changeset 7:6e27bb3f0fa6 draft default tip

"planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:16:41 +0000
parents d9ce554da9b4
files jackhmmer.xml macros.xml test-data/MADE1.hmm test-data/MADE1.nhmmscan_out test-data/MADE1.nhmmscan_out.tblout test-data/MADE1.out test-data/MADE1.out.domtblout test-data/MADE1.out.pfamtblout test-data/MADE1.out.tblout test-data/dna_target2.fa test-data/fn3.hmm test-data/globins.domtblout test-data/globins.pfamtblout test-data/globins.tblout test-data/globins4-emit-1.sto test-data/globins4-emit.sto test-data/globins4.hmm test-data/globins4.hmm2 test-data/jackhmmer.domtblout test-data/jackhmmer.out test-data/jackhmmer.tblout test-data/nhmmer.out test-data/nhmmer.out.tblout test-data/phmmer.domtblout test-data/phmmer.out test-data/phmmer.pfamtblout test-data/phmmer.tblout test-data/uniprot_globins_match.out
diffstat 28 files changed, 1248 insertions(+), 298 deletions(-) [+]
line wrap: on
line diff
--- a/jackhmmer.xml	Thu Jan 14 15:38:47 2021 +0000
+++ b/jackhmmer.xml	Wed Jul 21 14:16:41 2021 +0000
@@ -1,5 +1,5 @@
 <?xml version="1.0"?>
-<tool id="hmmer_jackhmmer" name="jackhmmer" version="@TOOL_VERSION@+galaxy1">
+<tool id="hmmer_jackhmmer" name="jackhmmer" version="@TOOL_VERSION@+galaxy0">
   <description>iteratively search a protein sequence against a protein database (PSIBLAST-like)</description>
--- a/macros.xml	Thu Jan 14 15:38:47 2021 +0000
+++ b/macros.xml	Wed Jul 21 14:16:41 2021 +0000
@@ -6,7 +6,7 @@
-  <token name="@TOOL_VERSION@">3.3</token>
+  <token name="@TOOL_VERSION@">3.3.2</token>
   <xml name="stdio">
       <!-- Anything other than zero is an error -->
--- a/test-data/MADE1.hmm	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.hmm	Wed Jul 21 14:16:41 2021 +0000
@@ -1,4 +1,4 @@
-HMMER3/f [3.3 | Nov 2019]
+HMMER3/f [3.3.2 | Nov 2020]
 ACC   DF0000629.2
 DESC  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
@@ -10,7 +10,7 @@
 CONS  yes
 CS    no
 MAP   yes
-DATE  Thu May 14 18:28:16 2020
+DATE  Fri Jul 16 10:31:17 2021
 NSEQ  1997
 EFFN  4.772646
 CKSUM 3015610723
--- a/test-data/MADE1.nhmmscan_out	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.nhmmscan_out	Wed Jul 21 14:16:41 2021 +0000
@@ -1,17 +1,17 @@
 # nhmmscan :: search DNA sequence(s) against a DNA profile database
-# HMMER 3.3 (Nov 2019);
-# Copyright (C) 2019 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020);
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpqydies2m/files/f/a/5/dataset_fa559c91-0436-48cb-a47d-20062d4af284.dat
+# query sequence file:             /tmp/tmp2vk0_a8v/files/7/d/6/dataset_7d62e9c6-1db3-4a28-9770-d56c56ccfb17.dat
 # target HMM database:             localref.hmm
-# per-seq hits tabular output:     /tmp/tmpqydies2m/files/4/7/2/dataset_4723128d-8711-4edb-8afe-a68476a6c127.dat
-# hits output in Dfam format:      /tmp/tmpqydies2m/files/1/a/e/dataset_1aeea50b-1263-4750-8237-4fc3f10c0999.dat
+# per-seq hits tabular output:     /tmp/tmp2vk0_a8v/files/7/0/4/dataset_70487df9-4948-42c0-a250-638bcc64487a.dat
+# hits output in Dfam format:      /tmp/tmp2vk0_a8v/files/8/0/f/dataset_80fdcb47-0041-4a2c-bc0a-4820ac3c27d0.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
 Query:       humanchr1/239220001-239550000  [L=330000]
@@ -103,7 +103,7 @@
 Residues passing Vit filter:            1612  (0.00244); expected (0.001)
 Residues passing Fwd filter:            1194  (0.00181); expected (1e-05)
 Total number of hits:                      5  (0.000405)
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 2289.06
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2765.21
--- a/test-data/MADE1.nhmmscan_out.tblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.nhmmscan_out.tblout	Wed Jul 21 14:16:41 2021 +0000
@@ -6,12 +6,12 @@
 MADE1                DF0000629.2 humanchr1/239220001-239550000 -               43      80  174493  174456  174513  174456      80    -     4.9e-06   25.0   7.0  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
 MADE1                DF0000629.2 humanchr1/239220001-239550000 -               41      71  304073  304103  304053  304109      80    +         2.2    6.9   7.2  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-# Program:         hmmscan
-# Version:         3.3 (Nov 2019)
+# Program:         nhmmscan
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SCAN
-# Query file:      /tmp/tmpqydies2m/files/f/a/5/dataset_fa559c91-0436-48cb-a47d-20062d4af284.dat
+# Query file:      /tmp/tmp2vk0_a8v/files/7/d/6/dataset_7d62e9c6-1db3-4a28-9770-d56c56ccfb17.dat
 # Target file:     localref.hmm
-# Option settings: nhmmscan --tblout /tmp/tmpqydies2m/files/4/7/2/dataset_4723128d-8711-4edb-8afe-a68476a6c127.dat --dfamtblout /tmp/tmpqydies2m/files/1/a/e/dataset_1aeea50b-1263-4750-8237-4fc3f10c0999.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 localref.hmm /tmp/tmpqydies2m/files/f/a/5/dataset_fa559c91-0436-48cb-a47d-20062d4af284.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/20/working
-# Date:            Thu May 14 18:55:28 2020
