comparison test-data/nhmmer.out @ 4:ca0b674e895b draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author iuc
date Mon, 11 Jun 2018 15:51:03 -0400
parents 17a98a843911
children b2453ee52845
comparison
equal deleted inserted replaced
3:a9c62fc8187b 4:ca0b674e895b
1 # nhmmer :: search a DNA model or alignment against a DNA database 1 # nhmmer :: search a DNA model, alignment, or sequence against a DNA database
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ 2 # HMMER 3.2 (June 2018); http://hmmer.org/
3 # Copyright (C) 2015 Howard Hughes Medical Institute. 3 # Copyright (C) 2018 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3). 4 # Freely distributed under the BSD open source license.
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query file: /tmp/tmpprnvgs/files/000/dataset_1.dat 6 # query file: /tmp/tmpp4O0Ju/files/000/dataset_36.dat
7 # target sequence database: /tmp/tmpprnvgs/files/000/dataset_2.dat 7 # target sequence database: /tmp/tmpp4O0Ju/files/000/dataset_37.dat
8 # hits tabular output: /tmp/tmpprnvgs/files/000/dataset_4.dat 8 # hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_39.dat
9 # hits output in Dfam format: None 9 # hits output in Dfam format: None
10 # max ASCII text line length: unlimited 10 # max ASCII text line length: unlimited
11 # SSV filter P threshold: <= 0.02 11 # SSV filter P threshold: <= 0.02
12 # Vit filter P threshold: <= 0.001 12 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05 13 # Fwd filter P threshold: <= 1e-05
20 Accession: DF0000629.2 20 Accession: DF0000629.2
21 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 21 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
22 Scores for complete hits: 22 Scores for complete hits:
23 E-value score bias Sequence start end Description 23 E-value score bias Sequence start end Description
24 ------- ------ ----- -------- ----- ----- ----------- 24 ------- ------ ----- -------- ----- ----- -----------
25 1.2e-10 38.6 7.4 humanchr1/239220001-239550000 302390 302466 25 8.7e-11 39.2 7.4 humanchr1/239220001-239550000 302390 302466
26 7.8e-08 29.6 8.3 humanchr1/239220001-239550000 174456 174498 26 6.4e-08 30.0 8.3 humanchr1/239220001-239550000 174456 174498
27 1.2e-07 28.9 6.0 humanchr1/239220001-239550000 302466 302390 27 9.3e-08 29.5 6.1 humanchr1/239220001-239550000 302466 302390
28 7.2e-06 23.3 7.0 humanchr1/239220001-239550000 174493 174456 28 6.3e-06 23.7 7.0 humanchr1/239220001-239550000 174493 174456
29 ------ inclusion threshold ------ 29 ------ inclusion threshold ------
30 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104 30 1.4 6.5 7.0 humanchr1/239220001-239550000 304073 304104
31 31
32 32
33 Annotation for each hit (and alignments): 33 Annotation for each hit (and alignments):
34 >> humanchr1/239220001-239550000 34 >> humanchr1/239220001-239550000
35 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 35 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
36 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 36 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
37 ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 37 ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87
38 38
39 Alignment: 39 Alignment:
40 score: 38.6 bits 40 score: 39.2 bits
41 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 41 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
42 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 42 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
43 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa 43 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa
44 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 44 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466
45 899******************************************955533.443..334.4689***********99986 PP 45 899******************************************955533.443..33.44689************9986 PP
46 46
47 >> humanchr1/239220001-239550000 47 >> humanchr1/239220001-239550000
48 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 48 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
49 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 49 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
50 ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 50 ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92
51 51
52 Alignment: 52 Alignment:
53 score: 29.6 bits 53 score: 30.0 bits
54 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 54 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
55 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 55 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
56 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt 56 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
57 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 57 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
58 589************************************9975 PP 58 589************************************9975 PP
59 59
60 >> humanchr1/239220001-239550000 60 >> humanchr1/239220001-239550000
61 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 61 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
62 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 62 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
63 ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 63 ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74
64 64
65 Alignment: 65 Alignment:
66 score: 28.9 bits 66 score: 29.5 bits
67 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 67 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
68 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 68 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77
69 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc 69 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc
70 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 70 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
71 68999999999999998................5666777776222222222222222268****************************9998 PP 71 68999999999999998................4666777765222222222222222268****************************9998 PP
72 72
73 >> humanchr1/239220001-239550000 73 >> humanchr1/239220001-239550000
74 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 74 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
75 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 75 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
76 ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 76 ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91
77 77
78 Alignment: 78 Alignment:
79 score: 23.3 bits 79 score: 23.7 bits
80 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 80 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
81 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 81 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
82 taatg caaaaacc caattacttttgcac aacctaa 82 taatg caaaaacc caattacttttgcac aacctaa
83 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 83 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
84 689********************************985 PP 84 689********************************986 PP
85 85
86 >> humanchr1/239220001-239550000 86 >> humanchr1/239220001-239550000
87 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc 87 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
88 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 88 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
89 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 89 ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85
90 90
91 Alignment: 91 Alignment:
92 score: 6.3 bits 92 score: 6.5 bits
93 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 93 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
94 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 94 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72
95 tt a tgg aaaaa ca tta ttttgca 95 tt a tgg aaaaa ca tta ttttgca
96 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 96 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
97 455779************************86 PP 97 455779************************86 PP
98 98
99 99
100 100
101 Internal pipeline statistics summary: 101 Internal pipeline statistics summary:
102 ------------------------------------- 102 -------------------------------------
103 Query model(s): 1 (80 nodes) 103 Query model(s): 1 (80 nodes)
104 Target sequences: 1 (660000 residues searched) 104 Target sequences: 1 (660000 residues searched)
105 Residues passing SSV filter: 61794 (0.0936); expected (0.02) 105 Residues passing SSV filter: 63737 (0.0966); expected (0.02)
106 Residues passing bias filter: 46199 (0.07); expected (0.02) 106 Residues passing bias filter: 44695 (0.0677); expected (0.02)
107 Residues passing Vit filter: 2752 (0.00417); expected (0.001) 107 Residues passing Vit filter: 2309 (0.0035); expected (0.001)
108 Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) 108 Residues passing Fwd filter: 2041 (0.00309); expected (1e-05)
109 Total number of hits: 5 (0.000405) 109 Total number of hits: 5 (0.000405)
110 # CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03 110 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
111 # Mc/sec: 1760.00 111 # Mc/sec: 1854.66
112 // 112 //
113 [ok] 113 [ok]