# HG changeset patch
# User iuc
# Date 1506459688 14400
# Node ID d5fe9aead222ce7373baa4bfad3cf1f8c6def0bd
# Parent  526b91fbde6056353307b4641510fe9396c67b75
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hisat2 commit 48012d1879395ecf1b4e6cd962f325c372164a33

diff -r 526b91fbde60 -r d5fe9aead222 hisat2.xml
--- a/hisat2.xml	Wed Jul 19 04:57:27 2017 -0400
+++ b/hisat2.xml	Tue Sep 26 17:01:28 2017 -0400
@@ -1,11 +1,10 @@
-<?xml version="1.0"?>
-<tool id="hisat2" name="HISAT2" version="2.0.5.2" profile="17.01">
+<tool id="hisat2" name="HISAT2" version="2.1.0" profile="17.01">
     <description>A fast and sensitive alignment program</description>
     <macros>
         <import>hisat2_macros.xml</import>
     </macros>
     <requirements>
-        <requirement type="package" version="2.0.5">hisat2</requirement>
+        <requirement type="package" version="2.1.0">hisat2</requirement>
         <requirement type="package" version="1.4">samtools</requirement>
     </requirements>
     <stdio>
@@ -15,488 +14,672 @@
     </stdio>
     <version_command>hisat2 --version</version_command>
     <command><![CDATA[
-        #if str($spliced_options.spliced_options_selector) == "advanced" and str($spliced_options.known_splice_gtf) != 'None':
-            ln -s '${spliced_options.known_splice_gtf}' splice_sites.gtf &&
-            hisat2_extract_splice_sites.py splice_sites.gtf > splice_sites.txt &&
+
+## Prepare HISAT2 index
+
+#if $reference_genome.source == "history":
+    ln -s '$reference_genome.history_item' genome.fa &&
+    hisat2-build -p \${GALAXY_SLOTS:-1} genome.fa genome &&
+    #set index_path = 'genome'
+#else:
+    #set index_path = $reference_genome.index.fields.path
+#end if
+
+
+## If using known splice sites
+
+#if str($adv.spliced_options.spliced_options_selector) == "advanced" and str($adv.spliced_options.known_splice_gtf) != 'None':
+    ln -s '${adv.spliced_options.known_splice_gtf}' splice_sites.gtf &&
+    hisat2_extract_splice_sites.py splice_sites.gtf > splice_sites.txt &&
+#end if
+
+
+## Link in the input files, so HISAT2 can tell their type
+
+#set compressed="False"
+#set reads_are_fastq = True
+
+#if str($library.type) == 'paired':
+    #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
+        #set read1 = "input_f.fastq.gz"
+        #set compressed = "GZ"
+    #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
+        #set read1 = "input_f.fastq.bz2"
+        #set compressed = "BZ2"
+    #else if $library.input_1.is_of_type('fasta'):
+        #set reads_are_fastq = False
+        #set read1 = "input_f.fasta"
+    #else:
+        #set read1 = "input_f.fastq"
+    #end if
+    ln -f -s '${library.input_1}' ${read1} &&
+
+    #if $library.input_2.is_of_type("fastq.gz", "fastqsanger.gz"):
+        #set read2 = "input_r.fastq.gz"
+        #set compressed = "GZ"
+    #else if $library.input_2.is_of_type("fastq.bz2", "fastqsanger.bz2"):
+        #set read2 = "input_r.fastq.bz2"
+        #set compressed = "BZ2"
+    #else if $library.input_2.is_of_type('fasta'):
+        #set read2 = "input_r.fasta"
+    #else:
+        #set read2 = "input_r.fastq"
+    #end if
+    ln -f -s '${library.input_2}' ${read2} &&
+
+#else if str($library.type) == 'paired_collection':
+    #if $library.input_1.forward.is_of_type("fastq.gz", "fastqsanger.gz"):
+        #set read1 = "input_f.fastq.gz"
+        #set compressed = "GZ"
+    #else if $library.input_1.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):
+        #set read1 = "input_f.fastq.bz2"
+        #set compressed = "BZ2"
+    #else if $library.input_1.forward.is_of_type('fasta'):
+        #set reads_are_fastq = False
+        #set read1 = "input_f.fasta"
+    #else:
+        #set read1 = "input_f.fastq"
+    #end if
+    ln -s '${library.input_1.forward}' ${read1} &&
+
+    #if $library.input_1.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):
+        #set read2 = "input_r.fastq.gz"
+        #set compressed = "GZ"
+    #else if $library.input_1.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):
+        #set read2 = "input_r.fastq.bz2"
+        #set compressed = "BZ2"
+    #else if $library.input_1.reverse.is_of_type("fasta"):
+        #set read2 = "input_r.fasta"
+    #else:
+        #set read2 = "input_r.fastq"
+    #end if
+    ln -s '${library.input_1.reverse}' ${read2} &&
+
+#else:
+    #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
+        #set read1 = "input_f.fastq.gz"
+        #set compressed = "GZ"
+    #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
+        #set read1 = "input_f.fastq.bz2"
+        #set compressed = "BZ2"
+    #else if $library.input_1.is_of_type('fasta'):
+        #set reads_are_fastq = False
+        #set read1 = "input_f.fasta"
+    #else:
+        #set read1 = "input_f.fastq"
+    #end if
+    ln -f -s '${library.input_1}' ${read1} &&
+#end if
+
+
+## Run HISAT2
+
+hisat2
+
+## number threads
+-p \${GALAXY_SLOTS:-1}
+
+## ref genome index path
+-x '${index_path}'
+
+## input reads are fasta?
+#if not $reads_are_fastq:
+    -f
+#end if
+
+## Input reads
+
+#if str( $library.type ) == "single":
+
+    -U '${read1}'
+
+    #if str($adv.output_options.output_options_selector) == "advanced":
+        #if str( $adv.output_options.unaligned_file ) == "true":
+            #if $compressed == "GZ":
+                --un-gz '$output_unaligned_reads_l'
+            #else if $compressed == "BZ2":
+                --un-bz2 '$output_unaligned_reads_l'
+            #else:
+                --un '$output_unaligned_reads_l'
+            #end if
         #end if
 
-        @FASTQGZ_SETUP@
-
-        #if $reference_genome.reference_genome_source == "history":
-            ln -s '$reference_genome.history_item' genome.fa &&
-            hisat2-build -p \${GALAXY_SLOTS:-1} genome.fa genome &&
-            #set index_path = 'genome'
-        #else:
-            #set index_path = $reference_genome.index.fields.path
+        #if str( $adv.output_options.aligned_file ) == "true":
+            #if $compressed == "GZ":
+                --al-gz '$output_aligned_reads_l'
+            #else if $compressed == "BZ2":
+                --al-bz2 '$output_aligned_reads_l'
+            #else:
+                --al '$output_aligned_reads_l'
+            #end if
         #end if
-        hisat2 -p \${GALAXY_SLOTS:-1} -x '${index_path}'
-        #if str($input_format.paired.paired_selector) == 'paired':
-            -1 '${read1}' -2 '${read2}'
-            @paired_end_options@
-        #else:
-            -U '${read1}'
-            #if str( $input_format.paired.unaligned_file ) == "true":
-                #if $compressed == "GZ":
-                    --un-gz '$output_unaligned_reads'
-                #else if $compressed == "BZ2":
-                    --un-bz2 '$output_unaligned_reads'
-                #else:
-                    --un '$output_unaligned_reads'
-                #end if
+    #end if
+
+#else:
+
+    -1 '${read1}'
+    -2 '${read2}'
+
+    #if str($adv.output_options.output_options_selector) == "advanced":
+        #if str( $adv.output_options.unaligned_file ) == "true":
+            #if $compressed == "GZ":
+                --un-conc-gz '${output_unaligned_reads_l}'
+            #else if $compressed == "BZ2":
+                --un-conc-bz2 '${output_unaligned_reads_l}'
+            #else:
+                --un-conc '${output_unaligned_reads_l}'
             #end if
-            #if str( $input_format.paired.aligned_file ) == "true":
-                #if $compressed == "GZ":
-                    --al-gz '$output_aligned_reads'
-                #else if $compressed == "BZ2":
-                    --al-bz2 '$output_aligned_reads'
-                #else:
-                    --al '$output_aligned_reads'
-                #end if
+        #end if
+
+        #if str( $adv.output_options.aligned_file ) == "true":
+            #if $compressed == "GZ":
+                --al-conc-gz '${output_aligned_reads_l}'
+            #else if $compressed == "BZ2":
+                --al-conc-bz2 '${output_aligned_reads_l}'
+            #else:
+                --al-conc '${output_aligned_reads_l}'
             #end if
         #end if
-        #if $input_format.input_format_selector == 'fasta':
-            -f
-        #end if
-        #if str($max_primary)
-            -k ${max_primary}
-        #end if
-        #if str($max_seeds)
-            --max-seeds $max_seeds
-        #end if
-        $secondary
-        #if str($input_options.input_options_selector) == "advanced":
-            #if int( $input_options.skip ) > 0:
-                -s ${input_options.skip}
-            #end if
-            #if int( $input_options.stop_after ) > 0:
-                -u ${input_options.stop_after}
-            #end if
-            -5 ${input_options.trim_five} -3 ${input_options.trim_three}
-        #end if
-        #if str($scoring_options.scoring_options_selector) == "advanced":
-            --ma ${scoring_options.match_bonus}
-            --mp ${scoring_options.max_mismatch},${scoring_options.min_mismatch}
-            ${scoring_options.no_softclip}
-            --np ${scoring_options.ambiguous_penalty}
-            --rdg ${scoring_options.read_open_penalty},${scoring_options.read_extend_penalty}
-            --rfg ${scoring_options.ref_open_penalty},${scoring_options.ref_extend_penalty}
-            --sp ${scoring_options.soft_clip_penalty_max},${scoring_options.soft_clip_penalty_min}
-            --score-min ${scoring_options.function_type},${scoring_options.constant_term},${scoring_options.coefficient}
-        #end if
-        #if str($alignment_options.alignment_options_selector) == "advanced":
-            --n-ceil ${alignment_options.function_type},${alignment_options.constant_term},${alignment_options.coefficient}
-            ${alignment_options.ignore_quals}
-            ${alignment_options.skip_forward}
-            ${alignment_options.skip_reverse}
-        #end if
-        #if str($spliced_options.spliced_options_selector) == "advanced":
-            --pen-cansplice ${spliced_options.canonical_penalty}
-            --pen-noncansplice ${spliced_options.noncanonical_penalty}
-            --pen-canintronlen ${spliced_options.function_type},${spliced_options.constant_term},${spliced_options.coefficient}
-            --pen-noncanintronlen ${spliced_options.nc_function_type},${spliced_options.nc_constant_term},${spliced_options.nc_coefficient}
-            #if str($spliced_options.known_splice_gtf) != 'None':
-                --known-splicesite-infile splice_sites.txt
-            #end if
-            ${spliced_options.no_spliced_alignment_options.no_spliced_alignment}
-            #if $spliced_options.no_spliced_alignment_options.no_spliced_alignment == '--no-spliced-alignment'
-                -I ${spliced_options.no_spliced_alignment_options.minins}
-                -X ${spliced_options.no_spliced_alignment_options.maxins}
-            #end if
-            --min-intronlen ${spliced_options.min_intron}
-            --max-intronlen ${spliced_options.max_intron}
-            ${spliced_options.tma}
-            @strandedness_parameters@
-        #end if
-        #if str($paired_options.paired_options_selector) == "advanced":
-            --minins ${paired_options.minins} --maxins ${paired_options.maxins} ${paired_options.no_mixed} ${paired_options.no_discordant}
-            ${paired_options.dovetail} ${paired_options.contain} ${paired_options.overlap}
-        #end if
-        | samtools sort - -@ \${GALAXY_SLOTS:-1} -l 6 -o '${output_alignments}'
-        ## Rename any output fastq files
-        #if $output_unaligned_reads_l and $output_unaligned_reads_r:
-            #set left = str($output_unaligned_reads_l).replace(".dat", ".1.dat")
-            #set right = str($output_unaligned_reads_l).replace(".dat", ".2.dat")
-            && mv '${left}' '${output_unaligned_reads_l}'
-            && mv '${right}' '${output_unaligned_reads_r}'
-        #end if
-        #if $output_aligned_reads_l and $output_aligned_reads_r:
-            #set left = str($output_aligned_reads_l).replace(".dat", ".1.dat")
-            #set right = str($output_aligned_reads_l).replace(".dat", ".2.dat")
-            && mv '${left}' '${output_aligned_reads_l}'
-            && mv '${right}' '${output_aligned_reads_r}'
-        #end if
+    #end if
+
+    #if str($library.paired_options.paired_options_selector) == "advanced":
+        ${library.paired_options.fr_rf_ff}
+        ${library.paired_options.no_mixed}
