, 49, 54, 52, 55, 55, 48.5, 45, 45, 43.5, 41.5, 40.5, 40.5, 43, 46, 52, 56.5, 53, 46.5, 43, 41, 41.5, 42, 39.5, 39, 40.5, 38.5, 37, 34, 29, 24.5, 21.5, 20.5, 17.5, 15.5, 15.5, 16, 14.5, 12, 11, 10, 9.5, 10, 9.5, 8.5, 8, 7.5, 7, 6.5, 6, 5, 4, 4.5, 4.5, 4, 3.5, 3, 3, 3, 3, 3, 3.5, 4.5, 5, 4, 3, 3, 3, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [1.06278, 1.23822, 1.43807, 1.66492, 1.9215, 2.21064, 2.5353, 2.89849, 3.30329, 3.75278, 4.25002, 4.79801, 5.39962, 6.05755, 6.77428, 7.55199, 8.3925, 9.29722, 10.2671, 11.3025, 12.4031, 13.5681, 14.7959, 16.084, 17.4293, 18.8277, 20.2744, 21.7635, 23.2885, 24.842, 26.4158, 28.001, 29.5879, 31.1665, 32.7259, 34.2554, 35.7436, 37.1791, 38.5506, 39.847, 41.0575, 42.1717, 43.1799, 44.0731, 44.8433, 45.4835, 45.9878, 46.3514, 46.5709, 46.6443, 46.5709, 46.3514, 45.9878, 45.4835, 44.8433, 44.0731, 43.1799, 42.1717, 41.0575, 39.847, 38.5506, 37.1791, 35.7436, 34.2554, 32.7259, 31.1665, 29.5879, 28.001, 26.4158, 24.842, 23.2885, 21.7635, 20.2744, 18.8277, 17.4293, 16.084, 14.7959, 13.5681, 12.4031, 11.3025, 10.2671, 9.29722, 8.3925, 7.55199, 6.77428, 6.05755, 5.39962, 4.79801, 4.25002, 3.75278, 3.30329, 2.89849, 2.5353, 2.21064, 1.9215, 1.66492, 1.43807, 1.23822, 1.06278, 0.90934, 0.775603, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","64 bp","98 bp","106 bp","107 bp","108 bp"], y : [1,5,9,5,5,5,7,8,4,3,6,6,6,7,6,9,7,4,6,6,2,9,3,9,11,8,5,3,3,7,8,3,11,8,8,6,7,5,10,5,9,14,7,6,7,13,7,17,11,5,5,2,2,1,3,2,13,121], text : [1,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,64,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.389, 0, 0.610998, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.7955, 0, 0.204499, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0407747,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.101937,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5 prime Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "SOLID Small RNA Adapter"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file +<html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no"> <title> 1000trimmed_fastq - report </title><link rel="stylesheet" href="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/css/bootstrap.min.css" integrity="sha384-ggOyR0iXCbMQv3Xipma34MD+dH/1fQ784/j6cY/iJTQUOhcWr7x9JvoRxT2MZw1T" crossorigin="anonymous"><link href="https://stackpath.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet" integrity="sha384-wvfXpqpZZVQGK6TAh5PVlGOfQNHSoD2xbE+QkPxCAFlNEevoEH3Sl0sibVcOQVnN" crossorigin="anonymous"><style type="text/css"> @media screen { div.summary { width: 18em; position:fixed; top: 4em; margin:1em 0 0 1em; } div.main { display:block; position:absolute; overflow:auto; height:auto; width:auto; top:4.5em; bottom:2.3em; left:18em; right:0; border-left: 1px solid #CCC; padding:0 0 0 1em; background-color: white; z-index:1; } div.header { background-color: #EEE; border:0; margin:0; padding: 0.2em; font-size: 200%; position:fixed; width:100%; top:0; left:0; z-index:2; } div.footer { background-color: #EEE; border:0; margin:0; padding:0.5em; height: 2.5em; overflow:hidden; font-size: 100%; position:fixed; bottom:0; width:100%; z-index:2; } img.indented { margin-left: 3em; } } @media print { img { max-width:100% !important; page-break-inside: avoid; } h2, h3 { page-break-after: avoid; } div.header { background-color: #FFF; } } body { color: #000; background-color: #FFF; border: 0; margin: 0; padding: 0; } div.header { border:0; margin:0; padding: 0.5em; font-size: 200%; width:100%; } #header_title { display:inline-block; float:left; clear:left; } #header_filename { display:inline-block; float:right; clear:right; font-size: 50%; margin-right:2em; text-align: right; } div.header h3 { font-size: 50%; margin-bottom: 0; } div.summary ul { padding-left:0; list-style-type:none; } div.summary ul li img { margin-bottom:-0.5em; margin-top:0.5em; } div.main { background-color: white; } div.module { padding-bottom:3em; padding-top:3em; border-bottom: 1px solid #990000 } div.footer { background-color: #EEE; border:0; margin:0; padding: 0.5em; font-size: 100%; width:100%; } h2 { color: #2a5e8c; padding-bottom: 0; margin-bottom: 0; clear:left; }table { margin-left: 3em; text-align: center; } th { text-align: center; background-color: #000080; color: #FFF; padding: 0.4em;} td { font-family: monospace; text-align: left; background-color: #EEE; color: #000; padding: 0.4em;}img { padding-top: 0; margin-top: 0; border-top: 0;} p { padding-top: 0; margin-top: 0;}.pass { color : #009900;}.warn { color : #999900;}.fail { color : #990000;}</style><script src="https://cdn.plot.ly/plotly-latest.min.js"></script></head><body><div class="header"> <div id="header_title">Report</div> <div id="header_filename">Sun Sep 1 15:40:37 2024 +<br/> 1000trimmed_fastq </div></div><div class="summary"><h2>Summary</h2><ul> <li><a class="pass" href="#basicstatistics"> Basic Statistics </a></li> <li><a class="pass" href="#perbasesequencequality"> Per base sequence quality</a></li> <li><a class="fail" href="#pertilesequencequality">Per tile sequence quality</a></li> <li><a class="pass" href="#persequencequalityscores">Per sequence quality scores</a></li> <li><a class="fail" href="#perbasesequencecontent">Per base sequence content</a></li> <li><a class="warn" href="#persequencegccontent">Per sequence GC content</a></li> <li><a class="pass" href="#perbasencontent">Per base N content</a></li> <li><a class="warn" href="#sequencelengthdistribution">Sequence Length Distribution</a></li> <li><a class="pass" href="#sequenceduplicationlevels">Sequence Duplication Levels</a></li> <li><a class="pass" href="#overrepresentedsequences">Overrepresented sequences</a></li> <li><a class="pass" href="#adaptercontent">Adapter Content</a></li> <!