+# Option settings: nhmmscan --tblout /tmp/tmp2vk0_a8v/files/7/0/4/dataset_70487df9-4948-42c0-a250-638bcc64487a.dat --dfamtblout /tmp/tmp2vk0_a8v/files/8/0/f/dataset_80fdcb47-0041-4a2c-bc0a-4820ac3c27d0.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 0 localref.hmm /tmp/tmp2vk0_a8v/files/7/d/6/dataset_7d62e9c6-1db3-4a28-9770-d56c56ccfb17.dat 
+# Current dir:     /tmp/tmp2vk0_a8v/job_working_directory/000/6/working
+# Date:            Fri Jul 16 11:22:43 2021
 # [ok]
--- a/test-data/MADE1.out	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.out	Wed Jul 21 14:16:41 2021 +0000
@@ -1,79 +1,45 @@
 # hmmscan :: search sequence(s) against a profile database
-# HMMER 3.3 (Nov 2019);
-# Copyright (C) 2019 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020);
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
+# query sequence file:             /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat
 # target HMM database:             localref.hmm
-# per-seq hits tabular output:     /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat
-# per-dom hits tabular output:     /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat
-# pfam-style tabular hit output:   /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat
+# per-seq hits tabular output:     /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat
+# per-dom hits tabular output:     /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat
+# pfam-style tabular hit output:   /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-Query:       humanchr1/239220001-239550000  [L=330000]
+Query:       humanchr1/239220001-239550000  [L=59940]
 Scores for complete sequence (score includes all domains):
    --- full sequence ---   --- best 1 domain ---    -#dom-
     E-value  score  bias    E-value  score  bias    exp  N  Model    Description
     ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
-    9.3e-18   51.2  26.3    1.3e-12   34.8   0.7    8.6  4  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+   [No hits detected that satisfy reporting thresholds]
 Domain annotation for each model (and alignments):
->> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-   #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
- ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
-   1 !   27.4   0.6   2.4e-10   2.4e-10       1      43 [.  174456  174498 ..  174456  174520 .. 0.93
-   2 ?   -8.4   5.8         1         1      12      79 ..  197274  197341 ..  197272  197342 .. 0.86
-   3 !   34.8   0.7   1.3e-12   1.3e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.87
-   4 ?    1.4   0.4     0.033     0.033      27      74 ..  304060  304106 ..  304029  304108 .. 0.71
-  Alignments for each domain:
-  == domain 1  score: 27.4 bits;  conditional E-value: 2.4e-10
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
-                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
-  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
-                                       79**************************************997 PP
-  == domain 2  score: -8.4 bits;  conditional E-value: 1
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79    
-                                       caa  gtaatt +  tttt  c att   ttt  t  c aaa  c c  tta tt t  ac  a cta
-                                       567789*******************999999999999*****99999999999988877777776666 PP
-  == domain 3  score: 34.8 bits;  conditional E-value: 1.3e-12
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80    
-                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a     a t ctttt caccaa ctaa
-                                       6799*****************************************99953333333345578**************997 PP
-  == domain 4  score: 1.4 bits;  conditional E-value: 0.033
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74    
-                                       tttt g c  ta  tt a tgg aaaaa + ca tta ttttgca  a
-  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106
-                                       334444443333.356788*************************9766 PP
+   [No targets detected that satisfy reporting thresholds]
 Internal pipeline statistics summary:
-Query sequence(s):                         1  (330000 residues searched)
+Query sequence(s):                         1  (59940 residues searched)
 Target model(s):                           1  (80 nodes)
-Passed MSV filter:                         1  (1); expected 0.0 (0.02)
-Passed bias filter:                        1  (1); expected 0.0 (0.02)
-Passed Vit filter:                         1  (1); expected 0.0 (0.001)
-Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
+Passed MSV filter:                         0  (0); expected 0.0 (0.02)
+Passed bias filter:                        0  (0); expected 0.0 (0.02)
+Passed Vit filter:                         0  (0); expected 0.0 (0.001)
+Passed Fwd filter:                         0  (0); expected 0.0 (1e-05)
