Mercurial > repos > iuc > hmmer_hmmconvert
comparison test-data/MADE1.nhmmscan_out @ 5:8d5ec58d2172 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
author | iuc |
---|---|
date | Tue, 16 Jun 2020 05:37:52 -0400 (2020-06-16) |
parents | f92edeb5e4c4 |
children | db8a5a3195e7 |
comparison
equal
deleted
inserted
replaced
4:f92edeb5e4c4 | 5:8d5ec58d2172 |
---|---|
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database | 1 # nhmmscan :: search DNA sequence(s) against a DNA profile database |
2 # HMMER 3.2 (June 2018); http://hmmer.org/ | 2 # HMMER 3.3 (Nov 2019); http://hmmer.org/ |
3 # Copyright (C) 2018 Howard Hughes Medical Institute. | 3 # Copyright (C) 2019 Howard Hughes Medical Institute. |
4 # Freely distributed under the BSD open source license. | 4 # Freely distributed under the BSD open source license. |
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
6 # query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_41.dat | 6 # query sequence file: /tmp/tmpqydies2m/files/f/a/5/dataset_fa559c91-0436-48cb-a47d-20062d4af284.dat |
7 # target HMM database: localref.hmm | 7 # target HMM database: localref.hmm |
8 # per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_43.dat | 8 # per-seq hits tabular output: /tmp/tmpqydies2m/files/4/7/2/dataset_4723128d-8711-4edb-8afe-a68476a6c127.dat |
9 # hits output in Dfam format: /tmp/tmpp4O0Ju/files/000/dataset_44.dat | 9 # hits output in Dfam format: /tmp/tmpqydies2m/files/1/a/e/dataset_1aeea50b-1263-4750-8237-4fc3f10c0999.dat |
10 # max ASCII text line length: unlimited | 10 # max ASCII text line length: unlimited |
11 # Vit filter P threshold: <= 0.001 | 11 # Vit filter P threshold: <= 0.001 |
12 # Fwd filter P threshold: <= 1e-05 | 12 # Fwd filter P threshold: <= 1e-05 |
13 # random number seed set to: 4 | 13 # random number seed set to: 4 |
14 # number of worker threads: 1 | 14 # number of worker threads: 1 |
16 | 16 |
17 Query: humanchr1/239220001-239550000 [L=330000] | 17 Query: humanchr1/239220001-239550000 [L=330000] |
18 Scores for complete hit: | 18 Scores for complete hit: |
19 E-value score bias Model start end Description | 19 E-value score bias Model start end Description |
20 ------- ------ ----- -------- ----- ----- ----------- | 20 ------- ------ ----- -------- ----- ----- ----------- |
21 8.7e-11 39.2 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 21 4e-11 41.3 7.5 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
22 6.4e-08 30.0 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 22 1.9e-08 32.8 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
23 9.3e-08 29.5 6.1 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 23 6.3e-08 31.0 6.7 MADE1 302466 302389 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
24 6.3e-06 23.7 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 24 4.9e-06 25.0 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
25 ------ inclusion threshold ------ | 25 ------ inclusion threshold ------ |
26 1.4 6.5 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 26 2.2 6.9 7.2 MADE1 304073 304103 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
27 | 27 |
28 | 28 |
29 Annotation for each hit (and alignments): | 29 Annotation for each hit (and alignments): |
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
33 ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 | 33 ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.88 |
34 | 34 |
35 Alignment: | 35 Alignment: |
36 score: 39.2 bits | 36 score: 41.3 bits |
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 | 38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 |
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa | 39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa |
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466 | 40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466 |
41 899******************************************955533.443..33.44689************9986 PP | 41 89*******************************************966644554...34.4578**************997 PP |
42 | 42 |
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
46 ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 | 46 ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.91 |
47 | 47 |
48 Alignment: | 48 Alignment: |
49 score: 30.0 bits | 49 score: 32.8 bits |
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 | 51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 |
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt | 52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt |
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 | 53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 |
54 589************************************9975 PP | 54 589************************************9986 PP |
55 | 55 |
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
59 ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 | 59 ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 80 0.80 |
60 | 60 |
61 Alignment: | 61 Alignment: |
62 score: 29.5 bits | 62 score: 31.0 bits |
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 | 64 MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78 |
65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc | 65 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc |
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 | 66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389 |
67 68999999999999998................4666777765222222222222222268****************************9998 PP | 67 6899************97543.2...23333455566666666666799*****************************9985 PP |
68 | 68 |
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
72 ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 | 72 ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.94 |
73 | 73 |
74 Alignment: | 74 Alignment: |
75 score: 23.7 bits | 75 score: 25.0 bits |
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 | 77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 |
78 taatg caaaaacc caattacttttgcac aacctaa | 78 taatg caaaaacc caattacttttgcac aacctaa |
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 | 79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 |
80 689********************************986 PP | 80 5899*******************************986 PP |
81 | 81 |
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
85 ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 | 85 ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 80 0.85 |
86 | 86 |
87 Alignment: | 87 Alignment: |
88 score: 6.5 bits | 88 score: 6.9 bits |
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 | 90 MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71 |
91 tt a tgg aaaaa ca tta ttttgca | 91 tt a tgg aaaaa ca tta ttttgca |
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 | 92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103 |
93 455779************************86 PP | 93 456789************************8 PP |
94 | 94 |
95 | 95 |
96 | 96 |
97 Internal pipeline statistics summary: | 97 Internal pipeline statistics summary: |
98 ------------------------------------- | 98 ------------------------------------- |
99 Query sequence(s): 1 (660000 residues searched) | 99 Query sequence(s): 1 (660000 residues searched) |
100 Target model(s): 1 (80 nodes) | 100 Target model(s): 1 (80 nodes) |
101 Residues passing SSV filter: 63737 (0.0966); expected (0.02) | 101 Residues passing SSV filter: 60770 (0.0921); expected (0.02) |
102 Residues passing bias filter: 44695 (0.0677); expected (0.02) | 102 Residues passing bias filter: 35792 (0.0542); expected (0.02) |
103 Residues passing Vit filter: 2309 (0.0035); expected (0.001) | 103 Residues passing Vit filter: 1612 (0.00244); expected (0.001) |
104 Residues passing Fwd filter: 2041 (0.00309); expected (1e-05) | 104 Residues passing Fwd filter: 1194 (0.00181); expected (1e-05) |
105 Total number of hits: 5 (0.000405) | 105 Total number of hits: 5 (0.000405) |
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 | 106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 |
107 # Mc/sec: 2407.09 | 107 # Mc/sec: 2289.06 |
108 // | 108 // |
109 [ok] | 109 [ok] |