+        ${library.paired_options.no_discordant}
+    #end if
+
+#end if
+
+
+## Specify strandedness of reads
+
+#if str($library.rna_strandness):
+    --rna-strandness ${library.rna_strandness}
+#end if
+
+
+## Input options
+
+#if str($adv.input_options.input_options_selector) == "advanced":
+    #if int( $adv.input_options.skip ) > 0:
+        --skip ${adv.input_options.skip}
+    #end if
+    #if int( $adv.input_options.qupto ) > 0:
+        --qupto ${adv.input_options.qupto}
+    #end if
+    --trim5 '${adv.input_options.trim5}'
+    --trim3 '${adv.input_options.trim3}'
+    ${adv.input_options.qv_encoding}
+    ${adv.input_options.solexa_quals}
+    ${adv.input_options.int_quals}
+#end if
+
+
+## Alignment options
+
+#if str($adv.alignment_options.alignment_options_selector) == "advanced":
+    --n-ceil ${adv.alignment_options.function_type},${adv.alignment_options.constant_term},${adv.alignment_options.coefficient}
+    ${adv.alignment_options.ignore_quals}
+    ${adv.alignment_options.skip_forward}
+    ${adv.alignment_options.skip_reverse}
+#end if
+
+
+ ## Scoring options
+
+#if str($adv.scoring_options.scoring_options_selector) == "advanced":
+    --mp ${adv.scoring_options.max_mismatch},${adv.scoring_options.min_mismatch}
+    ${adv.scoring_options.no_softclip}
+    --np ${adv.scoring_options.ambiguous_penalty}
+    --rdg ${adv.scoring_options.read_open_penalty},${adv.scoring_options.read_extend_penalty}
+    --rfg ${adv.scoring_options.ref_open_penalty},${adv.scoring_options.ref_extend_penalty}
+    --sp ${scoring_options.soft_clip_penalty_max},${adv.scoring_options.soft_clip_penalty_min}
+    --score-min ${scoring_options.function_type},${adv.scoring_options.constant_term},${adv.scoring_options.coefficient}
+#end if
+
+
+## Spliced alignment options
+
+#if str($adv.spliced_options.spliced_options_selector) == "advanced":
+    --pen-cansplice ${adv.spliced_options.canonical_penalty}
+    --pen-noncansplice ${adv.spliced_options.noncanonical_penalty}
+    --pen-canintronlen ${adv.spliced_options.function_type},${adv.spliced_options.constant_term},${adv.spliced_options.coefficient}
+    --pen-noncanintronlen ${adv.spliced_options.nc_function_type},${adv.spliced_options.nc_constant_term},${adv.spliced_options.nc_coefficient}
+    #if str($adv.spliced_options.known_splice_gtf) != 'None':
+        --known-splicesite-infile splice_sites.txt
+    #end if
+    ${adv.spliced_options.no_spliced_alignment_options.no_spliced_alignment}
+    #if $adv.spliced_options.no_spliced_alignment_options.no_spliced_alignment == '--no-spliced-alignment'
+        -I ${adv.spliced_options.no_spliced_alignment_options.minins}
+        -X ${adv.spliced_options.no_spliced_alignment_options.maxins}
+    #end if
+    --min-intronlen ${adv.spliced_options.min_intron}
+    --max-intronlen ${adv.spliced_options.max_intron}
+    ${adv.spliced_options.tma}
+
+    #if str($adv.spliced_options.notmplen):
+        ${adv.spliced_options.notmplen}
+    #end if
+#end if
+
+
+## Reporting options
+
+#if str($adv.reporting_options.reporting_options_selector) == "advanced":
+    -k ${adv.reporting_options.max_primary}
+    --max-seeds ${adv.reporting_options.max_seeds}
+    $adv.reporting_options.secondary
+#end if
+
+
+## Other options
+
+#if str( $adv.other_options.other_options_selector ) == "advanced":
+    ${adv.other_options.non_deterministic}
+    --seed '${adv.other_options.seed}'
+#end if
+
+
+## Output Summary
+
+#if str($sum.new_summary) == "true":
+    --new-summary
+#end if
+
+#if str($sum.summary_file) == "true":
+    --summary-file summary.txt
+#end if
+
+
+## Convert SAM output to sorted BAM
+
+| samtools sort - -@ \${GALAXY_SLOTS:-1} -l 6 -o '${output_alignments}'
+
+
+## Rename any output fastq files
+
+#if $output_unaligned_reads_l and $output_unaligned_reads_r:
+    #from os.path import splitext
+    #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) )
+    && mv '${ _unaligned_root }.1${_unaligned_ext}' '$output_unaligned_reads_l'
+    && mv '${ _unaligned_root }.2${_unaligned_ext}' '$output_unaligned_reads_r'
+#end if
+#if $output_aligned_reads_l and $output_aligned_reads_r:
+    #from os.path import splitext
+    #set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) )
+    && mv '${ _aligned_root }.1${_aligned_ext}' '$output_aligned_reads_l'
+    && mv '${ _aligned_root }.2${_aligned_ext}' '$output_aligned_reads_r'
+#end if
     ]]></command>
+
+    <!-- Define inputs -->
+
     <inputs>
-        <conditional name="input_format">
-            <param name="input_format_selector" type="select" label="Input data format">
-                <option value="fastq" selected="true">FASTQ</option>
-                <option value="fasta">FASTA</option>
-            </param>
-            <when value="fasta">
-                <expand macro="paired_input_conditional" ftype="fasta" />
-            </when>
-            <when value="fastq">
-                <expand macro="paired_input_conditional" ftype="fastq,fastqsanger,fastq.gz,fastqsanger.gz,fastq.bz2,fastqsanger.bz2" />
-            </when>
-        </conditional>
-        <conditional name="reference_genome">
-            <param name="reference_genome_source" type="select" label="Source for the reference genome to align against" help="Built-in references were created using default options">
-                <option value="indexed" selected="true">Use a built-in genome</option>
-                <option value="history">Use a genome from history</option>
-            </param>
-            <when value="indexed">
-                <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
-                    <options from_data_table="hisat2_indexes">
-                        <filter type="sort_by" column="2" />
-                        <validator type="no_options" message="No genomes are available for the selected input dataset" />
-                    </options>
+
+        <!-- Reference genome -->
+            <conditional name="reference_genome">
+                <param name="source" type="select" label="Source for the reference genome" help="Built-in references were created using default options">
+                    <option value="indexed" selected="true">Use a built-in genome</option>
+                    <option value="history">Use a genome from history</option>
                 </param>
-            </when>
-            <when value="history">
-                <param name="history_item" type="data" format="fasta" label="Select the reference genome" />
-            </when>
-        </conditional>
-        <param name="max_primary" argument="-k" type="integer" optional="true" label="Primary alignments" help="Search for at most K distinct, primary alignments for each read. Primary alignments mean alignments whose alignment score is equal or higher than any other alignments. The search terminates when it can't find more distinct valid alignments, or when it finds K, whichever happens first. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. For reads that have more than K distinct, valid alignments, hisat2 does not guarantee that the K alignments reported are the best possible in terms of alignment score. HISAT2 is not designed with large values for -k in mind, so when aligning reads to long repetitive genomes, a large K can be very, very slow. Default: 5 (HFM) or 10 (HGFM)" />
-        <param name="max_seeds" argument="--max-seeds" type="integer" optional="true" label="Maximum number of seeds that will be extended" help="HISAT2, like other aligners, uses seed-and-extend approaches. HISAT2 tries to extend seeds to full-length alignments. HISAT2 extends up to these many seeds and skips the rest of the seeds. Large values for --max-seeds may improve alignment sensitivity, but HISAT2 is not designed with large values for --max-seeds in mind, and when aligning reads to long repetitive genomes, a large --max-seeds can be very, very slow. Default: 5 (HFM) or 10 (HGFM)" />
-        <param argument="--secondary" type="boolean" truevalue="--secondary" falsevalue="" label="Report secondary alignments" />
-        <conditional name="alignment_options">
-            <param name="alignment_options_selector" type="select" label="Alignment options">
-                <option value="defaults">Use default values</option>
-                <option value="advanced">Specify alignment parameters</option>
-            </param>
-            <when value="defaults" />
-            <when value="advanced">
-                <param name="function_type" argument="--n-ceil" type="select" display="radio" label="Function governing the maximum number of ambiguous characters (usually Ns and/or .s) allowed in a read as a function of read length" help="Reads exceeding this ceiling are filtered out">
-                    <option value="C">Constant [f(x) = B]</option>
-                    <option value="L" selected="true">Linear [f(x) = B + A * x]</option>
-                    <option value="S">Square root [f(x) = B + A * x&#178;]</option>
-                    <option value="G">Natural logarithm [f(x) = B + A * log(x)]</option>
-                </param>
-                <param name="constant_term" type="float" value="0" label="Constant term (B)" help="Constant term for the above function" />
-                <param name="coefficient" type="float" value="0.15" label="Coefficient (A)" help="Coefficient for the above function" />
-                <param argument="--ignore-quals" name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="Ignore quality values" help="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value. I.e. input is treated as though all quality values are high. This is also the default behavior when the input doesn't specify quality values" />
-                <param argument="--nofw" name="skip_forward" type="boolean" truevalue="--nofw" falsevalue="" label="Skip forward strand of reference" help="If --nofw is specified, hisat2 will not attempt to align unpaired reads to the forward (Watson) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes hisat2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand" />
-                <param argument="--norc" name="skip_reverse" type="boolean" truevalue="--norc" falsevalue="" label="Skip reverse strand of reference" help="If --norc is specified, hisat2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --norc causes hisat2 to explore only those paired-end configurations corresponding to fragments from the forward-complement (Watson) strand" />
-            </when>
-        </conditional>
-        <conditional name="input_options">
-            <param name="input_options_selector" type="select" label="Input options">
-                <option value="defaults">Use default values</option>
-                <option value="advanced">Specify input parameters</option>
-            </param>
-            <when value="defaults" />
-            <when value="advanced">
-                <param name="skip" argument="-s" type="integer" min="0" value="0" label="Skip the first N reads or pairs in the input" />
-                <param name="stop_after" argument="-u" type="integer" min="0" value="0" label="Stop after aligning N reads" help="Align the first N reads or read pairs from the input (after the first N reads or pairs have been skipped), then stop" />
-                <param name="trim_five" argument="-5" type="integer" min="0" value="0" label="Trim 5' end" help="Trim N bases from 5' (left) end of each read before alignment" />
-                <param name="trim_three" argument="-3" type="integer" min="0" value="0" label="Trim 3' end" help="Trim N bases from 3' (right) end of each read before alignment" />
-            </when>
-        </conditional>
-        <conditional name="scoring_options">
-            <param name="scoring_options_selector" type="select" label="Scoring options">
-                <option value="defaults">Use default values</option>
-                <option value="advanced">Specify scoring parameters</option>
-            </param>
-            <when value="defaults" />
-            <when value="advanced">
-                <param name="function_type" argument="--score-min" type="select" display="radio" label="Function governing the minimum alignment score needed for an alignment to be considered &quot;valid&quot; (i.e. good enough to report)" help="This is a function of read length">
-                    <option value="C">Constant [f(x) = B]</option>