 Initial search space (Z):                  1  [actual number of targets]
-Domain search space  (domZ):               1  [number of targets reported over threshold]
-# CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22
-# Mc/sec: 117.29
+Domain search space  (domZ):               0  [number of targets reported over threshold]
+# CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00
+# Mc/sec: 7920.43
--- a/test-data/MADE1.out.domtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.out.domtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -1,17 +1,13 @@
-#                                                                                      --- full sequence --- -------------- this domain -------------   hmm coord   ali coord   env coord
-# target name        accession    tlen query name                    accession   qlen   E-value  score  bias   #  of  c-Evalue  i-Evalue  score  bias  from    to  from    to  from    to  acc description of target
-#-------------------  ---------- -----          -------------------- ---------- ----- --------- ------ ----- --- --- --------- --------- ------ ----- ----- ----- ----- ----- ----- ----- ---- ---------------------
-MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000   9.3e-18   51.2  26.3   1   4   2.4e-10   2.4e-10   27.4   0.6     1    43 174456 174498 174456 174520 0.93 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000   9.3e-18   51.2  26.3   2   4         1         1   -8.4   5.8    12    79 197274 197341 197272 197342 0.86 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000   9.3e-18   51.2  26.3   3   4   1.3e-12   1.3e-12   34.8   0.7     2    80 302388 302466 302387 302466 0.87 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000   9.3e-18   51.2  26.3   4   4     0.033     0.033    1.4   0.4    27    74 304060 304106 304029 304108 0.71 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+#                                                                                     --- full sequence --- -------------- this domain -------------   hmm coord   ali coord   env coord
+# target name        accession   tlen query name                    accession   qlen   E-value  score  bias   #  of  c-Evalue  i-Evalue  score  bias  from    to  from    to  from    to  acc description of target
+#------------------- ---------- -----          -------------------- ---------- ----- --------- ------ ----- --- --- --------- --------- ------ ----- ----- ----- ----- ----- ----- ----- ---- ---------------------
 # Program:         hmmscan
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SCAN
-# Query file:      /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
+# Query file:      /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat
 # Target file:     localref.hmm
-# Option settings: hmmscan --tblout /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat --domtblout /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat --pfamtblout /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 localref.hmm /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/8/working
-# Date:            Thu May 14 18:53:22 2020
+# Option settings: hmmscan --tblout /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat --domtblout /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat --pfamtblout /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 0 localref.hmm /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat 
+# Current dir:     /tmp/tmpgjabmh94/job_working_directory/000/3/working
+# Date:            Fri Jul 16 11:01:18 2021
 # [ok]
--- a/test-data/MADE1.out.pfamtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.out.pfamtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -3,24 +3,19 @@
 # name                  bits   E-value   n   exp  bias    description
 # ------------------- ------ --------- --- ----- -----    ---------------------
-MADE1                   51.2   9.3e-18   4   8.6  26.3    MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
 # Domain scores
 # -------------
 #  name                 bits   E-value   hit  bias env-st env-en ali-st ali-en hmm-st hmm-en     description
 # ------------------- ------ --------- ----- ----- ------ ------ ------ ------ ------ ------      ---------------------
-MADE1                   34.8   1.3e-12     3   0.7 302387 302466 302388 302466      2     80     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-MADE1                   27.4   2.4e-10     1   0.6 174456 174520 174456 174498      1     43     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-MADE1                    1.4     0.033     4   0.4 304029 304108 304060 304106     27     74     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-MADE1                   -8.4         1     2   5.8 197272 197342 197274 197341     12     79     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
 # Program:         hmmscan
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
+# Query file:      /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat
 # Target file:     localref.hmm
-# Option settings: hmmscan --tblout /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat --domtblout /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat --pfamtblout /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 localref.hmm /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/8/working
-# Date:            Thu May 14 18:53:22 2020
+# Option settings: hmmscan --tblout /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat --domtblout /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat --pfamtblout /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 0 localref.hmm /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat 
+# Current dir:     /tmp/tmpgjabmh94/job_working_directory/000/3/working
+# Date:            Fri Jul 16 11:01:18 2021
 # [ok]
--- a/test-data/MADE1.out.tblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/MADE1.out.tblout	Wed Jul 21 14:16:41 2021 +0000
@@ -1,14 +1,13 @@
-#                                                                         --- full sequence ---- --- best 1 domain ---- --- domain number estimation ----
-# target name        accession   query name                    accession    E-value  score  bias   E-value  score  bias   exp reg clu  ov env dom rep inc description of target
-#-------------------  ----------          -------------------- ---------- --------- ------ ----- --------- ------ -----   --- --- --- --- --- --- --- --- ---------------------
-MADE1                DF0000629.2 humanchr1/239220001-239550000 -            9.3e-18   51.2  26.3   1.3e-12   34.8   0.7   8.6   4   0   0   4   4   4   2 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+#                                                                        --- full sequence ---- --- best 1 domain ---- --- domain number estimation ----
+# target name        accession  query name                    accession    E-value  score  bias   E-value  score  bias   exp reg clu  ov env dom rep inc description of target
+#------------------- ----------          -------------------- ---------- --------- ------ ----- --------- ------ -----   --- --- --- --- --- --- --- --- ---------------------
 # Program:         hmmscan
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SCAN
-# Query file:      /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
+# Query file:      /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat
 # Target file:     localref.hmm
-# Option settings: hmmscan --tblout /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat --domtblout /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat --pfamtblout /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 localref.hmm /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/8/working
-# Date:            Thu May 14 18:53:22 2020
+# Option settings: hmmscan --tblout /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat --domtblout /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat --pfamtblout /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 0 localref.hmm /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat 
+# Current dir:     /tmp/tmpgjabmh94/job_working_directory/000/3/working
+# Date:            Fri Jul 16 11:01:18 2021
 # [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/dna_target2.fa	Wed Jul 21 14:16:41 2021 +0000
@@ -0,0 +1,1000 @@
--- a/test-data/fn3.hmm	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/fn3.hmm	Wed Jul 21 14:16:41 2021 +0000
@@ -1,4 +1,4 @@
-HMMER3/f [3.2 | June 2018]
+HMMER3/f [3.3.2 | Nov 2020]
 NAME  fn3
 ACC   PF00041.13
 DESC  Fibronectin type III domain
--- a/test-data/globins.domtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins.domtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -5,11 +5,11 @@
 sp|P02185|MYG_PHYCD  -            154 dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2 -            149   5.8e-70  221.1   3.3   1   1   6.4e-70   6.4e-70  220.9   3.3     2   149     2   148     1   148 0.99 Myoglobin OS=Physeter catodon GN=MB PE=1 SV=2
 # Program:         hmmsearch
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpqydies2m/files/6/d/6/dataset_6d69e63c-e7d8-450d-b7f8-3e08a51472f0.dat
-# Target file:     /tmp/tmpqydies2m/files/8/2/8/dataset_8282288a-91ea-4a46-89c2-d1f3b4e67c52.dat
-# Option settings: hmmsearch --tblout /tmp/tmpqydies2m/files/4/6/b/dataset_46bff7ad-a6de-481d-adb4-50ccab8aacb8.dat --domtblout /tmp/tmpqydies2m/files/b/2/5/dataset_b258e52b-de8c-4e23-86d8-c69ebf229c95.dat --pfamtblout /tmp/tmpqydies2m/files/f/b/8/dataset_fb8cde04-dee0-4b38-9125-bf4766986c0c.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpqydies2m/files/6/d/6/dataset_6d69e63c-e7d8-450d-b7f8-3e08a51472f0.dat /tmp/tmpqydies2m/files/8/2/8/dataset_8282288a-91ea-4a46-89c2-d1f3b4e67c52.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/11/working
-# Date:            Thu May 14 18:54:00 2020
+# Query file:      /tmp/tmpzdnl83p_/files/d/7/1/dataset_d71f3df3-1c51-496d-850e-764bcbc1d02f.dat