-- <li><a class="{{passkmercontent}}" href="#kmercontent">{{kmercontentname}}</a></li> --></ul></div><div class="main"><div class="module"> <h2 class="pass" id="basicstatistics"> Basic Statistics: pass </h2> <table><thead><tr><th>Measure</th><th>Value</th></tr></thead><tbody><tr><td>Filename</td><td>1000trimmed_fastq</td></tr><tr><td>File type</td><td>Conventional base calls</td></tr><tr><td>Encoding</td><td>Sanger / Illumina 1.9</td></tr><tr><td>Total Sequences</td><td>4905</td></tr><tr><td>Sequences Flagged As Poor Quality</td><td>0</td></tr><tr><td>Sequence length</td><td>1 - 108</td></tr><tr><td>%GC:</td><td>41</td></tr></tbody></table></div><div class="module"> <h2 class="pass" id="perbasesequencequality"> Per base sequence quality: pass</h2> <div id="seqbasequalityboxplot"></div></div><div class="module"> <h2 class="fail" id="pertilesequencequality"> Per tile sequence quality : fail </h2> <div id="tilequalityheatmap"></div></div><div class="module"> <h2 class="pass" id="persequencequalityscores"> Per sequence quality scores : pass </h2> <div id="seqqualitylineplot"></div></div><div class="module"> <h2 class="fail" id="perbasesequencecontent"> Per base sequence content : fail </h2> <div id="basesequencecontentlineplot"></div></div><div class="module"> <h2 class="warn" id="persequencegccontent"> Per sequence GC content: warn </h2> <div id="sequencegccontentlineplot"></div></div><div class="module"> <h2 class="pass" id="perbasencontent"> Per base N content : pass </h2> <div id="basencontentlineplot"></div></div><div class="module"> <h2 class="warn" id="sequencelengthdistribution"> Sequence Length Distribution : warn </h2> <div id="sequencelengthdistributionlineplot"></div></div><div class="module"> <h2 class="pass" id="sequenceduplicationlevels"> Sequence Duplication Levels : pass </h2> <div id="seqduplevelslineplot"></div></div><div class="module"> <h2 class="pass" id="overrepresentedsequences"> Overrepresented sequences : pass</h2> No overrepresented sequences</div><div class="module"> <h2 class="pass" id="adaptercontent"> Adapter Content : pass </h2> <div id="adapterlineplot"></div></div><!--<div class="module"> <h2 class="{{passkmercontent}}" id="kmercontent"> {{kmercontentname}} : {{passkmercontent}} </h2> <div id="kmerlineplot"></div></div>--></div><div class="footer">Falco 1.2.3</div></body><script src="https://code.jquery.com/jquery-3.3.1.slim.min.js" integrity="sha384-q8i/X+965DzO0rT7abK41JStQIAqVgRVzpbzo5smXKp4YfRvH+8abtTE1Pi6jizo" crossorigin="anonymous"></script><script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.14.7/umd/popper.min.js" integrity="sha384-UO2eT0CpHqdSJQ6hJty5KVphtPhzWj9WO1clHTMGa3JDZwrnQq4sF86dIHNDz0W1"crossorigin="anonymous"></script><script src="https://stackpath.bootstrapcdn.com/bootstrap/4.3.1/js/bootstrap.min.js"integrity="sha384-JjSmVgyd0p3pXB1rRibZUAYoIIy6OrQ6VrjIEaFf/nJGzIxFDsf4x0xIM+B07jRM"crossorigin="anonymous"></script><script> if (document.getElementById('seqbasequalityboxplot') !== null) { Plotly.newPlot('seqbasequalityboxplot', [ {y : [24, 28, 31, 33, 34], type : 'box', name : ' 1bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 2bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 34], type : 'box', name : ' 3bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 4bp', marker : {color : 'green'}}, {y : [22, 27, 30, 32, 33], type : 'box', name : ' 5bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 6bp', marker : {color : 'green'}}, {y : [23, 27, 30, 32, 33], type : 'box', name : ' 7bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 34], type : 'box', name : ' 8bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33], type : 'box', name : ' 9bp', marker : {color : 'green'}}, {y : [22.5, 26, 30, 32, 33], type : 'box', name : ' 10-11bp', marker : {color : 'green'}}, {y : [22.5, 26.5, 30, 32, 33.5], type : 'box', name : ' 12-13bp', marker : {color : 'green'}}, {y : [22, 26, 30, 32, 33.5], type : 'box', name : ' 14-15bp', marker : {color : 'green'}}, {y : [21.5, 26, 30, 32, 33.5], type : 'box', name : ' 16-17bp', marker : {color : 'green'}}, {y : [22, 26.5, 30, 32, 33.5], type : 'box', name : ' 18-19bp', marker : {color : 'green'}}, {y : [21.5, 25.5, 29, 32, 33], type : 'box', name : ' 20-21bp', marker : {color : 'green'}}, {y : [22, 26, 29.5, 32, 33], type : 'box', name : ' 22-23bp', marker : {color : 'green'}}, {y : [21, 25, 29, 32, 33], type : 'box', name : ' 24-25bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 32, 33], type : 'box', name : ' 26-27bp', marker : {color : 'green'}}, {y : [21.5, 25.5, 28.5, 31.5, 33], type : 'box', name : ' 28-29bp', marker : {color : 'green'}}, {y : [21.5, 24.5, 29, 31.5, 33], type : 'box', name : ' 30-31bp', marker : {color : 'green'}}, {y : [21, 25, 29, 31, 33], type : 'box', name : ' 32-33bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 33], type : 'box', name : ' 34-35bp', marker : {color : 'green'}}, {y : [20.5, 24.5, 28, 31, 33], type : 'box', name : ' 36-37bp', marker : {color : 'green'}}, {y : [21, 24, 28, 31, 32], type : 'box', name : ' 38-39bp', marker : {color : 'green'}}, {y : [20.5, 24.5, 28, 31, 32.5], type : 'box', name : ' 40-41bp', marker : {color : 'green'}}, {y : [21, 24, 27.5, 30.5, 32.5], type : 'box', name : ' 42-43bp', marker : {color : 'green'}}, {y : [20.5, 24, 27, 30, 32], type : 'box', name : ' 44-45bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 27, 30.5, 32], type : 'box', name : ' 46-47bp', marker : {color : 'green'}}, {y : [20, 22.5, 26.5, 30, 32], type : 'box', name : ' 48-49bp', marker : {color : 'green'}}, {y : [20.5, 23, 26.5, 30, 32], type : 'box', name : ' 50-51bp', marker : {color : 'green'}}, {y : [18.5, 22, 26, 29, 31.5], type : 'box', name : ' 52-53bp', marker : {color : 'green'}}, {y : [21.5, 25.5, 29.5, 31.5, 33], type : 'box', name : ' 54-55bp', marker : {color : 'green'}}, {y : [25, 28.5, 31.5, 33, 34], type : 'box', name : ' 56-57bp', marker : {color : 'green'}}, {y : [24, 27.5, 31, 33, 34], type : 'box', name : ' 58-59bp', marker : {color : 'green'}}, {y : [26, 29, 31, 33, 34], type : 'box', name : ' 60-61bp', marker : {color : 'green'}}, {y : [25.5, 29, 31.5, 33, 34], type : 'box', name : ' 62-63bp', marker : {color : 'green'}}, {y : [23.5, 28, 30.5, 33, 34], type : 'box', name : ' 64-65bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 66-67bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 68-69bp', marker : {color : 'green'}}, {y : [25.5, 28.5, 31.5, 33, 34], type : 'box', name : ' 70-71bp', marker : {color : 'green'}}, {y : [25, 28, 31.5, 33, 34], type : 'box', name : ' 72-73bp', marker : {color : 'green'}}, {y : [23.5, 27.5, 30.5, 32.5, 34], type : 'box', name : ' 74-75bp', marker : {color : 'green'}}, {y : [24.5, 27.5, 30, 32, 34], type : 'box', name : ' 76-77bp', marker : {color : 'green'}}, {y : [24, 28, 31, 33, 34], type : 'box', name : ' 78-79bp', marker : {color : 'green'}}, {y : [23.5, 27.5, 30.5, 33, 34], type : 'box', name : ' 80-81bp', marker : {color : 'green'}}, {y : [23.5, 27, 30, 32.5, 34], type : 'box', name : ' 82-83bp', marker : {color : 'green'}}, {y : [24.5, 27, 30.5, 32.5, 34], type : 'box', name : ' 84-85bp', marker : {color : 'green'}}, {y : [23.5, 28, 30, 32.5, 33], type : 'box', name : ' 86-87bp', marker : {color : 'green'}}, {y : [22, 26.5, 29.5, 32, 33], type : 'box', name : ' 88-89bp', marker : {color : 'green'}}, {y : [22, 26, 29, 32, 33.5], type : 'box', name : ' 90-91bp', marker : {color : 'green'}}, {y : [22.5, 26, 29, 31.5, 33], type : 'box', name : ' 92-93bp', marker : {color : 'green'}}, {y : [22, 25.5, 29, 31.5, 33], type : 'box', name : ' 94-95bp', marker : {color : 'green'}}, {y : [21.5, 25, 28.5, 31, 33], type : 'box', name : ' 96-97bp', marker : {color : 'green'}}, {y : [21.5, 25, 28, 31, 33], type : 'box', name : ' 98-99bp', marker : {color : 'green'}}, {y : [20.5, 24, 27.5, 31, 32.5], type : 'box', name : ' 100-101bp', marker : {color : 'green'}}, {y : [21, 23.5, 27.5, 30.5, 32.5], type : 'box', name : ' 102-103bp', marker : {color : 'green'}}, {y : [20.5, 23.5, 26.5, 30, 32], type : 'box', name : ' 104-105bp', marker : {color : 'green'}}, {y : [19.5, 22.5, 26.5, 29, 31.5], type : 'box', name : ' 106-107bp', marker : {color : 'green'}}, {y : [22, 24, 27, 30, 32], type : 'box', name : ' 108bp', marker : {color : 'green'}}, ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'Phread quality'}, });}if (document.getElementById('tilequalityheatmap') !== null) { Plotly.newPlot('tilequalityheatmap', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y: [0,1,2,3,4,5,6,7,8,9,10], z: [[-29.4857,-28.7721,-28.5832,-28.7282,-28.9662,-28.9765,-29.0324,-28.9563,-28.4479,-28.2935,-28.6264,-28.711,-28.5163,-28.3915,-28.2392,-28.5304,-28.3975,-28.5859,-28.6272,-28.1273,-28.2058,-28.1046,-28.3908,-28.0801,-28.0111,-27.9571,-28.1062,-27.7915,-27.6043,-27.7709,-27.5781,-27.8211,-27.6197,-27.447,-27.3368,-27.2226,-27.2582,-27.2825,-26.7901,-26.9377,-27.17,-27.1488,-26.1931,-26.6119,-26.5613,-26.7864,-26.3367,-26.2903,-25.7095,-26.3457,-26.0927,-25.7055,-24.9716,-26,-30.4161,-30.3869,-30.1825,-29.6569,-30.0876,-30.146,-30.4891,-30.9197,-30.0511,-29.5255,-30.0956,-30.4559,-30.0588,-30.1176,-29.9853,-30.4191,-30.1029,-30.2206,-30.2132,-29.2721,-29.25,-29.7206,-29.8015,-29.7794,-29.6838,-29.5956,-29.4412,-29.3824,-29.375,-29.6176,-29.1544,-29.2059,-29.0074,-28.8162,-28.3603,-28.0809,-28.8309,-28.5882,-28.1618,-27.8897,-28.0074,-28.1471,-27.6471,-27.5662,-27.4485,-27.4044,-26.9265,-27.2132,-26.5882,-26.8603,-26.2868,-26.0588,-25.1343,-27.2314], [0.904969,0.618551,0.463713,-0.165716,-0.0790766,0.136407,0.0643768,-0.311171,0.352106,0.23988,-0.059757,-0.982196,0.0260938,0.367111,1.12283,0.00406913,0.374399,0.128427,0.154569,0.911943,0.264783,-0.124558,-0.615325,-0.794396,-0.0315502,-0.957143,-0.780108,-0.204584,-0.343425,0.540213,-0.200347,0.0425501,0.213661,0.124409,0.419328,0.0700681,-0.437669,-1.33516,-0.654941,0.170365,-1.22718,-0.266407,0.473534,-0.248236,0.00117925,-0.108988,-0.30335,-0.0980149,-0.361671,-0.302201,-0.807001,0.294521,-1.12163,0,1.21552,0.98156,-0.656166,-0.0253554,-0.982328,-1.40914,-0.752209,-1.13023,-0.20899,-1.26239,-0.428922,-1.06699,0.885621,0.0490196,1.01471,1.41422,0.674837,0.334967,-0.602124,-0.0498366,-0.0833333,-0.887255,0.198529,-0.668301,0.705065,-0.262255,-1.10784,0.506536,-0.819444,0.493464,-0.154412,0.627451,-0.00735294,1.18382,0.750817,0.585784,-0.664216,-1.2549,0.504902,0.110294,-0.618464,0.186275,-0.202614,0.489379,-0.504085,0.0955882,0.740196,-0.268791,-0.699346,0.250817,-0.953431,-0.392157,-1.41211,-0.878464], [0.530738,-0.526172,-0.829064,-1.23641,-0.542445,-0.252358,-1.1574,-0.0836046,-0.11456,-0.351146,-0.806424,-0.791009,-1.31628,0.0459906,-1.0309,-0.721903,-1.63666,0.0569986,-0.432127,-0.127273,-0.280805,-0.929558,-0.740836,-0.874982,-0.511142,0.0984127,-0.106195,-0.379776,-1.39217,-2.25575,-1.89062,-1.38359,-2.84548,-2.41476,-2.23677,-2.40119,-2.52741,-2.0133,-2.16508,-1.06274,0.258531,-1.81543,-1.03524,-1.71714,-1.09073,-0.0989078,-3.64918,-1.07604,-2.32488,-0.845679,-2.19272,-1.50548,-1.57163,-3.9,1.80616,-0.053528,0.595296,-4.3236,-2.30981,1.18735,-0.933496,-1.36415,-0.60665,-0.636659,-3.87337,-1.01144,-1.72549,-0.00653595,-2.31863,-1.08578,-3.32516,-2.3317,-0.65768,0.61683,0.638889,-0.831699,-1.35703,-1.55719,-0.572712,-1.15114,1.3366,1.1732,-1.59722,-2.06209,-4.82108,-2.98366,-3.78513,-2.0384,-3.24918,-2.52533,-3.49755,-1.47712,-2.16176,-2.66748,0.103758,-2.36928,-2.0915,-2.7884,-1.22631,0.0400327,-3.92647,-1.8799,-2.03268,-1.86029,-2.95343,0.0522876,-1.91211,-2.94569], [-0.172223,-0.339238,0.670569,0.347542,0.503524,-0.914957,0.798372,0.231168,-0.6737,0.14203,-0.223198,-0.415927,0.29728,-0.0294405,-0.221377,-0.601842,-1.23682,-1.22222,-0.778193,0.684048,-0.436574,0.0915208,0.569164,1.00322,-0.181355,-0.659271,-0.795084,-0.745029,0.465473,-0.212758,0.00327035,-0.00713277,-0.224323,-0.400508,0.00469366,0.602385,0.00497608,1.74525,0.238495,-0.967155,0.314808,0.302853,-0.160875,-2.07854,-0.927987,0.146926,-0.372398,1.01737,1.21358,1.21954,1.31638,-0.387298,-0.521631,-1.8,-0.216058,1.11314,1.16752,0.493066,0.312409,0.254015,1.01095,0.730292,-0.701095,0.374453,-0.245588,0.194118,0.891176,-0.767647,0.464706,-0.0691176,-1.60294,-2.62059,-1.51324,-0.772059,-0.65,-0.420588,-0.351471,-0.329412,-1.53382,-1.44559,-1.74118,-1.38235,-0.475,-1.51765,0.145588,-0.305882,-0.307353,-1.11618,-0.660294,0.869118,-0.0808824,1.51176,-0.761765,-2.23971,0.742647,0.352941,-1.04706,-2.86618,-0.398529,0.445588,-0.626471,0.836765,0.911765,0.839706,1.41324,-0.508824,0.0235664,-0.668905], [-0.00946526,0.421474,-0.599291,-0.36756,-0.310436,-0.373047,0.381396,0.236651,-0.851402,-0.293454,-0.11699,0.0248399,-0.138921,-0.0141509,-0.258465,0.80292,1.13308,0.169243,0.148261,0.0564007,-0.0833558,-0.125391,-0.474169,-0.746777,0.233302,0.865079,0.00491642,-0.413763,-0.715406,-0.498171,-0.53267,-0.588528,0.0946136,0.35298,0.191008,-0.389282,-0.22961,-0.539671,0.121688,0.304681,-1.10943,0.00275482,0.0649315,0.745271,-0.116876,-1.00863,-0.256683,0.418011,0.457169,-2.05996,-0.759382,-0.455479,0.659948,-0.166667,-0.471614,-0.109084,-0.738037,-1.04582,-0.698702,0.0206813,-0.155718,0.746959,-1.60665,-0.636659,-0.0400327,-0.678105,-1.55882,-0.839869,-0.429739,-1.03023,0.674837,0.501634,0.0645425,-0.716503,0.638889,0.612745,-0.857026,-0.723856,-0.0171569,-0.762255,0.614379,-0.993464,-1.26389,-0.339869,-0.154412,-0.428105,-0.451797,-0.593954,-0.304739,-0.0808824,0.780229,-1.58824,-0.939542,-0.167484,-1.28513,0.24183,1.4085,0.0449346,-1.67075,-1.01552,-0.982026,0.564542,-0.143791,-1.91585,-0.508987,-0.503268,1.15979,-0.481405], [1.02228,0.307291,0.385092,0.481462,0.0499557,0.894472,0.361045,0.643668,0.83544,1.02858,0.746458,0.594076,0.173376,0.832628,0.181818,-0.184959,0.250617,-0.151896,0.7453,0.715865,0.834195,0.997483,0.405083,0.239038,-0.606887,1.86104,1.18926,0.799368,1.00036,1.0198,0.793968,0.607485,0.689852,0.0529801,0.472754,0.427385,0.891818,0.9226,1.39911,1.03448,1.60774,0.394097,-0.102224,0.974335,0.645576,-0.165718,0.806174,-1.62366,0.570503,0.17606,0.342067,-0.401132,-1.01511,-0.130435,0.311214,-0.432316,0.999336,1.07034,0.0942269,-0.555076,0.329131,-0.419708,1.26709,1.29263,1.44987,0.362299,0.941176,0.700535,-1.80348,0.35361,2.21524,1.00668,0.74131,0.273396,-0.386364,0.643048,0.698529,-0.870321,-1.13837,1.04078,0.286096,0.117647,