-                    <option value="L" selected="true">Linear [f(x) = B + A * x]</option>
-                    <option value="S">Square root [f(x) = B + A * x&#178;]</option>
-                    <option value="G">Natural logarithm [f(x) = B + A * log(x)]</option>
+                <when value="indexed">
+                    <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+                        <options from_data_table="hisat2_indexes">
+                            <filter type="sort_by" column="2" />
+                            <validator type="no_options" message="No genomes are available for the selected input dataset" />
+                        </options>
+                    </param>
+                </when>
+                <when value="history">
+                    <param name="history_item" type="data" format="fasta" label="Select the reference genome" />
+                </when>
+            </conditional>
+
+        <!-- Reads -->
+            <conditional name="library">
+                <param name="type" type="select" label="Single-end or paired-end reads?">
+                    <option value="single">Single-end</option>
+                    <option value="paired">Paired-end</option>
+                    <option value="paired_collection">Paired-end Collection</option>
                 </param>
-                <param name="constant_term" type="float" value="0" label="Constant term (B)" help="Constant term for the above function" />
-                <param name="coefficient" type="float" value="-0.2" label="Coefficient (A)" help="Coefficient for the above function" />
-                <param argument="--ma" name="match_bonus" type="integer" value="2" label="Set match bonus" help="In local mode N is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in end-to-end mode" />
-                <param argument="--mp" name="max_mismatch" type="integer" value="6" label="Maximum mismatch penalty" help="Sets the maximum mismatch penalty. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX. Otherwise, the number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
-                <param argument="--mp" name="min_mismatch" type="integer" value="2" label="Minimum mismatch penalty" help="Sets the minimum mismatch penalty. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX. Otherwise, the number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
-                <param argument="--no-softclip" name="no_softclip" type="boolean" truevalue="--no-softclip" falsevalue="" label="Disallow soft-clipping" />
-                <param argument="--np" name="ambiguous_penalty" type="integer" value="1" label="Ambiguous read penalty" help="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as N" />
-                <param argument="--sp" name="soft_clip_penalty_max" type="integer" value="2" label="Maximum soft-clipping penalty" help="Sets the maximum (MX) penalty for soft-clipping per base. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position. The number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
-                <param argument="--sp" name="soft_clip_penalty_min" type="integer" value="1" label="Minimum soft-clipping penalty" help="Sets the minimum (MN) penalty for soft-clipping per base. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position. The number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
-                <param argument="--rdg" name="read_open_penalty" type="integer" value="5" label="Read gap open penalty" help="A read gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
-                <param argument="--rdg" name="read_extend_penalty" type="integer" value="3" label="Read gap extend penalty" help="A read gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
-                <param argument="--rfg" name="ref_open_penalty" type="integer" value="5" label="Reference gap open penalty" help="A reference gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
-                <param argument="--rfg" name="ref_extend_penalty" type="integer" value="3" label="Reference gap extend penalty" help="A reference gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
-            </when>
-        </conditional>
-        <conditional name="spliced_options">
-            <param name="spliced_options_selector" type="select" label="Spliced alignment parameters">
-                <option value="defaults">Use default values</option>
-                <option value="advanced">Specify spliced alignment parameters</option>
-            </param>
-            <when value="defaults" />
-            <when value="advanced">
-                <param name="canonical_penalty" argument="--pen-cansplice" type="integer" value="0" label="Penalty for canonical splice sites" />
-                <param name="noncanonical_penalty" argument="--pen-noncansplice" type="integer" value="12" label="Penalty for non-canonical splice sites" />
-                <param name="function_type" argument="--pen-canintronlen" type="select" display="radio" label="Penalty function for long introns with canonical splice sites" help="Alignments with shorter introns are preferred to those with longer ones">
-                    <option value="C">Constant [f(x) = B]</option>
-                    <option value="L">Linear [f(x) = B + A * x]</option>
-                    <option value="S">Square root [f(x) = B + A * x&#178;]</option>
-                    <option value="G" selected="true">Natural logarithm [f(x) = B + A * log(x)]</option>
+
+                <when value="single">
+                    <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTA/Q file" help="Must be of datatype &quot;fastqsanger&quot; or &quot;fasta&quot;" />
+                     <param name="rna_strandness" argument="--rna-strandness" type="select" label="Specify strand information"
+                            help="'F' means a read corresponds to a transcript. 'R' means a read corresponds to the reverse complemented counterpart of a transcript. With this option being used, every read alignment will have an XS attribute tag: '+' means a read belongs to a transcript on '+' strand of genome. '-' means a read belongs to a transcript on '-' strand of genome.">
+                        <option value="">Unstranded</option>
+                        <option value="F">Forward (F)</option>
+                        <option value="R">Reverse (R)</option>
+                    </param>
+                </when>
+
+                <when value="paired">
+                    <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTA/Q file #1" help="Must be of datatype &quot;fastqsanger&quot;or &quot;fasta&quot;" />
+                    <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTA/Q file #2" help="Must be of datatype &quot;fastqsanger&quot;or &quot;fasta&quot;" />
+                    <expand macro="paired_end_options" />
+                </when>
+
+                <when value="paired_collection">
+                    <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data_collection" collection_type="paired" label="Paired Collection" help="Must be of datatype &quot;fastqsanger&quot; or &quot;fasta&quot;" />
+                    <expand macro="paired_end_options" />
+                </when>
+            </conditional>
+
+        <!-- Summary Options -->
+        <section name="sum" title="Summary Options" expanded="False">
+            <param name="new_summary" argument="--new-summary" type="boolean" checked="False" label="Output alignment summary in a more machine-friendly style." help="Select this option for compatibility with MultiQC" />
+            <param name="summary_file" argument="--summary-file" type="boolean" checked="False" label="Print alignment summary to a file." help="Output alignment summary to a file in addition to stderr." />
+        </section>
+
+        <!-- Advanced Options  -->
+        <section name="adv" title="Advanced Options" expanded="False">
+            <conditional name="input_options">
+                <param name="input_options_selector" type="select" label="Input options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify input options</option>
                 </param>
-                <param name="constant_term" type="float" value="-8" label="Constant term (B)" help="Constant term for the above function" />
-                <param name="coefficient" type="float" value="1" label="Coefficient (A)" help="Coefficient for the above function" />
-                <param name="nc_function_type" argument="--pen-noncanintronlen" type="select" display="radio" label="Penalty function for long introns with non-canonical splice sites" help="Alignments with shorter introns are preferred to those with longer ones">
-                    <option value="C">Constant [f(x) = B]</option>
-                    <option value="L">Linear [f(x) = B + A * x]</option>
-                    <option value="S">Square root [f(x) = B + A * x&#178;]</option>
-                    <option value="G" selected="true">Natural logarithm [f(x) = B + A * log(x)]</option>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="skip" argument="-s" type="integer" min="0" value="0" label="Skip the first N reads or pairs in the input" help="default: 0" />
+                    <param name="qupto" argument="-u" type="integer" min="0" value="0" label="Align the first N reads or read pairs from the input (after the first N reads or pairs have been skipped), then stop" help="default: no limit" />
+                    <param name="trim5" argument="-5" type="integer" min="0" value="0" label="Trim 5' end" help="Trim N bases from 5' (left) end of each read before alignment, default: 0" />
+                    <param name="trim3" argument="-3" type="integer" min="0" value="0" label="Trim 3' end" help="Trim N bases from 3' (right) end of each read before alignment, default: 0"/>
+                    <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details">
+                         <option value="--phred33" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
+                         <option value="--phred64">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
+                    </param>
+                    <param name="solexa_quals" argument="--solexa-quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default: False"/>
+                    <param name="int_quals" argument="--int-quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Are quality values provided as space separated integers?" help="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified [default: False]"/>
+                </when>
+            </conditional>
+
+            <conditional name="alignment_options">
+                <param name="alignment_options_selector" type="select" label="Alignment options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify alignment options</option>
+                </param>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="function_type" argument="--n-ceil" type="select" display="radio" label="Function governing the maximum number of ambiguous characters (usually Ns and/or .s) allowed in a read as a function of read length" help="Reads exceeding this ceiling are filtered out">
+                        <option value="C">Constant [f(x) = B]</option>
+                        <option value="L" selected="true">Linear [f(x) = B + A * x]</option>
+                        <option value="S">Square root [f(x) = B + A * x&#178;]</option>
+                        <option value="G">Natural logarithm [f(x) = B + A * log(x)]</option>
+                    </param>
+                    <param name="constant_term" type="float" value="0" label="Constant term (B)" help="Constant term for the above function" />
+                    <param name="coefficient" type="float" value="0.15" label="Coefficient (A)" help="Coefficient for the above function" />
+                    <param argument="--ignore-quals" name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="Ignore quality values" help="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value. I.e. input is treated as though all quality values are high. This is also the default behavior when the input doesn't specify quality values" />
+                    <param argument="--nofw" name="skip_forward" type="boolean" truevalue="--nofw" falsevalue="" label="Skip forward strand of reference" help="If --nofw is specified, HISAT2 will not attempt to align unpaired reads to the forward (Watson) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes HISAT2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand" />