+# Target file:     /tmp/tmpzdnl83p_/files/a/a/2/dataset_aa22e5e1-53c6-4de4-93db-352fe45c0b7c.dat
+# Option settings: hmmsearch --tblout /tmp/tmpzdnl83p_/files/b/3/0/dataset_b30af9dd-9ae0-4a21-b3b4-7f5c6faf9474.dat --domtblout /tmp/tmpzdnl83p_/files/1/3/b/dataset_13ba9c25-323d-45ff-9914-8a2b298330ee.dat --pfamtblout /tmp/tmpzdnl83p_/files/4/4/6/dataset_446d7608-0577-4f0f-a313-8ef4014324ac.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/d/7/1/dataset_d71f3df3-1c51-496d-850e-764bcbc1d02f.dat /tmp/tmpzdnl83p_/files/a/a/2/dataset_aa22e5e1-53c6-4de4-93db-352fe45c0b7c.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/24/working
+# Date:            Fri Jul 16 10:33:07 2021
 # [ok]
--- a/test-data/globins.pfamtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins.pfamtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -15,11 +15,11 @@
 sp|P02185|MYG_PHYCD    220.9   6.4e-70     1   3.3      1    148      2    148      2    149     Myoglobin OS=Physeter catodon GN=MB PE=1 SV=2
 # Program:         hmmsearch
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpqydies2m/files/6/d/6/dataset_6d69e63c-e7d8-450d-b7f8-3e08a51472f0.dat
-# Target file:     /tmp/tmpqydies2m/files/8/2/8/dataset_8282288a-91ea-4a46-89c2-d1f3b4e67c52.dat
-# Option settings: hmmsearch --tblout /tmp/tmpqydies2m/files/4/6/b/dataset_46bff7ad-a6de-481d-adb4-50ccab8aacb8.dat --domtblout /tmp/tmpqydies2m/files/b/2/5/dataset_b258e52b-de8c-4e23-86d8-c69ebf229c95.dat --pfamtblout /tmp/tmpqydies2m/files/f/b/8/dataset_fb8cde04-dee0-4b38-9125-bf4766986c0c.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpqydies2m/files/6/d/6/dataset_6d69e63c-e7d8-450d-b7f8-3e08a51472f0.dat /tmp/tmpqydies2m/files/8/2/8/dataset_8282288a-91ea-4a46-89c2-d1f3b4e67c52.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/11/working
-# Date:            Thu May 14 18:54:00 2020
+# Query file:      /tmp/tmpzdnl83p_/files/d/7/1/dataset_d71f3df3-1c51-496d-850e-764bcbc1d02f.dat
+# Target file:     /tmp/tmpzdnl83p_/files/a/a/2/dataset_aa22e5e1-53c6-4de4-93db-352fe45c0b7c.dat
+# Option settings: hmmsearch --tblout /tmp/tmpzdnl83p_/files/b/3/0/dataset_b30af9dd-9ae0-4a21-b3b4-7f5c6faf9474.dat --domtblout /tmp/tmpzdnl83p_/files/1/3/b/dataset_13ba9c25-323d-45ff-9914-8a2b298330ee.dat --pfamtblout /tmp/tmpzdnl83p_/files/4/4/6/dataset_446d7608-0577-4f0f-a313-8ef4014324ac.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/d/7/1/dataset_d71f3df3-1c51-496d-850e-764bcbc1d02f.dat /tmp/tmpzdnl83p_/files/a/a/2/dataset_aa22e5e1-53c6-4de4-93db-352fe45c0b7c.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/24/working
+# Date:            Fri Jul 16 10:33:07 2021
 # [ok]
--- a/test-data/globins.tblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins.tblout	Wed Jul 21 14:16:41 2021 +0000
@@ -5,11 +5,11 @@
 sp|P02185|MYG_PHYCD  -          dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2 -            5.8e-70  221.1   3.3   6.4e-70  220.9   3.3   1.0   1   0   0   1   1   1   1 Myoglobin OS=Physeter catodon GN=MB PE=1 SV=2
 # Program:         hmmsearch
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpqydies2m/files/6/d/6/dataset_6d69e63c-e7d8-450d-b7f8-3e08a51472f0.dat
-# Target file:     /tmp/tmpqydies2m/files/8/2/8/dataset_8282288a-91ea-4a46-89c2-d1f3b4e67c52.dat
-# Option settings: hmmsearch --tblout /tmp/tmpqydies2m/files/4/6/b/dataset_46bff7ad-a6de-481d-adb4-50ccab8aacb8.dat --domtblout /tmp/tmpqydies2m/files/b/2/5/dataset_b258e52b-de8c-4e23-86d8-c69ebf229c95.dat --pfamtblout /tmp/tmpqydies2m/files/f/b/8/dataset_fb8cde04-dee0-4b38-9125-bf4766986c0c.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpqydies2m/files/6/d/6/dataset_6d69e63c-e7d8-450d-b7f8-3e08a51472f0.dat /tmp/tmpqydies2m/files/8/2/8/dataset_8282288a-91ea-4a46-89c2-d1f3b4e67c52.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/11/working
-# Date:            Thu May 14 18:54:00 2020
+# Query file:      /tmp/tmpzdnl83p_/files/d/7/1/dataset_d71f3df3-1c51-496d-850e-764bcbc1d02f.dat
+# Target file:     /tmp/tmpzdnl83p_/files/a/a/2/dataset_aa22e5e1-53c6-4de4-93db-352fe45c0b7c.dat
+# Option settings: hmmsearch --tblout /tmp/tmpzdnl83p_/files/b/3/0/dataset_b30af9dd-9ae0-4a21-b3b4-7f5c6faf9474.dat --domtblout /tmp/tmpzdnl83p_/files/1/3/b/dataset_13ba9c25-323d-45ff-9914-8a2b298330ee.dat --pfamtblout /tmp/tmpzdnl83p_/files/4/4/6/dataset_446d7608-0577-4f0f-a313-8ef4014324ac.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/d/7/1/dataset_d71f3df3-1c51-496d-850e-764bcbc1d02f.dat /tmp/tmpzdnl83p_/files/a/a/2/dataset_aa22e5e1-53c6-4de4-93db-352fe45c0b7c.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/24/working
+# Date:            Fri Jul 16 10:33:07 2021
 # [ok]
--- a/test-data/globins4-emit-1.sto	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins4-emit-1.sto	Wed Jul 21 14:16:41 2021 +0000
@@ -1,4 +1,4 @@
--- a/test-data/globins4-emit.sto	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins4-emit.sto	Wed Jul 21 14:16:41 2021 +0000
@@ -1,26 +1,26 @@
-#=GC RF  
+#=GC RF                                     
-dataset_x-sample1  ...