0.352273,0.336898,0.300134,0.930481,1.08356,-0.179813,0.0487968,-0.580882,-0.0127005,1.09358,1.38369,1.11029,0.947193,-0.237968,-0.283422,0.752005,0.824198,-0.449866,0.846257,-1.57687,-0.270053,-0.496658,0.122326,0.0775401,-1.31615,-0.881405], [-0.394747,-0.105407,-0.0680107,0.0899661,-0.0570825,0.417444,-0.123306,-1.77451,-0.932742,0.237796,0.811076,1.13274,-0.391279,-2.32901,-0.145484,-0.186664,-1.05378,-0.804609,-1.17564,-1.57889,-0.334837,0.185765,-0.390836,-0.75753,-1.33372,-1.69908,-0.141909,-0.311541,0.0207055,-0.379593,1.24006,-0.571086,-0.198619,0.395085,0.941008,0.944052,2.74182,1.46747,0.584924,-1.25024,-0.236707,1.38457,1.40687,1.32146,1.83868,1.81359,-0.60335,-2.62366,-0.352354,1.15432,-0.692715,0.0722983,0.13948,1.44444,-1.41606,-1.49797,-1.18248,0.454177,1.46796,1.7429,1.28873,0.969181,1.17113,0.918897,1.57108,1.87745,-0.72549,0.771242,0.903595,0.580882,-3.21405,0.00163399,0.00898693,-1.16095,0.305556,0.0571895,-0.468137,1.3317,0.982843,1.73775,0.336601,0.173203,0.291667,-0.173203,0.623366,-1.4281,0.32598,1.07271,1.63971,0.585784,2.39134,0.189542,-0.161765,-0.889706,-1.56291,1.29739,0.464052,1.2116,2.21814,1.48448,-1.48203,-2.21324,-0.143791,1.69526,-0.508987,-0.281046,-0.0232172,2.1436], [-1.03404,0.582765,0.0942571,0.529849,-0.366173,0.356838,-0.0990641,0.112634,1.90925,1.02797,0.262465,0.251954,2.44526,1.45464,0.240766,0.829586,1.32247,1.49414,-0.187249,-0.447273,1.0742,-1.46456,0.849164,0.95989,1.90552,-0.582143,-1.14786,0.344823,1.77666,0.514816,0.421875,-0.821086,1.13033,1.44772,0.189546,-0.169983,1.26813,0.717472,-0.790076,0.00962523,1.61943,-0.569813,-0.0820219,0.665906,-1.14956,-1.25307,0.19665,-0.356989,-1.64283,-1.27901,0.490618,0.127854,0.195035,0.916667,-0.0827251,-1.13686,-0.599148,-0.656934,0.662409,-0.312652,0.260949,0.413625,1.69891,1.72445,0.571078,-1.03922,-0.142157,-0.867647,1.51471,0.747549,1.56373,0.696078,-0.546569,-0.938725,0.166667,-0.637255,1.53186,0.803922,1.48284,-0.178922,-1.52451,0.20098,0.125,-0.867647,0.178922,-0.789216,0.659314,-0.816176,-1.77696,-0.497549,0.335784,-0.421569,-1.16176,-0.973039,1.15931,-0.980392,0.102941,0.683824,-0.198529,-1.07108,-0.426471,-0.629902,-3.2549,-1.52696,0.296569,-0.22549,0.0323383,0.404959], [-1.36801,-0.00736804,0.181544,0.786936,0.190077,-0.570246,1.1551,0.481168,-0.104144,-0.980954,-0.220174,0.257741,-1.5808,-0.165703,-0.271493,-1.06375,0.0358025,0.827935,0.821027,-1.78245,0.0904915,0.203135,0.724549,0.23989,0.308858,-0.37381,1.01881,1.03455,-0.647773,-0.901333,-0.665082,1.588,0.332709,-0.208925,-0.622484,-0.772615,-0.508182,-0.582528,1.40992,-0.885112,-1.17004,0.684573,-0.304244,-0.317754,0.938679,1.40109,1.47582,1.13825,-0.852354,2.4725,0.807285,1.29452,2.77837,4.25,0.458942,0.613139,0.0675182,0.468066,0.787409,0.229015,-0.364051,0.205292,0.948905,1.47445,0.529412,1.16912,-0.558824,1.50735,0.264706,-3.29412,-0.602941,1.52941,0.911765,-0.272059,1.875,-1.72059,-0.426471,1.97059,3.06618,1.27941,1.68382,1.61765,2.25,1.88235,2.59559,1.79412,0.992647,1.68382,1.13971,0.0441176,0.794118,1.28676,2.58824,3.11029,1.24265,1.22794,0.602941,0.433824,3.42647,1.84559,3.32353,2.41176,3.28676,3.13971,1.33824,1.94118,2.61567,3.0186], [-0.439144,-0.772074,0.254047,0.48607,0.546022,0.0722848,-1.61776,-0.688039,-0.228381,-0.0434537,0.0485763,0.699247,0.562668,-0.641509,0.0385433,0.851939,0.573057,-0.203506,-0.0390141,-0.24492,-0.539138,0.332942,-0.297086,0.26364,0.301358,0.342857,0.527139,0.0751259,0.223292,0.194619,0.279018,0.000342309,1.15811,0.738165,0.432461,0.319052,-1.09152,-0.152093,0.253402,0.366605,0.734721,0.803621,-0.143133,1.27048,0.751179,0.213592,4.09189,2.42396,-0.209497,-1.27425,1.59959,3.38543,1.66473,0.909091,-0.416058,0.340411,0.908427,0.88852,1.45786,0.854015,-0.670869,-0.0106171,-1.50564,0.928998,-0.00467914,1.08957,0.304813,1.3369,0.65107,0.85361,0.442513,0.143048,1.1504,2.3643,-0.25,1.64305,-0.165107,1.12968,0.770722,1.40441,2.01337,1.07219,2.625,1.92781,-0.33623,0.339572,2.08356,2.54746,3.73061,0.555481,-0.921791,0.139037,1.20187,1.74666,1.62901,1.4893,0.989305,1.61564,0.551471,0.595588,3.61898,2.05949,0.502674,0.139706,2.16778,3.03209,1.50204,1.1686], [-1.10635,-0.392764,-0.996955,-0.348905,0.144938,0.838319,0.0476026,1.00367,0.63544,-2.21012,-0.334757,0.330657,0.858721,-0.183176,0.239026,1.07828,1.55701,1.36652,1.13466,0.158442,-0.872471,0.51449,0.752022,1.53894,1.22695,0.942857,0.735911,0.629512,0.079916,2.65015,1.57977,2.01225,-0.0641166,1.10854,0.251466,1.83621,1.21241,0.0704133,-0.966547,2.06226,-0.97004,-1.01543,-0.0597997,0.465051,-0.330552,-0.119741,-1.08668,1.80059,2.38141,2.25432,-1.09272,-1.81659,1.69504,1.44444,-2.08273,-1.16464,-1.96026,1.6764,0.0235199,-0.0348743,-0.711273,-0.0308191,0.282238,-5.0811,-0.984477,0.321895,-0.169935,-1.00654,0.570261,-0.0857843,-0.102941,1.55719,1.78676,1.72794,-1.25,1.05719,0.754085,1.66503,-1.23938,-0.484477,0.558824,-0.604575,0.291667,1.60458,1.62337,1.46078,-1.89624,-0.816176,-1.13807,0.363562,1.05801,0.189542,-0.71732,2.33252,-3.34069,-1.5915,0.352941,1.76716,-1.22631,-0.515523,-1.59314,1.67565,3.30065,1.91748,-1.28676,-2.16993,1.53234,1.7686]], type : 'heatmap',colorscale: [[0.0, 'rgb(210,65,83)'],[0.85, 'rgb(178,236,254)'],[1.0, 'rgb(34,57,212)']],showscale : true} ], { margin: { t: 0 }, showlegend: false, xaxis : {title : 'Base position'}, yaxis : {title : 'tile', type: 'category'} });}if (document.getElementById('seqqualitylineplot') !