+                    <param argument="--norc" name="skip_reverse" type="boolean" truevalue="--norc" falsevalue="" label="Skip reverse strand of reference" help="If --norc is specified, HISAT2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --norc causes HISAT2 to explore only those paired-end configurations corresponding to fragments from the forward-complement (Watson) strand" />
+                </when>
+            </conditional>
+
+            <conditional name="scoring_options">
+                <param name="scoring_options_selector" type="select" label="Scoring options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify scoring options</option>
                 </param>
-                <param name="nc_constant_term" type="float" value="-8" label="Constant term (B)" help="Constant term for the above function" />
-                <param name="nc_coefficient" type="float" value="1" label="Coefficient (A)" help="Coefficient for the above function" />
-                <param name="min_intron" type="integer" value="20" label="Minimum intron length" />
-                <param name="max_intron" type="integer" value="500000" label="Maximum intron length" />
-                <param name="rna_strandness" argument="--rna-strandness" type="select" label="Specify strand-specific information"
-                    help="'F' means a read corresponds to a transcript. 'R' means a read corresponds to the reverse complemented counterpart of a transcript">
-                    <option value="">FR Unstranded</option>
-                    <option value="R">First Strand (R/RF)</option>
-                    <option value="F">Second Strand (F/FR)</option>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="constant_term" type="float" value="0" label="Constant term (B)" help="Constant term for the above function" />
+                    <param name="coefficient" type="float" value="-0.2" label="Coefficient (A)" help="Coefficient for the above function" />
+                    <param argument="--mp" name="max_mismatch" type="integer" value="6" min="0" label="Maximum mismatch penalty" help="Sets the maximum mismatch penalty. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX. Otherwise, the number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
+                    <param argument="--mp" name="min_mismatch" type="integer" value="2" min="0" label="Minimum mismatch penalty" help="Sets the minimum mismatch penalty. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX. Otherwise, the number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
+                    <param argument="--sp" name="soft_clip_penalty_max" type="integer" value="2" min="0" label="Maximum soft-clipping penalty" help="Sets the maximum (MX) penalty for soft-clipping per base. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position. The number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
+                    <param argument="--sp" name="soft_clip_penalty_min" type="integer" value="1" min="0" label="Minimum soft-clipping penalty" help="Sets the minimum (MN) penalty for soft-clipping per base. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position. The number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value" />
+                    <param argument="--no-softclip" name="no_softclip" type="boolean" truevalue="" falsevalue="--no-softclip" label="Allow soft-clipping" />
+                    <param argument="--np" name="ambiguous_penalty" type="integer" value="1" min="0" label="Ambiguous read penalty" help="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as N" />
+                    <param argument="--rdg" name="read_open_penalty" type="integer" value="5" min="0" label="Read gap open penalty" help="A read gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
+                    <param argument="--rdg" name="read_extend_penalty" type="integer" value="3" min="0" label="Read gap extend penalty" help="A read gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
+                    <param argument="--rfg" name="ref_open_penalty" type="integer" value="5" min="0" label="Reference gap open penalty" help="A reference gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
+                    <param argument="--rfg" name="ref_extend_penalty" type="integer" value="3" min="0" label="Reference gap extend penalty" help="A reference gap of length N gets a penalty of [open_penalty] + N * [extend_penalty]" />
+                    <param name="function_type" argument="--score-min" type="select" display="radio" label="Function governing the minimum alignment score needed for an alignment to be considered &quot;valid&quot; (i.e. good enough to report)" help="This is a function of read length">
+                        <option value="C">Constant [f(x) = B]</option>
+                        <option value="L" selected="true">Linear [f(x) = B + A * x]</option>
+                        <option value="S">Square root [f(x) = B + A * x&#178;]</option>
+                        <option value="G">Natural logarithm [f(x) = B + A * log(x)]</option>
+                    </param>
+                </when>
+            </conditional>
+
+            <conditional name="spliced_options">
+                <param name="spliced_options_selector" type="select" label="Spliced alignment options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify spliced alignment options</option>
                 </param>
-                <conditional name="no_spliced_alignment_options">
-                    <param name="no_spliced_alignment" argument="--no-spliced-alignment" type="select" label="Disable spliced alignment">
-                        <option value="--no-spliced-alignment">True</option>
-                        <option value="">False</option>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="canonical_penalty" argument="--pen-cansplice" type="integer" value="0" min="0" label="Penalty for canonical splice sites" />
+                    <param name="noncanonical_penalty" argument="--pen-noncansplice" type="integer" value="12" min="0" label="Penalty for non-canonical splice sites" />
+                    <param name="function_type" argument="--pen-canintronlen" type="select" display="radio" label="Penalty function for long introns with canonical splice sites" help="Alignments with shorter introns are preferred to those with longer ones">
+                        <option value="C">Constant [f(x) = B]</option>
+                        <option value="L">Linear [f(x) = B + A * x]</option>
+                        <option value="S">Square root [f(x) = B + A * x&#178;]</option>
+                        <option value="G" selected="true">Natural logarithm [f(x) = B + A * log(x)]</option>
+                    </param>
+                    <param name="constant_term" type="float" value="-8" label="Constant term (B)" help="Constant term for the above function" />
+                    <param name="coefficient" type="float" value="1" label="Coefficient (A)" help="Coefficient for the above function" />
+                    <param name="nc_function_type" argument="--pen-noncanintronlen" type="select" display="radio" label="Penalty function for long introns with non-canonical splice sites" help="Alignments with shorter introns are preferred to those with longer ones">
+                        <option value="C">Constant [f(x) = B]</option>
+                        <option value="L">Linear [f(x) = B + A * x]</option>
+                        <option value="S">Square root [f(x) = B + A * x&#178;]</option>
+                        <option value="G" selected="true">Natural logarithm [f(x) = B + A * log(x)]</option>
                     </param>
-                    <when value="--no-spliced-alignment">
-                        <param name="minins" argument="-I" type="integer" value="0" label="Minimum fragment length for valid paired-end alignments" help="E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates. The larger the difference between -I and -X, the slower HISAT2 will run. This is because larger differences between -I and -X require that HISAT2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very efficient" />
-                        <param name="maxins" argument="-X" type="integer" value="500" label="Maximum fragment length for valid paired-end alignments" help="E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates. The larger the difference between -I and -X, the slower HISAT2 will run. This is because larger differences between -I and -X require that HISAT2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very efficient" />
-                    </when>
-                    <when value="" />
-                </conditional>
-                <param name="known_splice_gtf" type="data" format="gtf" optional="true" label="GTF file with known splice sites" />
-                <param name="tma" type="select" display="radio" label="Transcriptome assembly reporting">
-                    <option value="">Use default reporting.</option>
-                    <option value="--tmo">Report only those alignments within known transcripts.</option>
-                    <option value="--dta">Report alignments tailored for transcript assemblers including StringTie.</option>
-                    <option value="--dta-cufflinks">Report alignments tailored specifically for Cufflinks.</option>
+                    <param name="nc_constant_term" type="float" value="-8" label="Constant term (B)" help="Constant term for the above function" />
+                    <param name="nc_coefficient" type="float" value="1" label="Coefficient (A)" help="Coefficient for the above function" />
+                    <param name="min_intron" type="integer" value="20" min="0" label="Minimum intron length" />
+                    <param name="max_intron" type="integer" value="500000" min="0" label="Maximum intron length" />
+                    <conditional name="no_spliced_alignment_options">
+                        <param name="no_spliced_alignment" argument="--no-spliced-alignment" type="select" label="Disable spliced alignment">
+                            <option value="--no-spliced-alignment">True</option>
+                            <option value="">False</option>
+                        </param>
+                        <when value="--no-spliced-alignment">
+                            <param name="minins" argument="-I" type="integer" value="0" min="0" label="Minimum fragment length for valid paired-end alignments" help="E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates. The larger the difference between -I and -X, the slower HISAT2 will run. This is because larger differences between -I and -X require that HISAT2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very efficient" />
+                            <param name="maxins" argument="-X" type="integer" value="500" min="0" label="Maximum fragment length for valid paired-end alignments" help="E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates. The larger the difference between -I and -X, the slower HISAT2 will run. This is because larger differences between -I and -X require that HISAT2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very efficient" />
+                        </when>
+                        <when value="" />
+                    </conditional>
+                    <param name="known_splice_gtf" type="data" format="gtf" optional="true" label="GTF file with known splice sites" />
+                    <param name="tma" type="select" display="radio" label="Transcriptome assembly reporting">
+                        <option value="">Use default reporting.</option>
+                        <option value="--tmo">Report only those alignments within known transcripts.</option>
+                        <option value="--dta">Report alignments tailored for transcript assemblers including StringTie.</option>
+                        <option value="--dta-cufflinks">Report alignments tailored specifically for Cufflinks.</option>
+                    </param>
+                    <param name="notmplen" argument="--no-templatelen-adjustment" type="boolean" truevalue="--no-templatelen-adjustment" falsevalue="" label="Disable automatic template length adjustment for RNA-seq reads" help="Default: false" />
+                </when>
+            </conditional>