-dataset_x-sample2  ...
-dataset_x-sample3  ...
-dataset_x-sample4  ...
-dataset_x-sample5  ...
-dataset_x-sample6  gmp
-dataset_x-sample7  ...
-dataset_x-sample8  ...
-dataset_x-sample9  ...
-dataset_x-sample10 ...
-#=GC RF            ...
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample1  S..KYL..KAKYnpseKpglpdslhtfssdrqnk
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample2  R..IVL..NNEF....L.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample3  S..EYL..SEAF....R.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample4  QnvGIM..WHMM....N.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample5  I..HS-..-DNW....K.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample6  M..TDLthLDQH....Kp................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample7  S..AEF..ARPY....-.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample8  T..KHL..KNKS....E.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample9  C..KG-..TRKW....M.................
+dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2-sample10 R..WLA..ADQL....K.................
+#=GC RF                                     
--- a/test-data/globins4.hmm	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins4.hmm	Wed Jul 21 14:16:41 2021 +0000
@@ -1,5 +1,5 @@
-HMMER3/f [3.3 | Nov 2019]
-NAME  dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2
+HMMER3/f [3.3.2 | Nov 2020]
+NAME  dataset_4d0de504-1e4d-41c4-aebc-164c97efd566
 LENG  149
 ALPH  amino
 RF    no
@@ -7,7 +7,7 @@
 CONS  yes
 CS    no
 MAP   yes
-DATE  Thu May 14 18:27:55 2020
+DATE  Fri Jul 16 10:31:05 2021
 NSEQ  4
 EFFN  0.964844
 CKSUM 2027839109
--- a/test-data/globins4.hmm2	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/globins4.hmm2	Wed Jul 21 14:16:41 2021 +0000
@@ -1,4 +1,4 @@
-HMMER2.0  [converted from 3.3]
+HMMER2.0  [converted from 3.3.2]
 NAME  dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2
 LENG  149
 ALPH  Amino
--- a/test-data/jackhmmer.domtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/jackhmmer.domtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -93,11 +93,11 @@
 MYG_MUSAN            -            148 sp|P02024|HBB_GORGO  -            147   1.6e-44  142.7   0.3   1   1   1.8e-44   1.8e-44  142.6   0.3     8   146     2   141     1   142 0.96 -
 # Program:         jackhmmer
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpfvu1k4r6/files/e/a/d/dataset_ead1ef79-dd40-459b-b072-01fc401e229a.dat
-# Target file:     /tmp/tmpfvu1k4r6/files/c/9/e/dataset_c9eb6990-14c2-41da-9304-1bdf155f29e9.dat
-# Option settings: jackhmmer -N 5 --tblout /tmp/tmpfvu1k4r6/files/c/c/a/dataset_cca87e56-6fd4-49f3-b29f-dca9b665fb4e.dat --domtblout /tmp/tmpfvu1k4r6/files/a/9/3/dataset_a93530ef-2a8d-4611-9764-b317aa42a6b4.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpfvu1k4r6/files/e/a/d/dataset_ead1ef79-dd40-459b-b072-01fc401e229a.dat /tmp/tmpfvu1k4r6/files/c/9/e/dataset_c9eb6990-14c2-41da-9304-1bdf155f29e9.dat 
-# Current dir:     /tmp/tmpfvu1k4r6/job_working_directory/000/3/working
-# Date:            Thu May 14 18:30:01 2020
+# Query file:      /tmp/tmpzdnl83p_/files/0/1/5/dataset_0156c4e5-db19-44b9-9720-26a662d40967.dat
+# Target file:     /tmp/tmpzdnl83p_/files/4/1/d/dataset_41d1e750-65d7-48a9-819a-f7188b5b01b8.dat
+# Option settings: jackhmmer -N 5 --tblout /tmp/tmpzdnl83p_/files/7/d/e/dataset_7de0eeb5-83b6-418a-88c5-21c3999368bb.dat --domtblout /tmp/tmpzdnl83p_/files/a/0/b/dataset_a0b2025a-6ab0-46b2-b566-fa012cd86bf9.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/0/1/5/dataset_0156c4e5-db19-44b9-9720-26a662d40967.dat /tmp/tmpzdnl83p_/files/4/1/d/dataset_41d1e750-65d7-48a9-819a-f7188b5b01b8.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/30/working
+# Date:            Fri Jul 16 10:33:43 2021
