Mercurial > repos > iuc > hmmer_hmmemit
diff test-data/MADE1.nhmmscan_out @ 3:7b7ff4d209f7 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
| author | iuc |
|---|---|
| date | Sat, 07 Apr 2018 03:50:15 -0400 |
| parents | |
| children | 1cd4d0cf8fd9 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out Sat Apr 07 03:50:15 2018 -0400 @@ -0,0 +1,109 @@ +# nhmmscan :: search DNA sequence(s) against a DNA profile database +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. +# Freely distributed under the GNU General Public License (GPLv3). +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +# query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat +# hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat +# max ASCII text line length: unlimited +# Vit filter P threshold: <= 0.001 +# Fwd filter P threshold: <= 1e-05 +# random number seed set to: 4 +# number of worker threads: 1 +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + +Query: humanchr1/239220001-239550000 [L=330000] +Scores for complete hit: + E-value score bias Model start end Description + ------- ------ ----- -------- ----- ----- ----------- + 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + ------ inclusion threshold ------ + 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + + +Annotation for each hit (and alignments): +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 + + Alignment: + score: 38.6 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 + ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 + 899******************************************955533.443..334.4689***********99986 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 + + Alignment: + score: 29.6 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 + ttaggtt gtgcaaaagtaattg ggtttttg cattactttt + humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 + 589************************************9975 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 + + Alignment: + score: 28.9 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 + ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc + humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 + 68999999999999998................5666777776222222222222222268****************************9998 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 + + Alignment: + score: 23.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 + taatg caaaaacc caattacttttgcac aacctaa + humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 + 689********************************985 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 + + Alignment: + score: 6.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 + tt a tgg aaaaa ca tta ttttgca + humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 + 455779************************86 PP + + + +Internal pipeline statistics summary: +------------------------------------- +Query sequence(s): 1 (660000 residues searched) +Target model(s): 1 (80 nodes) +Residues passing SSV filter: 61794 (0.0936); expected (0.02) +Residues passing bias filter: 46199 (0.07); expected (0.02) +Residues passing Vit filter: 2752 (0.00417); expected (0.001) +Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) +Total number of hits: 5 (0.000405) +# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 +# Mc/sec: 2640.00 +// +[ok]