+
+            <conditional name="reporting_options">
+                <param name="reporting_options_selector" type="select" label="Reporting options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify reporting options</option>
                 </param>
-            </when>
-        </conditional>
-        <conditional name="paired_options">
-            <param name="paired_options_selector" type="select" label="Paired alignment parameters">
-                <option value="defaults">Use default values</option>
-                <option value="advanced">Specify paired alignment parameters</option>
-            </param>
-            <when value="defaults" />
-            <when value="advanced">
-                <param argument="--minins" type="integer" value="0" label="Minimum fragment length" help="The minimum fragment length for valid paired-end alignments. 0 sets no minimum" />
-                <param argument="--maxins" type="integer" value="500" label="Maximum fragment length" help="The maximum fragment length for valid paired-end alignments" />
-                <param name="no_mixed" argument="--no-mixed" type="boolean" truevalue="--no-mixed" falsevalue="" label="Disable finding alignments for individual mates"
-                    help="By default, when hisat2 cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates" />
-                <param name="no_discordant" argument="--no-discordant" type="boolean" truevalue="--no-discordant" falsevalue="" label="Disable looking for discordant alignments"
-                    help="By default, hisat2 looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints" />
-                <param argument="--dovetail" type="boolean" truevalue="--dovetail" falsevalue="" label="Mates not dovetail" help="If the mates &quot;dovetail&quot;, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant" />
-                <param name="contain" argument="--no-contain" type="boolean" truevalue="--no-contain" falsevalue="" label="Mates cannot contain others" help="If one mate alignment contains the other, consider that to be non-concordant" />
-                <param name="overlap" argument="--no-overlap" type="boolean" truevalue="--no-overlap" falsevalue="" label="Mates cannot overlap" help="If one mate alignment overlaps the other at all, consider that to be non-concordant" />
-            </when>
-        </conditional>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="max_primary" argument="-k" type="integer" min="0" optional="true" label="Primary alignments" help="Search for at most K distinct, primary alignments for each read. Primary alignments mean alignments whose alignment score is equal or higher than any other alignments. The search terminates when it can't find more distinct valid alignments, or when it finds K, whichever happens first. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. For reads that have more than K distinct, valid alignments, HISAT2 does not guarantee that the K alignments reported are the best possible in terms of alignment score. HISAT2 is not designed with large values for -k in mind, so when aligning reads to long repetitive genomes, a large K can be very, very slow. Default: 5 (HFM) or 10 (HGFM)" />
+                    <param name="max_seeds" argument="--max-seeds" type="integer" min="0" optional="true" label="Maximum number of seeds that will be extended" help="HISAT2, like other aligners, uses seed-and-extend approaches. HISAT2 tries to extend seeds to full-length alignments. HISAT2 extends up to these many seeds and skips the rest of the seeds. Large values for --max-seeds may improve alignment sensitivity, but HISAT2 is not designed with large values for --max-seeds in mind, and when aligning reads to long repetitive genomes, a large --max-seeds can be very, very slow. Default: 5 (HFM) or 10 (HGFM)" />
+                    <param name="secondary" argument="--secondary" type="boolean" truevalue="--secondary" falsevalue="" label="Report secondary alignments" />
+                </when>
+            </conditional>
+
+             <conditional name="output_options">
+                <param name="output_options_selector" type="select" label="Output options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify output options</option>
+                </param>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="unaligned_file" argument="--un/--un-conc" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="This triggers --un parameter for single reads and --un-conc for paired reads" />
+                    <param name="aligned_file" argument="--al/--al-conc" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="This triggers --al parameter for single reads and --al-conc for paired reads" />
+                </when>
+            </conditional>
+
+            <conditional name="other_options">
+                <param name="other_options_selector" type="select" label="Other options">
+                    <option value="defaults">Use default values</option>
+                    <option value="advanced">Specify other options</option>
+                </param>
+                <when value="defaults" />
+                <when value="advanced">
+                    <param name="seed" argument="--seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="Default=0" />
+                    <param name="non_deterministic" argument="--non-deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="see Help below for explanation of this option; default: False"/>
+                </when>
+            </conditional>
+        </section>
+
     </inputs>
+
+    <!-- Define outputs -->
+
     <outputs>
-        <data name="output_alignments" format="bam">
-            <actions>
-                <conditional name="reference_genome.reference_genome_source">
-                    <when value="indexed">
-                        <action type="metadata" name="dbkey">
-                            <option type="from_data_table" name="hisat2_indexes" column="1" offset="0">
-                                <filter type="param_value" column="0" compare="startswith" value="#" keep="false" />
-                                <filter type="param_value" ref="reference_genome.index" column="0" />
-                            </option>
-                        </action>
-                    </when>
-                    <when value="history">
-                        <action type="metadata" name="dbkey">
-                            <option type="from_param" name="reference_genome.history_item" param_attribute="dbkey" />
-                        </action>
-                    </when>
-                </conditional>
-            </actions>
+
+        <!-- BAM -->
+        <data name="output_alignments" format="bam" label="${tool.name} on ${on_string}: aligned reads (BAM) " />
+
+        <!-- Unaligned fastq (L) -->
+        <data name="output_unaligned_reads_l" format="fastqsanger" label="${tool.name} on ${on_string}: unaligned reads (L)">
+            <filter>adv['output_options']['output_options_selector'] == "advanced" and adv['output_options']['unaligned_file'] is True)</filter>
         </data>
-        <data name="output_unaligned_reads" format="fastqsanger" label="${tool.name} on ${on_string}: unaligned reads">
-            <filter>input_format['paired']['unaligned_file'] is True and input_format['paired']['paired_selector'] == 'single'</filter>
-            <actions>
-                <action type="format">
-                    <option type="from_param" name="input_format.paired.reads" param_attribute="ext" />
-                </action>
-            </actions>
-        </data>
-        <data name="output_aligned_reads" format="fastqsanger" label="${tool.name} on ${on_string}: aligned reads">
-            <filter>input_format['paired']['aligned_file'] is True and input_format['paired']['paired_selector'] == 'single'</filter>
-            <actions>
-                <action type="format">
-                    <option type="from_param" name="input_format.paired.reads" param_attribute="ext" />
-                </action>
-            </actions>
+
+        <!-- Aligned fastq (L) -->
+        <data name="output_aligned_reads_l" format="fastqsanger" label="${tool.name} on ${on_string}: aligned reads (L)">
+            <filter>adv['output_options']['output_options_selector'] == "advanced" and adv['output_options']['aligned_file'] is True)</filter>
         </data>
-        <data name="output_unaligned_reads_l" format="fastqsanger" label="${tool.name} on ${on_string}: unaligned reads (L)">
-            <filter>input_format['paired']['unaligned_file'] is True and input_format['paired']['paired_selector'] == 'paired'</filter>
-            <actions>
-                <conditional name="input_format.paired.collection.collection_selector">
-                    <when value="collection">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.reads.forward" param_attribute="ext" />
-                        </action>
-                    </when>
-                    <when value="files">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.forward" param_attribute="ext" />
-                        </action>
-                    </when>
-                </conditional>
-            </actions>
-        </data>
+
+        <!-- Unaligned fastq (R) -->
         <data name="output_unaligned_reads_r" format="fastqsanger" label="${tool.name} on ${on_string}: unaligned reads (R)">
-            <filter>input_format['paired']['unaligned_file'] is True and input_format['paired']['paired_selector'] == 'paired'</filter>
-            <actions>
-                <conditional name="input_format.paired.collection.collection_selector">
-                    <when value="collection">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.reads.reverse" param_attribute="ext" />
-                        </action>
-                    </when>
-                    <when value="files">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.reverse" param_attribute="ext" />
-                        </action>
-                    </when>
-                </conditional>
-            </actions>
+            <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection') and (adv['output_options']['output_options_selector'] == "advanced" and adv['output_options']['unaligned_file'] is True) </filter>
+        </data>
+
+        <!-- Aligned fastq (R) -->
+        <data name="output_aligned_reads_r" format="fastqsanger" label="${tool.name} on ${on_string}: aligned reads (R)">
+            <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection') and (adv['output_options']['output_options_selector'] == "advanced" and adv['output_options']['aligned_file'] is True) </filter>
+        </data>
+
+        <!-- Alignment summary file -->
+        <data name="summary_file"  format="txt" from_work_dir="summary.txt" label="${tool.name} on ${on_string}: Mapping summary" >
+          <filter>sum['summary_file'] is True</filter>
         </data>
-        <data name="output_aligned_reads_l" format="fastqsanger" label="${tool.name} on ${on_string}: aligned reads (L)">
-            <filter>input_format['paired']['aligned_file'] is True and input_format['paired']['paired_selector'] == 'paired'</filter>
-            <actions>
-                <conditional name="input_format.paired.collection.collection_selector">
-                    <when value="collection">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.reads.forward" param_attribute="ext" />
-                        </action>
-                    </when>
-                    <when value="files">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.forward" param_attribute="ext" />
-                        </action>
-                    </when>
-                </conditional>
-            </actions>
-        </data>
-        <data name="output_aligned_reads_r" format="fastqsanger" label="${tool.name} on ${on_string}: aligned reads (R)">
-            <filter>input_format['paired']['aligned_file'] is True and input_format['paired']['paired_selector'] == 'paired'</filter>
-            <actions>
-                <conditional name="input_format.paired.collection.collection_selector">
-                    <when value="collection">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.reads.reverse" param_attribute="ext" />
-                        </action>
-                    </when>
-                    <when value="files">