== null) { Plotly.newPlot('seqqualitylineplot', [ {x : [20,21,22,23,24,25,26,27,28,29,30,31,32], y : [1,1,3,10,37,48,79,100,92,68,33,16,3], type: 'line', line : {color : 'red'}, name : 'Sequence quality distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Phread quality'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basesequencecontentlineplot') !== null) { Plotly.newPlot('basesequencecontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [32.9939, 29.7959, 31.0204, 29.6907, 32.3529, 33.121, 27.897, 28.1996, 27.3128, 29.5045, 29.1284, 26.0613, 27.6156, 26.8015, 27.1429, 32.5333, 29.2985, 29.9281, 27.451, 30.3544, 28.0449, 30.5509, 30.8511, 27.1881, 29.2157, 27.027, 29.5195, 30.1703, 31.8059, 29.4671, 27.9863, 32.2695, 31.7857, 33.2143, 37.8571, 27.1429, 35.8423, 27.3381, 25.8993, 25.1799, 28.4173, 27.3381, 32.7338, 30.5755, 30.5755, 26.259, 30.5755, 29.1367, 35.6115, 30.9353, 30.9353, 30.2158, 26.259, 28.3636, 31.9853, 29.0441, 29.0441, 28.5185, 27.2727], mode : 'lines', name : 'A', line :{ color : 'green'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [18.3299, 18.1633, 20, 20.6186, 19.958, 21.6561, 21.03, 21.9089, 23.5683, 20.8333, 21.789, 20.7547, 21.4112, 21.3654, 21.2987, 18.9333, 22.2834, 22.1583, 20.8145, 18.1818, 21.9551, 19.6995, 18.0851, 20.4842, 22.549, 23.0769, 20.595, 15.8151, 20.2156, 18.4953, 22.1843, 18.0851, 17.1429, 17.1429, 18.9286, 20, 18.9964, 19.0647, 17.9856, 20.8633, 17.2662, 21.9424, 18.705, 23.741, 19.4245, 20.8633, 19.4245, 19.4245, 20.8633, 16.5468, 16.1871, 19.0647, 24.1007, 18.9091, 12.8676, 21.6912, 19.8529, 21.1111, 19.0083], mode : 'lines', name : 'C', line :{ color : 'blue'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [28.9206, 26.5306, 27.1429, 27.4227, 25.4202, 24.6285, 26.6094, 27.3319, 29.2952, 28.3784, 27.0642, 31.7217, 30.5353, 29.8357, 29.2208, 27.7333, 29.1609, 28.6331, 29.2609, 30.5085, 31.7308, 31.5526, 33.3333, 31.6574, 28.8235, 29.106, 30.2059, 35.2798, 26.9542, 29.7806, 31.7406, 31.9149, 28.5714, 29.6429, 25.3571, 31.7857, 30.8244, 32.7338, 39.5683, 36.6906, 35.9712, 30.5755, 32.0144, 31.295, 30.9353, 33.0935, 32.7338, 35.9712, 29.4964, 36.6906, 32.3741, 32.0144, 32.0144, 34.5455, 37.8676, 29.0441, 31.6176, 32.5926, 29.7521], mode : 'lines', name : 'T', line :{ color : 'red'}}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", 108], y : [19.7556, 25.5102, 21.8367, 22.268, 22.2689, 20.5945, 24.4635, 22.5597, 19.8238, 21.2838, 22.0183, 21.4623, 20.438, 21.9975, 22.3377, 20.8, 19.2572, 19.2806, 22.4736, 20.9553, 18.2692, 18.197, 17.7305, 20.6704, 19.4118, 20.79, 19.6796, 18.7348, 21.0243, 22.2571, 18.0887, 17.7305, 22.5, 20, 17.8571, 21.0714, 14.3369, 20.8633, 16.5468, 17.2662, 18.3453, 20.1439, 16.5468, 14.3885, 19.0647, 19.7842, 17.2662, 15.4676, 14.0288, 15.8273, 20.5036, 18.705, 17.6259, 18.1818, 17.2794, 20.2206, 19.4853, 17.7778, 23.9669], mode : 'lines', name : 'G', line :{ color : 'black'}}, ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequence content'} } );}if (document.getElementById('sequencegccontentlineplot') !== null) { Plotly.newPlot('sequencegccontentlineplot', [ {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [2, 2, 2, 2.5, 3, 3, 3.5, 4.5, 5.5, 5.5, 5, 5, 5, 7, 9.5, 10.5, 11, 12.5, 13, 12, 15, 18.5, 20, 19, 17, 16.5, 19, 22.5, 23, 25, 32, 36, 36.5, 40.5, 49, 54, 52, 55, 55, 48.5, 45, 45, 43.5, 41.5, 40.5, 40.5, 43, 46, 52, 56.5, 53, 46.5, 43, 41, 41.5, 42, 39.5, 39, 40.5, 38.5, 37, 34, 29, 24.5, 21.5, 20.5, 17.5, 15.5, 15.5, 16, 14.5, 12, 11, 10, 9.5, 10, 9.5, 8.5, 8, 7.5, 7, 6.5, 6, 5, 4, 4.5, 4.5, 4, 3.5, 3, 3, 3, 3, 3, 3.5, 4.5, 5, 4, 3, 3, 3, ], type: 'line', line : {color : 'red'},name : 'GC distribution'}, {x : [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, ], y : [1.06278, 1.23822, 1.43807, 1.66492, 1.9215, 2.21064, 2.5353, 2.89849, 3.30329, 3.75278, 4.25002, 4.79801, 5.39962, 6.05755, 6.77428, 7.55199, 8.3925, 9.29722, 10.2671, 11.3025, 12.4031, 13.5681, 14.7959, 16.084, 17.4293, 18.8277, 20.2744, 21.7635, 23.2885, 24.842, 26.4158, 28.001, 29.5879, 31.1665, 32.7259, 34.2554, 35.7436, 37.1791, 38.5506, 39.847, 41.0575, 42.1717, 43.1799, 44.0731, 44.8433, 45.4835, 45.9878, 46.3514, 46.5709, 46.6443, 46.5709, 46.3514, 45.9878, 45.4835, 44.8433, 44.0731, 43.1799, 42.1717, 41.0575, 39.847, 38.5506, 37.1791, 35.7436, 34.2554, 32.7259, 31.1665, 29.5879, 28.001, 26.4158, 24.842, 23.2885, 21.7635, 20.2744, 18.8277, 17.4293, 16.084, 14.7959, 13.5681, 12.4031, 11.3025, 10.2671, 9.29722, 8.3925, 7.55199, 6.77428, 6.05755, 5.39962, 4.79801, 4.25002, 3.75278, 3.30329, 2.89849, 2.5353, 2.21064, 1.9215, 1.66492, 1.43807, 1.23822, 1.06278, 0.90934, 0.775603, ], type: 'line', line : {color : 'blue'},name : 'Theoretical distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : '% GC'}, yaxis : {title : 'Density'} } );}if (document.getElementById('basencontentlineplot') !