Mercurial > repos > iuc > hmmer_hmmconvert
view test-data/nhmmer.out @ 7:db8a5a3195e7 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author | iuc |
---|---|
date | Wed, 21 Jul 2021 14:13:43 +0000 |
parents | 8d5ec58d2172 |
children |
line wrap: on
line source
# nhmmer :: search a DNA model, alignment, or sequence against a DNA database # HMMER 3.3.2 (Nov 2020); http://hmmer.org/ # Copyright (C) 2020 Howard Hughes Medical Institute. # Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - # query file: /tmp/tmpzdnl83p_/files/9/7/3/dataset_973ac44a-c86b-42ed-b8fe-f747795642c7.dat # target sequence database: /tmp/tmpzdnl83p_/files/6/5/6/dataset_65678542-5e91-4d72-9409-b7213a529ca0.dat # max ASCII text line length: unlimited # SSV filter P threshold: <= 0.02 # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # input query is asserted as: DNA # random number seed set to: 4 # number of worker threads: 0 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: MADE1 [M=80] Accession: DF0000629.2 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- 4e-11 41.3 7.5 humanchr1/239220001-239550000 302390 302466 1.9e-08 32.8 8.3 humanchr1/239220001-239550000 174456 174498 6.3e-08 31.0 6.7 humanchr1/239220001-239550000 302466 302389 4.9e-06 25.0 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ 2.2 6.9 7.2 humanchr1/239220001-239550000 304073 304103 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.88 Alignment: score: 41.3 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466 89*******************************************966644554...34.4578**************997 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.91 Alignment: score: 32.8 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 589************************************9986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 330000 0.80 Alignment: score: 31.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389 6899************97543.2...23333455566666666666799*****************************9985 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.94 Alignment: score: 25.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 5899*******************************986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 330000 0.85 Alignment: score: 6.9 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71 tt a tgg aaaaa ca tta ttttgca humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103 456789************************8 PP Internal pipeline statistics summary: ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) Residues passing SSV filter: 60770 (0.0921); expected (0.02) Residues passing bias filter: 35792 (0.0542); expected (0.02) Residues passing Vit filter: 1612 (0.00244); expected (0.001) Residues passing Fwd filter: 1194 (0.00181); expected (1e-05) Total number of hits: 5 (0.000405) # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 # Mc/sec: 2197.54 // [ok]