-                        <action type="format">
-                            <option type="from_param" name="input_format.paired.collection.reverse" param_attribute="ext" />
-                        </action>
-                    </when>
-                </conditional>
-            </actions>
-        </data>
+
     </outputs>
+
+    <!-- Define tests -->
+
     <tests>
-        <test>
-            <param name="input_format_selector" value="fastq" />
-            <param name="paired_selector" value="paired" />
-            <param name="collection_selector" value="files" />
-            <param name="reference_genome_source" value="history" />
+        <test><!-- Ensure bam output works -->
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
-            <param name="forward" ftype="fastqsanger" value="hisat_input_1_forward.fastq" />
-            <param name="reverse" ftype="fastqsanger" value="hisat_input_1_reverse.fastq" />
+            <param name="input_1" ftype="fastqsanger" value="hisat_input_1_forward.fastq" />
+            <param name="input_2" ftype="fastqsanger" value="hisat_input_1_reverse.fastq" />
             <output name="output_alignments" file="hisat_output_1.bam" ftype="bam" lines_diff="2" />
         </test>
-        <test>
-            <param name="input_format_selector" value="fastq" />
-            <param name="paired_selector" value="paired" />
-            <param name="collection_selector" value="files" />
-            <param name="reference_genome_source" value="history" />
+        <test><!-- Ensure built-in reference works -->
+            <param name="type" value="paired" />
+            <param name="source" value="indexed" />
+            <param name="input_1" ftype="fastqsanger" dbkey="phiX" value="hisat_input_1_forward.fastq" />
+            <param name="input_2" ftype="fastqsanger" dbkey="phiX" value="hisat_input_1_reverse.fastq" />
+            <output name="output_alignments" file="hisat_output_1.bam" ftype="bam" lines_diff="2" />
+        </test>
+        <test><!-- Ensure trimming works -->
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
             <param name="input_options_selector" value="advanced" />
-            <param name="trim_three" value="15" />
-            <param name="trim_five" value="15" />
-            <param name="forward" ftype="fastqsanger" value="hisat_input_2_forward.fastq" />
-            <param name="reverse" ftype="fastqsanger" value="hisat_input_2_reverse.fastq" />
+            <param name="trim3" value="15" />
+            <param name="trim5" value="15" />
+            <param name="input_1" ftype="fastqsanger" value="hisat_input_2_forward.fastq" />
+            <param name="input_2" ftype="fastqsanger" value="hisat_input_2_reverse.fastq" />
             <output name="output_alignments" file="hisat_output_2.bam" ftype="bam" lines_diff="2" />
         </test>
-        <test>
-            <param name="input_format_selector" value="fastq" />
-            <param name="paired_selector" value="paired" />
-            <param name="collection_selector" value="files" />
-            <param name="reference_genome_source" value="history" />
+        <test><!-- Ensure paired options works -->
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
             <param name="input_options_selector" value="advanced" />
-            <param name="trim_three" value="15" />
-            <param name="trim_five" value="15" />
-            <param name="forward" ftype="fastqsanger" value="hisat_input_2_forward.fastq" />
-            <param name="reverse" ftype="fastqsanger" value="hisat_input_2_reverse.fastq" />
-            <param name="paired_end_options_selector" value="advanced" />
+            <param name="trim3" value="15" />
+            <param name="trim5" value="15" />
+            <param name="input_1" ftype="fastqsanger" value="hisat_input_2_forward.fastq" />
+            <param name="input_2" ftype="fastqsanger" value="hisat_input_2_reverse.fastq" />
+            <param name="paired_options_selector" value="advanced" />
             <param name="no_mixed" value="True" />
             <param name="no_discordant" value="True" />
             <output name="output_alignments" file="hisat_output_3.bam" ftype="bam" lines_diff="2" />
         </test>
-        <test>
-            <param name="input_format_selector" value="fasta" />
-            <param name="paired_selector" value="single" />
-            <param name="reference_genome_source" value="history" />
+        <test><!-- Ensure unaligned output works -->
+            <param name="type" value="single" />
+            <param name="source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
+            <param name="output_options_selector" value="advanced" />
             <param name="unaligned_file" value="true" />
             <param name="aligned_file" value="true" />
-            <param name="reference_genome_source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
-            <param name="reads" ftype="fasta" value="test_unaligned_reads.fasta" />
-            <output name="output_unaligned_reads" file="test_unaligned_reads.fasta" />
+            <param name="input_1" ftype="fasta" value="test_unaligned_reads.fasta" />
+            <output name="output_unaligned_reads_l" file="test_unaligned_reads.fasta" />
         </test>
-        <test>
-            <param name="input_format_selector" value="fasta" />
-            <param name="paired_selector" value="paired" />
-            <param name="collection_selector" value="files" />
-            <param name="reference_genome_source" value="history" />
-            <param name="history_item" ftype="fasta" value="phiX.fa" />
+        <test><!-- Ensure paired unaligned output works -->
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
+            <param name="output_options_selector" value="advanced" />
             <param name="unaligned_file" value="true" />
             <param name="aligned_file" value="true" />
-            <param name="reference_genome_source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
-            <param name="forward" ftype="fasta" value="test_unaligned_reads.fasta" />
-            <param name="reverse" ftype="fasta" value="test_unaligned_reads.fasta" />
+            <param name="input_1" ftype="fasta" value="test_unaligned_reads.fasta" />
+            <param name="input_2" ftype="fasta" value="test_unaligned_reads.fasta" />
             <output name="output_unaligned_reads_l" file="test_unaligned_reads.fasta" />
             <output name="output_unaligned_reads_r" file="test_unaligned_reads.fasta" />
         </test>
         <test><!-- Ensure fastqsanger.gz works -->
-            <param name="input_format_selector" value="fastq" />
-            <param name="paired_selector" value="paired" />
-            <param name="collection_selector" value="files" />
-            <param name="reference_genome_source" value="history" />
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
             <param name="input_options_selector" value="advanced" />
-            <param name="trim_three" value="15" />
-            <param name="trim_five" value="15" />
-            <param name="forward" ftype="fastqsanger.gz" value="hisat_input_2_forward.fastq.gz" />
-            <param name="reverse" ftype="fastqsanger.gz" value="hisat_input_2_reverse.fastq.gz" />
-            <param name="paired_end_options_selector" value="advanced" />
+            <param name="trim3" value="15" />
+            <param name="trim5" value="15" />
+            <param name="input_1" ftype="fastqsanger.gz" value="hisat_input_2_forward.fastq.gz" />
+            <param name="input_2" ftype="fastqsanger.gz" value="hisat_input_2_reverse.fastq.gz" />
+            <param name="paired_options_selector" value="advanced" />
             <param name="no_mixed" value="True" />
             <param name="no_discordant" value="True" />
             <output name="output_alignments" file="hisat_output_3.bam" ftype="bam" lines_diff="2" />
         </test>
         <test><!-- Ensure fastqsanger.bz2 works -->
-            <param name="input_format_selector" value="fastq" />
-            <param name="paired_selector" value="paired" />
-            <param name="collection_selector" value="files" />
-            <param name="reference_genome_source" value="history" />
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
             <param name="history_item" ftype="fasta" value="phiX.fa" />
             <param name="input_options_selector" value="advanced" />
-            <param name="trim_three" value="15" />
-            <param name="trim_five" value="15" />
-            <param name="forward" ftype="fastqsanger.bz2" value="hisat_input_2_forward.fastq.bz2" />
-            <param name="reverse" ftype="fastqsanger.bz2" value="hisat_input_2_reverse.fastq.bz2" />
-            <param name="paired_end_options_selector" value="advanced" />
+            <param name="trim3" value="15" />
+            <param name="trim5" value="15" />
+            <param name="input_1" ftype="fastqsanger.bz2" value="hisat_input_2_forward.fastq.bz2" />
+            <param name="input_2" ftype="fastqsanger.bz2" value="hisat_input_2_reverse.fastq.bz2" />
+            <param name="paired_options_selector" value="advanced" />
             <param name="no_mixed" value="True" />
             <param name="no_discordant" value="True" />
             <output name="output_alignments" file="hisat_output_3.bam" ftype="bam" lines_diff="2" />
         </test>
+        <test><!-- Ensure paired strandness works -->
+            <param name="type" value="paired" />
+            <param name="source" value="history" />
+            <param name="history_item" ftype="fasta" value="phiX.fa" />
+            <param name="input_1" ftype="fastqsanger" value="hisat_input_1_forward.fastq" />
+            <param name="input_2" ftype="fastqsanger" value="hisat_input_1_reverse.fastq" />
+            <param name="rna_strandness" value="FR" />
+            <output name="output_alignments" file="hisat_output_4.bam" ftype="bam" lines_diff="2" />
+        </test>
+        <test><!-- Ensure summary file output works -->
+            <param name="type" value="single" />
+            <param name="source" value="history" />
+            <param name="history_item" ftype="fasta" value="phiX.fa" />
+            <param name="input_1" ftype="fastqsanger" value="hisat_input_1_forward.fastq" />
+            <param name="rna_strandness" value="R" />
+            <param name="new_summary" value="true" />
+            <param name="summary_file" value="true" />
+            <output name="summary_file" file="hisat_output.summary" ftype="txt" />
+        </test>
     </tests>
+
     <help><![CDATA[
 Introduction
 ============
@@ -596,10 +779,8 @@
 Alignment summmary
 ------------------
 
-When HISAT finishes running, it prints messages summarizing what
-happened. These messages are printed to the "standard error" ("stderr")
-filehandle. For datasets consisting of unpaired reads, the summary might
-look like this:
+When HISAT finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle and can be optionally printed to a file. Choose `--new-summary` under **Summary Options** for compatibility with `MultiQC <http://multiqc.info/docs/#hisat2>`_.
+For datasets consisting of unpaired reads, the summary might look like this:
 
 ::
 
@@ -631,6 +812,241 @@
     96.70% overall alignment rate
 
 The indentation indicates how subtotals relate to totals.
+
+
+.. class:: infomark
+
+**HISAT2 options**
+
+Galaxy wrapper for HISAT2 implements most, but not all, options available through the command line. Supported options are described below.
+
+-----
+
+**Inputs**
+
+HISAT2 accepts files in FASTQ or FASTA format (single-end or paired-end).
+
+Note that if your reads are from a stranded library, you need to choose the appropriate setting under **Specify strand information** above. For single-end reads, use F or R. 'F' means a read corresponds to a transcript. 'R' means a read corresponds to the reverse complemented counterpart of a transcript. For paired-end reads, use either FR or RF. With this option being used, every read alignment will have an XS attribute tag: '+' means a read belongs to a transcript on '+' strand of genome. '-' means a read belongs to a transcript on '-' strand of genome. (TopHat has a similar option, --library-type option, where fr-firststrand corresponds to R and RF; fr-secondstrand corresponds to F and FR.)
