annotate test-data/MADE1.out @ 5:b2453ee52845 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"

# hmmscan :: search sequence(s) against a profile database
# HMMER 3.3 (Nov 2019); http://hmmer.org/
# Copyright (C) 2019 Howard Hughes Medical Institute.
# Freely distributed under the BSD open source license.
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query sequence file:             /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
# target HMM database:             localref.hmm
# per-seq hits tabular output:     /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat
# per-dom hits tabular output:     /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat
# pfam-style tabular hit output:   /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat
# max ASCII text line length:      unlimited
# Vit filter P threshold:       <= 0.001
# Fwd filter P threshold:       <= 1e-05
# random number seed set to:       4
# number of worker threads:        1
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Query:       humanchr1/239220001-239550000  [L=330000]
Scores for complete sequence (score includes all domains):
   --- full sequence ---   --- best 1 domain ---    -#dom-
    E-value  score  bias    E-value  score  bias    exp  N  Model    Description
    ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
    9.3e-18   51.2  26.3    1.3e-12   34.8   0.7    8.6  4  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon


Domain annotation for each model (and alignments):
>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
   #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
 ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
   1 !   27.4   0.6   2.4e-10   2.4e-10       1      43 [.  174456  174498 ..  174456  174520 .. 0.93
   2 ?   -8.4   5.8         1         1      12      79 ..  197274  197341 ..  197272  197342 .. 0.86
   3 !   34.8   0.7   1.3e-12   1.3e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.87
   4 ?    1.4   0.4     0.033     0.033      27      74 ..  304060  304106 ..  304029  304108 .. 0.71

  Alignments for each domain:
  == domain 1  score: 27.4 bits;  conditional E-value: 2.4e-10
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
                                       79**************************************997 PP

  == domain 2  score: -8.4 bits;  conditional E-value: 1
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79    
                                       caa  gtaatt +  tttt  c att   ttt  t  c aaa  c c  tta tt t  ac  a cta
  humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341
                                       567789*******************999999999999*****99999999999988877777776666 PP

  == domain 3  score: 34.8 bits;  conditional E-value: 1.3e-12
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80    
                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a     a t ctttt caccaa ctaa
  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
                                       6799*****************************************99953333333345578**************997 PP

  == domain 4  score: 1.4 bits;  conditional E-value: 0.033
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74    
                                       tttt g c  ta  tt a tgg aaaaa + ca tta ttttgca  a
  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106
                                       334444443333.356788*************************9766 PP



Internal pipeline statistics summary:
-------------------------------------
Query sequence(s):                         1  (330000 residues searched)
Target model(s):                           1  (80 nodes)
Passed MSV filter:                         1  (1); expected 0.0 (0.02)
Passed bias filter:                        1  (1); expected 0.0 (0.02)
Passed Vit filter:                         1  (1); expected 0.0 (0.001)
Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
Initial search space (Z):                  1  [actual number of targets]
Domain search space  (domZ):               1  [number of targets reported over threshold]
# CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22
# Mc/sec: 117.29
//
[ok]