Mercurial > repos > iuc > hmmer_hmmemit
diff test-data/MADE1.out @ 0:f48f9bbfcfd8 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
author | iuc |
---|---|
date | Sat, 25 Jun 2016 15:05:37 -0400 |
parents | |
children | 1cd4d0cf8fd9 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.out Sat Jun 25 15:05:37 2016 -0400 @@ -0,0 +1,87 @@ +# hmmscan :: search sequence(s) against a profile database +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. +# Freely distributed under the GNU General Public License (GPLv3). +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +# query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat +# target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat +# per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat +# per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat +# pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat +# max ASCII text line length: unlimited +# Vit filter P threshold: <= 0.001 +# Fwd filter P threshold: <= 1e-05 +# random number seed set to: 4 +# number of worker threads: 1 +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + +Query: humanchr1/239220001-239550000 [L=330000] +Scores for complete sequence (score includes all domains): + --- full sequence --- --- best 1 domain --- -#dom- + E-value score bias E-value score bias exp N Model Description + ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- + 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + + +Domain annotation for each model (and alignments): +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc + --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- + 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 + 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 + 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 + 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 + 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 + + Alignments for each domain: + == domain 1 score: -4.2 bits; conditional E-value: 1 + xxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 30 ttgccattacttttaatggcaaaaa 54 + t g catt ttt aatggcaaa a + humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 + 45789****************9966 PP + + == domain 2 score: -6.6 bits; conditional E-value: 1 + xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 + aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca + humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 + 78999999999999999999999984444444457777777899998876....77777888876 PP + + == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 + ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a + humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 + 79***************************************964443333333333330 PP + + == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 + t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 + 56899******************************************963333233345578**************996 PP + + == domain 5 score: 2.9 bits; conditional E-value: 0.011 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 + tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa + humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 + 222222222222.3455779************************98765 PP + + + +Internal pipeline statistics summary: +------------------------------------- +Query sequence(s): 1 (330000 residues searched) +Target model(s): 1 (80 nodes) +Passed MSV filter: 1 (1); expected 0.0 (0.02) +Passed bias filter: 1 (1); expected 0.0 (0.02) +Passed Vit filter: 1 (1); expected 0.0 (0.001) +Passed Fwd filter: 1 (1); expected 0.0 (1e-05) +Initial search space (Z): 1 [actual number of targets] +Domain search space (domZ): 1 [number of targets reported over threshold] +# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 +# Mc/sec: 165.00 +// +[ok]