view test-data/MADE1.out @ 1:4e0cbf379bab draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 2c4b4a154e2f07730fdfdaf66a09e1e09ac5efde

# hmmscan :: search sequence(s) against a profile database
# HMMER 3.1b2 (February 2015); http://hmmer.org/
# Copyright (C) 2015 Howard Hughes Medical Institute.
# Freely distributed under the GNU General Public License (GPLv3).
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query sequence file:             /tmp/tmpYWzicI/files/000/dataset_20.dat
# target HMM database:             /tmp/tmpYWzicI/files/000/dataset_19.dat
# per-seq hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_22.dat
# per-dom hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_23.dat
# pfam-style tabular hit output:   /tmp/tmpYWzicI/files/000/dataset_24.dat
# max ASCII text line length:      unlimited
# Vit filter P threshold:       <= 0.001
# Fwd filter P threshold:       <= 1e-05
# random number seed set to:       4
# number of worker threads:        1
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Query:       humanchr1/239220001-239550000  [L=330000]
Scores for complete sequence (score includes all domains):
   --- full sequence ---   --- best 1 domain ---    -#dom-
    E-value  score  bias    E-value  score  bias    exp  N  Model    Description
    ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
      1e-17   51.0  28.5    2.7e-12   33.7   0.7    9.6  5  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon


Domain annotation for each model (and alignments):
>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
   #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
 ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
   1 ?   -4.2   0.1         1         1      30      54 ..   80044   80068 ..   80030   80073 .. 0.80
   2 ?   -6.6   3.3         1         1      13      71 ..  154012  154072 ..  154011  154076 .. 0.75
   3 !   27.4   0.7   2.4e-10   2.4e-10       1      44 [.  174456  174514 ..  174456  174577 .. 0.62
   4 !   33.7   0.7   2.7e-12   2.7e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.86
   5 ?    2.9   0.7     0.011     0.011      27      75 ..  304060  304107 ..  304021  304109 .. 0.61

  Alignments for each domain:
  == domain 1  score: -4.2 bits;  conditional E-value: 1
                                      xxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1    30 ttgccattacttttaatggcaaaaa 54
                                      t g catt  ttt aatggcaaa a
  humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
                                      45789****************9966 PP

  == domain 2  score: -6.6 bits;  conditional E-value: 1
                                       xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
                                       aaaagta tt +   ttttgc att      a  tttaa  gcaaa a +    tta  tttgca
  humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
                                       78999999999999999999999984444444457777777899998876....77777888876 PP

  == domain 3  score: 27.4 bits;  conditional E-value: 2.4e-10
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF
                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44
                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt               a
  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514
                                       79***************************************964443333333333330 PP

  == domain 4  score: 33.7 bits;  conditional E-value: 2.7e-12
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a  +  a t ctttt caccaa ctaa
  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
                                       56899******************************************963333233345578**************996 PP

  == domain 5  score: 2.9 bits;  conditional E-value: 0.011
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75
                                       tttt g c  ta  tt a tgg aaaaa ++ca tta ttttgca  aa
  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
                                       222222222222.3455779************************98765 PP



Internal pipeline statistics summary:
-------------------------------------
Query sequence(s):                         1  (330000 residues searched)
Target model(s):                           1  (80 nodes)
Passed MSV filter:                         1  (1); expected 0.0 (0.02)
Passed bias filter:                        1  (1); expected 0.0 (0.02)
Passed Vit filter:                         1  (1); expected 0.0 (0.001)
Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
Initial search space (Z):                  1  [actual number of targets]
Domain search space  (domZ):               1  [number of targets reported over threshold]
# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16
# Mc/sec: 165.00
//
[ok]