 # [ok]
--- a/test-data/jackhmmer.out	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/jackhmmer.out	Wed Jul 21 14:16:41 2021 +0000
@@ -1,15 +1,15 @@
 # jackhmmer :: iteratively search a protein sequence against a protein database
-# HMMER 3.3 (Nov 2019);
-# Copyright (C) 2019 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020);
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpfvu1k4r6/files/5/c/1/dataset_5c1435bb-ab6c-4203-863c-578c4a331ea1.dat
-# target sequence database:        /tmp/tmpfvu1k4r6/files/0/c/2/dataset_0c23de62-c430-473e-92ee-a18da9f58231.dat
+# query sequence file:             /tmp/tmpzdnl83p_/files/2/7/9/dataset_27979eae-6ed4-4ade-aa69-7ece7b993e22.dat
+# target sequence database:        /tmp/tmpzdnl83p_/files/e/6/d/dataset_e6d4b38b-8770-49ed-98bb-842ce026d3c8.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
 Query:       sp|P02185|MYG_PHYCD  [L=154]
@@ -606,8 +606,8 @@
 Passed Fwd filter:                        44  (0.977778); expected 0.0 (1e-05)
 Initial search space (Z):                 45  [actual number of targets]
 Domain search space  (domZ):              44  [number of targets reported over threshold]
-# CPU time: 0.04u 0.00s 00:00:00.04 Elapsed: 00:00:00.04
-# Mc/sec: 20.54
+# CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03
+# Mc/sec: 28.10
 @@ New targets included:   44
 @@ New alignment includes: 45 subseqs (was 1), including original query
@@ -1268,8 +1268,8 @@
 Passed Fwd filter:                        45  (1); expected 0.0 (1e-05)
 Initial search space (Z):                 45  [actual number of targets]
 Domain search space  (domZ):              45  [number of targets reported over threshold]
-# CPU time: 0.22u 0.00s 00:00:00.22 Elapsed: 00:00:00.22
-# Mc/sec: 4.45
+# CPU time: 0.13u 0.00s 00:00:00.13 Elapsed: 00:00:00.13
+# Mc/sec: 7.65
 @@ New targets included:   1
 @@ New alignment includes: 46 subseqs (was 45), including original query
@@ -1930,8 +1930,8 @@
 Passed Fwd filter:                        45  (1); expected 0.0 (1e-05)
 Initial search space (Z):                 45  [actual number of targets]
 Domain search space  (domZ):              45  [number of targets reported over threshold]
-# CPU time: 0.20u 0.00s 00:00:00.20 Elapsed: 00:00:00.20
-# Mc/sec: 5.00
+# CPU time: 0.14u 0.00s 00:00:00.14 Elapsed: 00:00:00.13
+# Mc/sec: 7.59
 @@ New targets included:   0
 @@ New alignment includes: 46 subseqs (was 46), including original query
@@ -2547,8 +2547,8 @@
 Passed Fwd filter:                        45  (1); expected 0.0 (1e-05)
 Initial search space (Z):                 45  [actual number of targets]
 Domain search space  (domZ):              45  [number of targets reported over threshold]
-# CPU time: 0.05u 0.00s 00:00:00.05 Elapsed: 00:00:00.04
-# Mc/sec: 20.84
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
+# Mc/sec: 33.36
 @@ New targets included:   45
 @@ New alignment includes: 46 subseqs (was 1), including original query
@@ -3209,8 +3209,8 @@
 Passed Fwd filter:                        45  (1); expected 0.0 (1e-05)
 Initial search space (Z):                 45  [actual number of targets]
 Domain search space  (domZ):              45  [number of targets reported over threshold]
-# CPU time: 0.22u 0.00s 00:00:00.22 Elapsed: 00:00:00.24
-# Mc/sec: 3.96
+# CPU time: 0.13u 0.00s 00:00:00.13 Elapsed: 00:00:00.12
+# Mc/sec: 7.64
 @@ New targets included:   0
 @@ New alignment includes: 46 subseqs (was 46), including original query
--- a/test-data/jackhmmer.tblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/jackhmmer.tblout	Wed Jul 21 14:16:41 2021 +0000
@@ -93,11 +93,11 @@
 MYG_MUSAN            -          sp|P02024|HBB_GORGO  -            1.6e-44  142.7   0.3   1.8e-44  142.6   0.3   1.0   1   0   0   1   1   1   1 -
 # Program:         jackhmmer
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpfvu1k4r6/files/e/a/d/dataset_ead1ef79-dd40-459b-b072-01fc401e229a.dat
