diff test-data/MADE1.nhmmscan_out @ 4:01219a31c48e draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author iuc
date Mon, 11 Jun 2018 15:52:41 -0400
parents 1a83249ddfff
children be7097d6e3ff
line wrap: on
line diff
--- a/test-data/MADE1.nhmmscan_out	Sat Apr 07 03:51:55 2018 -0400
+++ b/test-data/MADE1.nhmmscan_out	Mon Jun 11 15:52:41 2018 -0400
@@ -1,12 +1,12 @@
 # nhmmscan :: search DNA sequence(s) against a DNA profile database
-# HMMER 3.1b2 (February 2015); http://hmmer.org/
-# Copyright (C) 2015 Howard Hughes Medical Institute.
-# Freely distributed under the GNU General Public License (GPLv3).
+# HMMER 3.2 (June 2018); http://hmmer.org/
+# Copyright (C) 2018 Howard Hughes Medical Institute.
+# Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpc_c3amjg/files/000/dataset_2.dat
-# target HMM database:             /tmp/tmpc_c3amjg/files/000/dataset_1.dat
-# per-seq hits tabular output:     /tmp/tmpc_c3amjg/files/000/dataset_4.dat
-# hits output in Dfam format:      /tmp/tmpc_c3amjg/files/000/dataset_5.dat
+# query sequence file:             /tmp/tmpp4O0Ju/files/000/dataset_41.dat
+# target HMM database:             localref.hmm
+# per-seq hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_43.dat
+# hits output in Dfam format:      /tmp/tmpp4O0Ju/files/000/dataset_44.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
@@ -18,35 +18,35 @@
 Scores for complete hit:
     E-value  score  bias  Model     start    end  Description
     ------- ------ -----  --------  -----  -----  -----------
-    1.2e-10   38.6   7.4  MADE1    302390 302466  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-    7.8e-08   29.6   8.3  MADE1    174456 174498  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-    1.2e-07   28.9   6.0  MADE1    302466 302390  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-    7.2e-06   23.3   7.0  MADE1    174493 174456  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    8.7e-11   39.2   7.4  MADE1    302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    6.4e-08   30.0   8.3  MADE1    174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    9.3e-08   29.5   6.1  MADE1    302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    6.3e-06   23.7   7.0  MADE1    174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
   ------ inclusion threshold ------
-        1.4    6.3   7.0  MADE1    304073 304104  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+        1.4    6.5   7.0  MADE1    304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
 
 
 Annotation for each hit  (and alignments):
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   38.6   7.4   1.2e-10         4        80 .]    302390    302466 ..    302387    302466 ..        80    0.87
+ !   39.2   7.4   8.7e-11         4        80 .]    302390    302466 ..    302387    302466 ..        80    0.87
 
   Alignment:
-  score: 38.6 bits
+  score: 39.2 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
-                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g a  t ctttt caccaa ctaa
-  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
-                                       899******************************************955533.443..334.4689***********99986 PP
+                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g  a t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466
+                                       899******************************************955533.443..33.44689************9986 PP
 
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   29.6   8.3   7.8e-08         1        43 [.    174456    174498 ..    174456    174518 ..        80    0.92
+ !   30.0   8.3   6.4e-08         1        43 [.    174456    174498 ..    174456    174518 ..        80    0.92
 
   Alignment:
-  score: 29.6 bits
+  score: 30.0 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
                                        ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
@@ -56,36 +56,36 @@
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   28.9   6.0   1.2e-07         1        77 [.    302466    302390 ..    302466    302387 ..        80    0.74
+ !   29.5   6.1   9.3e-08         1        77 [.    302466    302390 ..    302466    302387 ..        80    0.74
 
   Alignment:
-  score: 28.9 bits
+  score: 29.5 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77    
                                        ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
   humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
-                                       68999999999999998................5666777776222222222222222268****************************9998 PP
+                                       68999999999999998................4666777765222222222222222268****************************9998 PP
 
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   23.3   7.0   7.2e-06        43        80 .]    174493    174456 ..    174513    174456 ..        80    0.91
+ !   23.7   7.0   6.3e-06        43        80 .]    174493    174456 ..    174513    174456 ..        80    0.91
 
   Alignment:
-  score: 23.3 bits
+  score: 23.7 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
                                        taatg caaaaacc caattacttttgcac aacctaa
   humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
-                                       689********************************985 PP
+                                       689********************************986 PP
 
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to      mod len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- ?    6.3   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..        80    0.85
+ ?    6.5   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..        80    0.85
 
   Alignment:
-  score: 6.3 bits
+  score: 6.5 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72    
                                        tt a tgg aaaaa   ca tta ttttgca 
@@ -98,12 +98,12 @@
 -------------------------------------
 Query sequence(s):                         1  (660000 residues searched)
 Target model(s):                           1  (80 nodes)
-Residues passing SSV filter:             61794  (0.0936); expected (0.02)
-Residues passing bias filter:            46199  (0.07); expected (0.02)
-Residues passing Vit filter:              2752  (0.00417); expected (0.001)
-Residues passing Fwd filter:              2526  (0.00383); expected (1e-05)
-Total number of hits:                        5  (0.000405)
+Residues passing SSV filter:           63737  (0.0966); expected (0.02)
+Residues passing bias filter:          44695  (0.0677); expected (0.02)
+Residues passing Vit filter:            2309  (0.0035); expected (0.001)
+Residues passing Fwd filter:            2041  (0.00309); expected (1e-05)
+Total number of hits:                      5  (0.000405)
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 2640.00
+# Mc/sec: 2407.09
 //
 [ok]