== null) { Plotly.newPlot('basencontentlineplot', [ {x : ["1", "2", "3", "4", "5", "6", "7", "8", "9", "10-11", "12-13", "14-15", "16-17", "18-19", "20-21", "22-23", "24-25", "26-27", "28-29", "30-31", "32-33", "34-35", "36-37", "38-39", "40-41", "42-43", "44-45", "46-47", "48-49", "50-51", "52-53", "54-55", "56-57", "58-59", "60-61", "62-63", "64-65", "66-67", "68-69", "70-71", "72-73", "74-75", "76-77", "78-79", "80-81", "82-83", "84-85", "86-87", "88-89", "90-91", "92-93", "94-95", "96-97", "98-99", "100-101", "102-103", "104-105", "106-107", "108"], y : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'Fraction of N reads per base'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% N'} } );}if (document.getElementById('sequencelengthdistributionlineplot') !== null) { Plotly.newPlot('sequencelengthdistributionlineplot', [ {x : ["1 bp","3 bp","4 bp","5 bp","6 bp","7 bp","8 bp","9 bp","10 bp","11 bp","12 bp","13 bp","14 bp","15 bp","16 bp","17 bp","18 bp","19 bp","20 bp","21 bp","22 bp","23 bp","24 bp","25 bp","26 bp","27 bp","28 bp","29 bp","30 bp","31 bp","32 bp","33 bp","34 bp","35 bp","36 bp","37 bp","38 bp","39 bp","40 bp","41 bp","42 bp","43 bp","44 bp","45 bp","46 bp","47 bp","48 bp","49 bp","50 bp","51 bp","52 bp","53 bp","54 bp","64 bp","98 bp","106 bp","107 bp","108 bp"], y : [1,5,9,5,5,5,7,8,4,3,6,6,6,7,6,9,7,4,6,6,2,9,3,9,11,8,5,3,3,7,8,3,11,8,8,6,7,5,10,5,9,14,7,6,7,13,7,17,11,5,5,2,2,1,3,2,13,121], text : [1,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,64,98,106,107,108], type: 'bar', marker : {color : 'rgba(55,128,191,1.0)',line : {width : 2}}, name : 'Sequence length distribution'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Sequence length'}, yaxis : {title : 'Number of sequences'} } );}if (document.getElementById('seqduplevelslineplot') !== null) { Plotly.newPlot('seqduplevelslineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.389, 0, 0.610998, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'blue'}, name : 'total sequences'}, {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], y : [99.7955, 0, 0.204499, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], type: 'line', line : {color : 'red'}, name : 'deduplicated sequences'} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Duplication rate', tickvals : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16], ticktext : ['1','2','3','4','5','6','7','8','9','10+','50+','100+','500+','1k+','5k+','10k+']}, yaxis : {title : '% of sequences'} } );}if (document.getElementById('adapterlineplot') !== null) { Plotly.newPlot('adapterlineplot', [ {x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0203874,0.0407747,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0611621,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.101937,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324,0.122324], type : 'line', name : "Illumina Universal Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 3' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Illumina Small RNA 5' Adapter"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "Nextera Transposase Sequence"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0.0203874,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0407747,0.0611621,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494,0.0815494], type : 'line', name : "PolyA"},{x : [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108], y : [0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0], type : 'line', name : "PolyG"} ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : '% sequences with adapter before position'} } );}if (document.getElementById('kmerlineplot') !== null) { Plotly.newPlot('kmerlineplot', [ ], { margin: { t: 0 }, showlegend: true, xaxis : {title : 'Base position'}, yaxis : {title : 'log2(obs/ exp max)'} } );}</script></html> \ No newline at end of file
--- a/test-data/fastqc_report_subsample.txt Sun Jun 30 11:28:30 2024 +0000 +++ b/test-data/fastqc_report_subsample.txt Tue Sep 10 19:02:42 2024 +0000 @@ -1,4 +1,4 @@ -##Falco 1.2.2 +##Falco 1.2.3 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq @@ -1590,113 +1590,113 @@ >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3 prime Adapter Illumina Small RNA 5 prime Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0 0 0 0 0 -2 0 0 0 0 0 -3 0 0 0 0 0 -4 0 0 0 0 0 -5 0 0 0 0 0 -6 0 0 0 0 0 -7 0 0 0 0 0 -8 0 0 0 0 0 -9 0 0 0 0 0 -10 0 0 0 0 0 -11 0 0 0 0 0 -12 0 0 0 0 0 -13 0 0 0 0 0 -14 0 0 0 0 0 -15 0 0 0 0 0 -16 0 0 0 0 0 -17 0 0 0 0 0 -18 0 0 0 0 0 -19 0 0 0 0 0 -20 0.0203874 0 0 0 0 -21 0.0203874 0 0 0 0 -22 0.0203874 0 0 0 0 -23 0.0203874 0 0 0 0 -24 0.0203874 0 0 0 0 -25 0.0203874 0 0 0 0 -26 0.0203874 0 0 0 0 -27 0.0203874 0 0 0 0 -28 0.0203874 0 0 0 0 -29 0.0203874 0 0 0 0 -30 0.0203874 0 0 0 0 -31 0.0203874 0 0 0 0 -32 0.0203874 