annotate test-data/nhmmer.out @ 1:4e0cbf379bab draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 2c4b4a154e2f07730fdfdaf66a09e1e09ac5efde

# nhmmer :: search a DNA model or alignment against a DNA database
# HMMER 3.1b2 (February 2015); http://hmmer.org/
# Copyright (C) 2015 Howard Hughes Medical Institute.
# Freely distributed under the GNU General Public License (GPLv3).
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query file:                      /tmp/tmpprnvgs/files/000/dataset_1.dat
# target sequence database:        /tmp/tmpprnvgs/files/000/dataset_2.dat
# hits tabular output:             /tmp/tmpprnvgs/files/000/dataset_4.dat
# hits output in Dfam format:      None
# max ASCII text line length:      unlimited
# SSV filter P threshold:       <= 0.02
# Vit filter P threshold:       <= 0.001
# Fwd filter P threshold:       <= 1e-05
# input query is asserted as:      DNA
# random number seed set to:       4
# number of worker threads:        1
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Query:       MADE1  [M=80]
Accession:   DF0000629.2
Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
Scores for complete hits:
    E-value  score  bias  Sequence                       start    end  Description
    ------- ------ -----  --------                       -----  -----  -----------
    1.2e-10   38.6   7.4  humanchr1/239220001-239550000 302390 302466  
    7.8e-08   29.6   8.3  humanchr1/239220001-239550000 174456 174498  
    1.2e-07   28.9   6.0  humanchr1/239220001-239550000 302466 302390  
    7.2e-06   23.3   7.0  humanchr1/239220001-239550000 174493 174456  
  ------ inclusion threshold ------
        1.4    6.3   7.0  humanchr1/239220001-239550000 304073 304104  


Annotation for each hit  (and alignments):
>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   38.6   7.4   1.2e-10         4        80 .]    302390    302466 ..    302387    302466 ..    330000    0.87

  Alignment:
  score: 38.6 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g a  t ctttt caccaa ctaa
  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
                                       899******************************************955533.443..334.4689***********99986 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   29.6   8.3   7.8e-08         1        43 [.    174456    174498 ..    174456    174518 ..    330000    0.92

  Alignment:
  score: 29.6 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
                                       ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
                                       589************************************9975 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   28.9   6.0   1.2e-07         1        77 [.    302466    302390 ..    302466    302387 ..    330000    0.74

  Alignment:
  score: 28.9 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77    
                                       ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
                                       68999999999999998................5666777776222222222222222268****************************9998 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   23.3   7.0   7.2e-06        43        80 .]    174493    174456 ..    174513    174456 ..    330000    0.91

  Alignment:
  score: 23.3 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
                                       taatg caaaaacc caattacttttgcac aacctaa
  humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
                                       689********************************985 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 ?    6.3   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..    330000    0.85

  Alignment:
  score: 6.3 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72    
                                       tt a tgg aaaaa   ca tta ttttgca 
  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
                                       455779************************86 PP



Internal pipeline statistics summary:
-------------------------------------
Query model(s):                              1  (80 nodes)
Target sequences:                            1  (660000 residues searched)
Residues passing SSV filter:             61794  (0.0936); expected (0.02)
Residues passing bias filter:            46199  (0.07); expected (0.02)
Residues passing Vit filter:              2752  (0.00417); expected (0.001)
Residues passing Fwd filter:              2526  (0.00383); expected (1e-05)
Total number of hits:                        5  (0.000405)
# CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03
# Mc/sec: 1760.00
//
[ok]