Mercurial > repos > iuc > hmmer_jackhmmer

comparison test-data/MADE1.nhmmscan_out @ 3:036df14999e8 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
author iuc
date Sat, 07 Apr 2018 03:48:57 -0400
parents
children 793967b6ae8a
comparison
equal deleted inserted replaced
2:d4fda6672a64 3:036df14999e8
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/
3 # Copyright (C) 2015 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3).
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat
7 # target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat
8 # per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat
9 # hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat
10 # max ASCII text line length: unlimited
11 # Vit filter P threshold: <= 0.001
12 # Fwd filter P threshold: <= 1e-05
13 # random number seed set to: 4
14 # number of worker threads: 1
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
16
17 Query: humanchr1/239220001-239550000 [L=330000]
18 Scores for complete hit:
19 E-value score bias Model start end Description
20 ------- ------ ----- -------- ----- ----- -----------
21 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
22 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
23 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
24 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
25 ------ inclusion threshold ------
26 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
27
28
29 Annotation for each hit (and alignments):
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
33 ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87
34
35 Alignment:
36 score: 38.6 bits
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
41 899******************************************955533.443..334.4689***********99986 PP
42
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
46 ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92
47
48 Alignment:
49 score: 29.6 bits
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
54 589************************************9975 PP
55
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
59 ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74
60
61 Alignment:
62 score: 28.9 bits
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77
65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
67 68999999999999998................5666777776222222222222222268****************************9998 PP
68
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
72 ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91
73
74 Alignment:
75 score: 23.3 bits
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
78 taatg caaaaacc caattacttttgcac aacctaa
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
80 689********************************985 PP
81
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
85 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85
86
87 Alignment:
88 score: 6.3 bits
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72
91 tt a tgg aaaaa ca tta ttttgca
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
93 455779************************86 PP
94
95
96
97 Internal pipeline statistics summary:
98 -------------------------------------
99 Query sequence(s): 1 (660000 residues searched)
100 Target model(s): 1 (80 nodes)
101 Residues passing SSV filter: 61794 (0.0936); expected (0.02)
102 Residues passing bias filter: 46199 (0.07); expected (0.02)
103 Residues passing Vit filter: 2752 (0.00417); expected (0.001)
104 Residues passing Fwd filter: 2526 (0.00383); expected (1e-05)
105 Total number of hits: 5 (0.000405)
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
107 # Mc/sec: 2640.00
108 //
109 [ok]