+
+------
+
+**Input options**::
+
+    -s/--skip <int>
+            Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
+
+    -u/--qupto <int>
+            Align the first `<int>` reads or read pairs from the input (after the
+            `-s`/`--skip` reads or pairs have been skipped), then stop.  Default: no limit.
+
+    -5/--trim5 <int>
+            Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).
+
+    -3/--trim3 <int>
+            Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0).
+
+    --phred33
+            Input qualities are ASCII chars equal to the Phred quality plus 33.  This is
+            also called the "Phred+33" encoding, which is used by the very latest Illumina
+            pipelines.
+
+    --phred64
+            Input qualities are ASCII chars equal to the Phred quality plus 64.  This is
+            also called the "Phred+64" encoding.
+
+    --solexa-quals
+            Convert input qualities from Solexa Phred quality (which can be negative) to
+            Phred Phred quality (which can't).  This scheme was used in older Illumina GA
+            Pipeline versions (prior to 1.3).  Default: off.
+
+    --int-quals
+            Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
+            Integers are treated as being on the Phred quality scale unless
+            `--solexa-quals` is also specified. Default: off.
+
+------
+
+**Alignment options**::
+
+    --n-ceil <func>
+            Sets a function governing the maximum number of ambiguous characters (usually
+            `N`s and/or `.`s) allowed in a read as a function of read length.  For instance,
+            specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
+            where x is the read length.  Reads exceeding this ceiling are filtered out.
+            Default: `L,0,0.15`.
+
+    --ignore-quals
+            When calculating a mismatch penalty, always consider the quality value at the
+            mismatched position to be the highest possible, regardless of the actual value.
+            I.e. input is treated as though all quality values are high.  This is also the
+            default behavior when the input doesn't specify quality values (e.g. in `-f`,
+            `-r`, or `-c` modes).
+
+    --nofw/--norc
+            If `--nofw` is specified, `hisat2` will not attempt to align unpaired reads to
+            the forward (Watson) reference strand.  If `--norc` is specified, `hisat2` will not attempt to align unpaired reads against the reverse-complement (Crick)
+            reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
+            fragments; i.e. specifying `--nofw` causes `hisat2` to explore only those
+            paired-end configurations corresponding to fragments from the reverse-complement
+            (Crick) strand.  Default: both strands enabled.
+
+-----
+
+**Scoring options**::
+
+    --mp MX,MN
+            Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A number less than or equal to `MX` and greater than or equal to `MN` is
+            subtracted from the alignment score for each position where a read character
+            aligns to a reference character, the characters do not match, and neither is an
+            `N`.  If `--ignore-quals` is specified, the number subtracted quals `MX`.
+            Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
+            where Q is the Phred quality value.  Default: `MX` = 6, `MN` = 2.
+
+    --sp MX,MN
+            Sets the maximum (`MX`) and minimum (`MN`) penalties for soft-clipping per base, both integers. A number less than or equal to `MX` and greater than or equal to `MN` is subtracted from the alignment score for each position. The number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` where Q is the Phred quality value. Default: `MX` = 2, `MN` = 1.
+
+    --no-softclip
+            Disallow soft-clipping.
+
+    --np <int>
+            Sets penalty for positions where the read, reference, or both, contain an
+            ambiguous character such as `N`.  Default: 1.
+
+    --rdg <int1>,<int2>
+            Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties.  A read gap of
+            length N gets a penalty of `<int1>` + N * `<int2>`.  Default: 5, 3.
+
+    --rfg <int1>,<int2>
+            Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties.  A
+            reference gap of length N gets a penalty of `<int1>` + N * `<int2>`.  Default:
+            5, 3.
+
+    --score-min <func>
+            Sets a function governing the minimum alignment score needed for an alignment to
+            be considered "valid" (i.e. good enough to report).  This is a function of read
+            length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
+            to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default is `L,0,-0.2`.
+
+-----
+
+**Spliced alignment options**::
+
+    --pen-cansplice <int>
+            Sets the penalty for each pair of canonical splice sites (e.g. GT/AG). Default: 0.
+
+    --pen-noncansplice <int>
+            Sets the penalty for each pair of non-canonical splice sites (e.g. non-GT/AG). Default: 12.
+
+    --pen-canintronlen <func>
+            Sets the penalty for long introns with canonical splice sites so that alignments with shorter introns are preferred to those with longer ones. Default: G,-8,1
+
+    --pen-noncanintronlen <func>
+            Sets the penalty for long introns with noncanonical splice sites so that alignments with shorter introns are preferred to those with longer ones. Default: G,-8,1
+
+    --min-intronlen <int>
+            Sets minimum intron length. Default: 20
+
+    --max-intronlen <int>
+            Sets maximum intron length. Default: 500000
+
+    --no-spliced-alignment
+            Disable spliced alignment.
+
+    -I/--minins <int>
+            The minimum fragment length for valid paired-end alignments.This option is valid only with `--no-spliced-alignment`. E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates.
+
+            The larger the difference between `-I` and `-X`, the slower HISAT2 will run. This is because larger differences between `-I` and `-X` require that HISAT2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very efficient.
+
+            Default: 0 (essentially imposing no minimum)
+
+    -X/--maxins <int>
+            The maximum fragment length for valid paired-end alignments. This option is valid only with `--no-spliced-alignment`. E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates.
+
+            The larger the difference between `-I` and `-X`, the slower HISAT2 will run. This is because larger differences between `-I` and `-X` require that HISAT2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very efficient.
+
+            Default: 500.
+
+    --known-splicesite-infile <path>
+            With this mode, you can provide a list of known splice sites, which HISAT2 makes use of to align reads with small anchors. You can create such a list using python hisat2_extract_splice_sites.py genes.gtf > splicesites.txt, where hisat2_extract_splice_sites.py is included in the HISAT2 package, genes.gtf is a gene annotation file, and splicesites.txt is a list of splice sites with which you provide HISAT2 in this mode. Note that it is better to use indexes built using annotated transcripts (such as genome_tran or genome_snp_tran), which works better than using this option. It has no effect to provide splice sites that are already included in the indexes.
+
+    --tmo/--transcriptome-mapping-only
+            Report only those alignments within known transcripts.
+
+    --dta/--downstream-transcriptome-assembly
+            Report alignments tailored for transcript assemblers including StringTie. With this option, HISAT2 requires longer anchor lengths for de novo discovery of splice sites. This leads to fewer alignments with short-anchors, which helps transcript assemblers improve significantly in computation and memory usage.
+
+    --dta-cufflinks
+            Report alignments tailored specifically for Cufflinks. In addition to what HISAT2 does with the above option (--dta), With this option, HISAT2 looks for novel splice sites with three signals (GT/AG, GC/AG, AT/AC), but all user-provided splice sites are used irrespective of their signals. HISAT2 produces an optional field, XS:A:[+-], for every spliced alignment.
+
+    --no-templatelen-adjustment
+            Disables template length adjustment for RNA-seq reads.
+
+-----
+
+**Reporting options**::
+
+    -k <int>
+            It searches for at most `<int>` distinct, primary alignments for each read. Primary alignments mean alignments whose alignment score is equal or higher than any other alignments. The search terminates when it can't find more distinct valid alignments, or when it finds `<int>`, whichever happens first. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. For reads that have more than `<int>` distinct, valid alignments, hisat2 does not guarantee that the `<int>` alignments reported are the best possible in terms of alignment score. Default: 5 (HFM) or 10 (HGFM)
+
+            Note: HISAT2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow.
+
+    -max-seeds
+            HISAT2, like other aligners, uses seed-and-extend approaches. HISAT2 tries to extend seeds to full-length alignments. In HISAT2, `--max-seeds` is used to control the maximum number of seeds that will be extended. HISAT2 extends up to these many seeds and skips the rest of the seeds. Large values for `--max-seeds` may improve alignment sensitivity, but HISAT2 is not designed with large values for `--max-seeds` in mind, and when aligning reads to long, repetitive genomes large `--max-seeds` can be very, very slow. The default value is the maximum of 5 and the value that comes with `-k`.
+
+    --secondary
+            Report secondary alignments.
+
+-----
+
+**Paired-end options**::
+
+    --fr/--rf/--ff
+            The upstream/downstream mate orientations for a valid paired-end alignment
+            against the forward reference strand.  E.g., if `--fr` is specified and there is
+            a candidate paired-end alignment where mate 1 appears upstream of the reverse
+            complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
+            met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse
+            complement of mate 1 and all other constraints are met, that too is valid.
+            `--rf` likewise requires that an upstream mate1 be reverse-complemented and a
+            downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
+            and a downstream mate 2 to be forward-oriented.  Default: `--fr` (appropriate
+            for Illumina's Paired-end Sequencing Assay).
+
+    --no-mixed
+            By default, when `hisat2` cannot find a concordant or discordant alignment for
+            a pair, it then tries to find alignments for the individual mates.  This option
+            disables that behavior.
+
+    --no-discordant
+            By default, `hisat2` looks for discordant alignments if it cannot find any
+            concordant alignments.  A discordant alignment is an alignment where both mates
+            align uniquely, but that does not satisfy the paired-end constraints
+            (`--fr`/`--rf`/`--ff`, `-I`, `-X`).  This option disables that behavior.
+
+
+**Output options**::
+
+    --un/--un-gz/--un-bz2
+            Write unpaired reads that fail to align to file at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit set and neither the `0x40` nor `0x80` bits set. If `--un-gz` is specified, output will be gzip compressed. If `--un-bz2` is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.
+
+    --al/--al-gz/--al-bz2
+            Write unpaired reads that align at least once to file at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4`, `0x40`, and `0x80` bits unset. If `--al-gz` is specified, output will be gzip compressed. If `--al-bz2` is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.
+
+    --un-conc/--un-conc-gz/--un-conc-bz2
+            Write paired-end reads that fail to align concordantly to file(s) at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit set and either the `0x40` or `0x80` bit set (depending on whether it's mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in <path> to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.
+
+    --al-conc/--al-conc-gz/--al-conc-bz2
+            Write paired-end reads that align concordantly at least once to file(s) at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit unset and either the `0x40` or `0x80` bit set (depending on whether it's mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in `<path>` to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.
+
+
+**Other options**::
+
+    --seed <int>
+            Use `<int>` as the seed for pseudo-random number generator.  Default: 0.
+
+    --non-deterministic
+            Normally, HISAT2 re-initializes its pseudo-random generator for each read. It seeds the generator with a number derived from (a) the read name, (b) the nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed` option. This means that if two reads are identical (same name, same nucleotides, same qualities) HISAT2 will find and report the same alignment(s) for both, even if there was ambiguity. When `--non-deterministic` is specified, HISAT2 re-initializes its pseudo-random generator for each read using the current time. This means that HISAT2 will not necessarily report the same alignment for two identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.