0 0 0 0 -33 0.0203874 0 0 0 0 -34 0.0203874 0 0 0 0 -35 0.0203874 0 0 0 0 -36 0.0203874 0 0 0 0 -37 0.0203874 0 0 0 0 -38 0.0407747 0 0 0 0 -39 0.0611621 0 0 0 0 -40 0.0611621 0 0 0 0 -41 0.0611621 0 0 0 0 -42 0.0611621 0 0 0 0 -43 0.0611621 0 0 0 0 -44 0.0611621 0 0 0 0 -45 0.0611621 0 0 0 0 -46 0.0611621 0 0 0 0 -47 0.0611621 0 0 0 0 -48 0.0611621 0 0 0 0 -49 0.0611621 0 0 0 0 -50 0.0611621 0 0 0 0 -51 0.0611621 0 0 0 0 -52 0.0611621 0 0 0 0 -53 0.0611621 0 0 0 0 -54 0.0611621 0 0 0 0 -55 0.0611621 0 0 0 0 -56 0.0611621 0 0 0 0 -57 0.0611621 0 0 0 0 -58 0.0611621 0 0 0 0 -59 0.0611621 0 0 0 0 -60 0.0611621 0 0 0 0 -61 0.0611621 0 0 0 0 -62 0.0611621 0 0 0 0 -63 0.0611621 0 0 0 0 -64 0.0611621 0 0 0 0 -65 0.0611621 0 0 0 0 -66 0.0611621 0 0 0 0 -67 0.0611621 0 0 0 0 -68 0.0611621 0 0 0 0 -69 0.0611621 0 0 0 0 -70 0.0611621 0 0 0 0 -71 0.0611621 0 0 0 0 -72 0.0611621 0 0 0 0 -73 0.0611621 0 0 0 0 -74 0.0815494 0 0 0 0 -75 0.0815494 0 0 0 0 -76 0.0815494 0 0 0 0 -77 0.0815494 0 0 0 0 -78 0.0815494 0 0 0 0 -79 0.0815494 0 0 0 0 -80 0.0815494 0 0 0 0 -81 0.0815494 0 0 0 0 -82 0.0815494 0 0 0 0 -83 0.0815494 0 0 0 0 -84 0.0815494 0 0 0 0 -85 0.0815494 0 0 0 0 -86 0.0815494 0 0 0 0 -87 0.0815494 0 0 0 0 -88 0.0815494 0 0 0 0 -89 0.0815494 0 0 0 0 -90 0.0815494 0 0 0 0 -91 0.0815494 0 0 0 0 -92 0.101937 0 0 0 0 -93 0.122324 0 0 0 0 -94 0.122324 0 0 0 0 -95 0.122324 0 0 0 0 -96 0.122324 0 0 0 0 -97 0.122324 0 0 0 0 -98 0.122324 0 0 0 0 -99 0.122324 0 0 0 0 -100 0.122324 0 0 0 0 -101 0.122324 0 0 0 0 -102 0.122324 0 0 0 0 -103 0.122324 0 0 0 0 -104 0.122324 0 0 0 0 -105 0.122324 0 0 0 0 -106 0.122324 0 0 0 0 -107 0.122324 0 0 0 0 -108 0.122324 0 0 0 0 +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0 0 0 0 0 0 +2 0 0 0 0 0.0203874 0 +3 0 0 0 0 0.0407747 0 +4 0 0 0 0 0.0407747 0 +5 0 0 0 0 0.0407747 0 +6 0 0 0 0 0.0407747 0 +7 0 0 0 0 0.0407747 0 +8 0 0 0 0 0.0407747 0 +9 0 0 0 0 0.0407747 0 +10 0 0 0 0 0.0407747 0 +11 0 0 0 0 0.0407747 0 +12 0 0 0 0 0.0407747 0 +13 0 0 0 0 0.0407747 0 +14 0 0 0 0 0.0407747 0 +15 0 0 0 0 0.0407747 0 +16 0 0 0 0 0.0407747 0 +17 0 0 0 0 0.0611621 0 +18 0 0 0 0 0.0815494 0 +19 0 0 0 0 0.0815494 0 +20 0.0203874 0 0 0 0.0815494 0 +21 0.0203874 0 0 0 0.0815494 0 +22 0.0203874 0 0 0 0.0815494 0 +23 0.0203874 0 0 0 0.0815494 0 +24 0.0203874 0 0 0 0.0815494 0 +25 0.0203874 0 0 0 0.0815494 0 +26 0.0203874 0 0 0 0.0815494 0 +27 0.0203874 0 0 0 0.0815494 0 +28 0.0203874 0 0 0 0.0815494 0 +29 0.0203874 0 0 0 0.0815494 0 +30 0.0203874 0 0 0 0.0815494 0 +31 0.0203874 0 0 0 0.0815494 0 +32 0.0203874 0 0 0 0.0815494 0 +33 0.0203874 0 0 0 0.0815494 0 +34 0.0203874 0 0 0 0.0815494 0 +35 0.0203874 0 0 0 0.0815494 0 +36 0.0203874 0 0 0 0.0815494 0 +37 0.0203874 0 0 0 0.0815494 0 +38 0.0407747 0 0 0 0.0815494 0 +39 0.0611621 0 0 0 0.0815494 0 +40 0.0611621 0 0 0 0.0815494 0 +41 0.0611621 0 0 0 0.0815494 0 +42 0.0611621 0 0 0 0.0815494 0 +43 0.0611621 0 0 0 0.0815494 0 +44 0.0611621 0 0 0 0.0815494 0 +45 0.0611621 0 0 0 0.0815494 0 +46 0.0611621 0 0 0 0.0815494 0 +47 0.0611621 0 0 0 0.0815494 0 +48 0.0611621 0 0 0 0.0815494 0 +49 0.0611621 0 0 0 0.0815494 0 +50 0.0611621 0 0 0 0.0815494 0 +51 0.0611621 0 0 0 0.0815494 0 +52 0.0611621 0 0 0 0.0815494 0 +53 0.0611621 0 0 0 0.0815494 0 +54 0.0611621 0 0 0 0.0815494 0 +55 0.0611621 0 0 0 0.0815494 0 +56 0.0611621 0 0 0 0.0815494 0 +57 0.0611621 0 0 0 0.0815494 0 +58 0.0611621 0 0 0 0.0815494 0 +59 0.0611621 0 0 0 0.0815494 0 +60 0.0611621 0 0 0 0.0815494 0 +61 0.0611621 0 0 0 0.0815494 0 +62 0.0611621 0 0 0 0.0815494 0 +63 0.0611621 0 0 0 0.0815494 0 +64 0.0611621 0 0 0 0.0815494 0 +65 0.0611621 0 0 0 0.0815494 0 +66 0.0611621 0 0 0 0.0815494 0 +67 0.0611621 0 0 0 0.0815494 0 +68 0.0611621 0 0 0 0.0815494 0 +69 0.0611621 0 0 0 0.0815494 0 +70 0.0611621 0 0 0 0.0815494 0 +71 0.0611621 0 0 0 0.0815494 0 +72 0.0611621 0 0 0 0.0815494 0 +73 0.0611621 0 0 0 0.0815494 0 +74 0.0815494 0 0 0 0.0815494 0 +75 0.0815494 0 0 0 0.0815494 0 +76 0.0815494 0 0 0 0.0815494 0 +77 0.0815494 0 0 0 0.0815494 0 +78 0.0815494 0 0 0 0.0815494 0 +79 0.0815494 0 0 0 0.0815494 0 +80 0.0815494 0 0 0 0.0815494 0 +81 0.0815494 0 0 0 0.0815494 0 +82 0.0815494 0 0 0 0.0815494 0 +83 0.0815494 0 0 0 0.0815494 0 +84 0.0815494 0 0 0 0.0815494 0 +85 0.0815494 0 0 0 0.0815494 0 +86 0.0815494 0 0 0 0.0815494 0 +87 0.0815494 0 0 0 0.0815494 0 +88 0.0815494 0 0 0 0.0815494 0 +89 0.0815494 0 0 0 0.0815494 0 +90 0.0815494 0 0 0 0.0815494 0 +91 0.0815494 0 0 0 0.0815494 0 +92 0.101937 0 0 0 0.0815494 0 +93 0.122324 0 0 0 0.0815494 0 +94 0.122324 0 0 0 0.0815494 0 +95 0.122324 0 0 0 0.0815494 0 +96 0.122324 0 0 0 0.0815494 0 +97 0.122324 0 0 0 0.0815494 0 +98 0.122324 0 0 0 0.0815494 0 +99 0.122324 0 0 0 0.0815494 0 +100 0.122324 0 0 0 0.0815494 0 +101 0.122324 0 0 0 0.0815494 0 +102 0.122324 0 0 0 0.0815494 0 +103 0.122324 0 0 0 0.0815494 0 +104 0.122324 0 0 0 0.0815494 0 +105 0.122324 0 0 0 0.0815494 0 +106 0.122324 0 0 0 0.0815494 0 +107 0.122324 0 0 0 0.0815494 0 +108 0.122324 0 0 0 0.0815494 0 >>END_MODULE