+
     ]]></help>
     <citations>
         <citation type="doi">10.1038/nmeth.3317</citation>
diff -r 526b91fbde60 -r d5fe9aead222 hisat2_macros.xml
--- a/hisat2_macros.xml	Wed Jul 19 04:57:27 2017 -0400
+++ b/hisat2_macros.xml	Tue Sep 26 17:01:28 2017 -0400
@@ -1,148 +1,30 @@
-<?xml version="1.0"?>
 <macros>
-    <xml name="single_paired_selector">
-        <param name="paired_selector" type="select" label="Single end or paired reads?">
-            <option value="paired">Paired reads</option>
-            <option value="single">Unpaired reads</option>
+    <xml name="paired_end_options">
+
+        <param name="rna_strandness" argument="--rna-strandness" type="select" label="Specify strand information"
+                help="'FR' means a read corresponds to a transcript. 'RF' means a read corresponds to the reverse complemented counterpart of a transcript. With this option being used, every read alignment will have an XS attribute tag: '+' means a read belongs to a transcript on '+' strand of genome. '-' means a read belongs to a transcript on '-' strand of genome.">
+                <option value="">Unstranded</option>
+                <option value="FR">Forward (FR)</option>
+                <option value="RF">Reverse (RF)</option>
         </param>
-    </xml>
-    <xml name="paired_input_conditional" tokens="ftype">
-        <conditional name="paired">
-            <expand macro="single_paired_selector" />
-            <when value="paired">
-                <conditional name="collection" label="Data structure">
-                    <param name="collection_selector" type="select" label="Input is structured as" help="If a list of pairs is selected, HISAT2 will run in batch mode over each pair in the list, producing a list of output bam files">
-                        <option value="files">Individual files</option>
-                        <option value="collection">Pair collection or list of pairs</option>
-                    </param>
-                    <when value="collection">
-                        <param name="reads" type="data_collection" collection_type="paired" format="@FTYPE@" label="Paired reads" />
-                    </when>
-                    <when value="files">
-                        <param name="forward" type="data" format="@FTYPE@" label="Forward reads" />
-                        <param name="reverse" type="data" format="@FTYPE@" label="Reverse reads" />
-                    </when>
-                </conditional>
-                <expand macro="paired_end_conditional" />
-                <expand macro="paired_end_output" />
-            </when>
-            <when value="single">
-                <param name="reads" type="data" format="@FTYPE@" label="Reads" />
-                <param name="unaligned_file" argument="--un-gz" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" />
-                <param name="aligned_file" argument="--al-gz" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" />
-            </when>
-        </conditional>
-    </xml>
-    <xml name="paired_end_conditional">
-        <conditional name="paired_end_options">
-            <param name="paired_end_options_selector" type="select" label="Paired-end options">
+
+        <conditional name="paired_options">
+            <param name="paired_options_selector" type="select" label="Paired-end options" help="See &quot;Alignment Options&quot; section of Help below for information">
                 <option value="defaults">Use default values</option>
                 <option value="advanced">Specify paired-end parameters</option>
             </param>
-            <when value="defaults" />
+            <when value="defaults"/>
             <when value="advanced">
-                <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" label="Disable alignments of individual mates" help="By default, when hisat cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates. This option disables that behavior" />
-                <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" label="Disable alignments of individual mates" help="By default, hisat looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (--fr/--rf/--ff, -I, -X). This option disables that behavior" />
-                <param name="skip_reverse" type="boolean" truevalue="--norc" falsevalue="" label="Skip reference strand of reference" help="If --norc is specified, hisat will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes hisat to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand" />
+                <param name="fr_rf_ff" argument="--fr/--rf/--ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand"
+                       help="E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
+                    <option value="--fr" selected="True">--fr</option>
+                    <option value="--rf">--rf</option>
+                    <option value="--ff">--ff</option>
+                </param>
+                <param argument="--no-mixed" name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="By default, when `hisat2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default: False"/>
+                <param argument="--no-discordant" name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `hisat2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default: False"/>
             </when>
         </conditional>
-    </xml>
-    <xml name="paired_end_output">
-        <param name="unaligned_file" argument="--un-conc-gz" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" />
-        <param name="aligned_file" argument="--al-conc-gz" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" />
+
     </xml>
-    <token name="@paired_end_options@">
-        #if str( $input_format.paired.unaligned_file ) == "true":
-            #if $compressed == "GZ":
-                --un-conc-gz '${output_unaligned_reads_l}'
-            #else if $compressed == "BZ2":
-                --un-conc-bz2 '${output_unaligned_reads_l}'
-            #else:
-                --un-conc '${output_unaligned_reads_l}'
-            #end if
-        #end if
-        #if str( $input_format.paired.aligned_file ) == "true":
-            #if $compressed == "GZ":
-                --al-conc-gz '${output_aligned_reads_l}'
-            #else if $compressed == "BZ2"
-                --al-conc-bz2 '${output_aligned_reads_l}'
-            #else:
-                --al-conc '${output_aligned_reads_l}'
-            #end if
-        #end if
-        #if str($input_format.paired.paired_end_options.paired_end_options_selector) == 'advanced':
-            ${input_format.paired.paired_end_options.no_mixed}
-            ${input_format.paired.paired_end_options.no_discordant}
-        #end if
-    </token>
-    <token name="@strandedness_parameters@">
-        #if str($spliced_options.spliced_options_selector) == "advanced":
-            #if str($spliced_options.rna_strandness).strip() != '':
-                --rna-strandness $spliced_options.rna_strandness
-            #end if
-        #end if
-    </token>
-    <token name="@FASTQGZ_SETUP@">
-<![CDATA[
-        #set compressed="False"
-        #if str($input_format.paired.paired_selector) == 'paired':
-            #if str($input_format.paired.collection.collection_selector) == 'collection':
-                #if $input_format.paired.collection.reads.forward.is_of_type("fastq.gz", "fastqsanger.gz"):
-                    #set read1 = "input_f.fastq.gz"
-                    #set compressed = "GZ"
-                #else if $input_format.paired.collection.reads.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):
-                    #set read1 = "input_f.fastq.bz2"
-                    #set compressed = "BZ2"
-                #else:
-                    #set read1 = "input_f.fastq"
-                #end if
-                ln -f -s '${input_format.paired.collection.reads.forward}' ${read1} &&
-
-                #if $input_format.paired.collection.reads.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):
-                    #set read2 = "input_r.fastq.gz"
-                    #set compressed = "GZ"
-                #else if $input_format.paired.collection.reads.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):
-                    #set read2 = "input_r.fastq.bz2"
-                    #set compressed = "BZ2"
-                #else:
-                    #set read2 = "input_r.fastq"
-                #end if
-                ln -f -s '${input_format.paired.collection.reads.reverse}' ${read2} &&
-            #else:
-                #if $input_format.paired.collection.forward.is_of_type("fastq.gz", "fastqsanger.gz"):
-                    #set read1 = "input_f.fastq.gz"
-                    #set compressed = "GZ"
-                #else if $input_format.paired.collection.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):
-                    #set read1 = "input_f.fastq.bz2"
-                    #set compressed = "BZ2"
-                #else:
-                    #set read1 = "input_f.fastq"
-                #end if
-                ln -f -s '${input_format.paired.collection.forward}' ${read1} &&
-
-                #if $input_format.paired.collection.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):
-                    #set read2 = "input_r.fastq.gz"
-                    #set compressed = "GZ"
-                #else if $input_format.paired.collection.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):
-                    #set read2 = "input_r.fastq.bz2"
-                    #set compressed = "BZ2"
-                #else:
-                    #set read2 = "input_r.fastq"
-                #end if
-                ln -f -s '${input_format.paired.collection.reverse}' ${read2} &&
-            #end if
-        #else:
-            #if $input_format.paired.reads.is_of_type("fastq.gz", "fastqsanger.gz"):
-                #set read1 = "input_f.fastq.gz"
-                #set compressed = "GZ"
-            #else if $input_format.paired.reads.is_of_type("fastq.bz2", "fastqsanger.bz2"):
-                #set read1 = "input_f.fastq.bz2"
-                #set compressed = "BZ2"
-            #else:
-                #set read1 = "input_f.fastq"
-            #end if
-            ln -s '${input_format.paired.reads}' ${read1} &&
-        #end if
-]]>
-    </token>
-</macros>
+</macros>
\ No newline at end of file
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/hisat2_indexes.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cached_locally/hisat2_indexes.loc	Tue Sep 26 17:01:28 2017 -0400
@@ -0,0 +1,1 @@
+phiX	phiX	PhiX	${__HERE__}/phiX
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.1.ht2
Binary file test-data/cached_locally/phiX.1.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.2.ht2
Binary file test-data/cached_locally/phiX.2.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.3.ht2
Binary file test-data/cached_locally/phiX.3.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.4.ht2
Binary file test-data/cached_locally/phiX.4.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.5.ht2
Binary file test-data/cached_locally/phiX.5.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.6.ht2
Binary file test-data/cached_locally/phiX.6.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.7.ht2
Binary file test-data/cached_locally/phiX.7.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.8.ht2
Binary file test-data/cached_locally/phiX.8.ht2 has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cached_locally/phiX.fa	Tue Sep 26 17:01:28 2017 -0400
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output.summary
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hisat_output.summary	Tue Sep 26 17:01:28 2017 -0400
@@ -0,0 +1,6 @@
+HISAT2 summary stats:
+	Total reads: 10
+		Aligned 0 time: 0 (0.00%)
+		Aligned 1 time: 10 (100.00%)
+		Aligned >1 times: 0 (0.00%)
+	Overall alignment rate: 100.00%
diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_1.bam
Binary file test-data/hisat_output_1.bam has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_2.bam
Binary file test-data/hisat_output_2.bam has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_3.bam
Binary file test-data/hisat_output_3.bam has changed
diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_4.bam
Binary file test-data/hisat_output_4.bam has changed
diff -r 526b91fbde60 -r d5fe9aead222 tool_data_table_conf.xml.test
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Tue Sep 26 17:01:28 2017 -0400
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Locations of indexes in the HISAT mapper format -->
+    <table name="hisat2_indexes" comment_char="#" allow_duplicate_entries="False">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/cached_locally/hisat2_indexes.loc" />
+    </table>
+</tables>