-# Target file:     /tmp/tmpfvu1k4r6/files/c/9/e/dataset_c9eb6990-14c2-41da-9304-1bdf155f29e9.dat
-# Option settings: jackhmmer -N 5 --tblout /tmp/tmpfvu1k4r6/files/c/c/a/dataset_cca87e56-6fd4-49f3-b29f-dca9b665fb4e.dat --domtblout /tmp/tmpfvu1k4r6/files/a/9/3/dataset_a93530ef-2a8d-4611-9764-b317aa42a6b4.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpfvu1k4r6/files/e/a/d/dataset_ead1ef79-dd40-459b-b072-01fc401e229a.dat /tmp/tmpfvu1k4r6/files/c/9/e/dataset_c9eb6990-14c2-41da-9304-1bdf155f29e9.dat 
-# Current dir:     /tmp/tmpfvu1k4r6/job_working_directory/000/3/working
-# Date:            Thu May 14 18:30:01 2020
+# Query file:      /tmp/tmpzdnl83p_/files/0/1/5/dataset_0156c4e5-db19-44b9-9720-26a662d40967.dat
+# Target file:     /tmp/tmpzdnl83p_/files/4/1/d/dataset_41d1e750-65d7-48a9-819a-f7188b5b01b8.dat
+# Option settings: jackhmmer -N 5 --tblout /tmp/tmpzdnl83p_/files/7/d/e/dataset_7de0eeb5-83b6-418a-88c5-21c3999368bb.dat --domtblout /tmp/tmpzdnl83p_/files/a/0/b/dataset_a0b2025a-6ab0-46b2-b566-fa012cd86bf9.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/0/1/5/dataset_0156c4e5-db19-44b9-9720-26a662d40967.dat /tmp/tmpzdnl83p_/files/4/1/d/dataset_41d1e750-65d7-48a9-819a-f7188b5b01b8.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/30/working
+# Date:            Fri Jul 16 10:33:43 2021
 # [ok]
--- a/test-data/nhmmer.out	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/nhmmer.out	Wed Jul 21 14:16:41 2021 +0000
@@ -1,20 +1,17 @@
 # nhmmer :: search a DNA model, alignment, or sequence against a DNA database
-# HMMER 3.3 (Nov 2019);
-# Copyright (C) 2019 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020);
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query file:                      /tmp/tmpqydies2m/files/c/4/e/dataset_c4e67f40-cb86-438e-8bc0-6020ada9fc86.dat
-# target sequence database:        /tmp/tmpqydies2m/files/a/1/b/dataset_a1b4364c-0e9a-4709-b4ef-ab7e5661d9e9.dat
-# hits tabular output:             /tmp/tmpqydies2m/files/b/d/d/dataset_bdd87d82-1ce1-4051-8d5f-f7251bf7fd18.dat
-# hits output in Dfam format:      /tmp/tmpqydies2m/files/d/8/e/dataset_d8ee0d50-d171-4e8a-9c7d-1cbd4394296f.dat
-# alignment scores output:         /tmp/tmpqydies2m/files/5/1/3/dataset_5139892f-c507-40c4-b43d-f73023c634f4.dat
+# query file:                      /tmp/tmpzdnl83p_/files/9/7/3/dataset_973ac44a-c86b-42ed-b8fe-f747795642c7.dat
+# target sequence database:        /tmp/tmpzdnl83p_/files/6/5/6/dataset_65678542-5e91-4d72-9409-b7213a529ca0.dat
 # max ASCII text line length:      unlimited
 # SSV filter P threshold:       <= 0.02
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # input query is asserted as:      DNA
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
 Query:       MADE1  [M=80]
@@ -108,7 +105,7 @@
 Residues passing Vit filter:            1612  (0.00244); expected (0.001)
 Residues passing Fwd filter:            1194  (0.00181); expected (1e-05)
 Total number of hits:                      5  (0.000405)
-# CPU time: 0.04u 0.00s 00:00:00.04 Elapsed: 00:00:00.05
-# Mc/sec: 1031.54
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
+# Mc/sec: 2197.54
--- a/test-data/nhmmer.out.tblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/nhmmer.out.tblout	Wed Jul 21 14:16:41 2021 +0000
@@ -7,11 +7,11 @@
 humanchr1/239220001-239550000 -          MADE1                DF0000629.2      41      71  304073  304103  304053  304109  330000    +         2.2    6.9   7.2  -
 # Program:         nhmmer
-# Version:         3.3 (Nov 2019)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpqydies2m/files/c/4/e/dataset_c4e67f40-cb86-438e-8bc0-6020ada9fc86.dat
-# Target file:     /tmp/tmpqydies2m/files/a/1/b/dataset_a1b4364c-0e9a-4709-b4ef-ab7e5661d9e9.dat
-# Option settings: nhmmer --tblout /tmp/tmpqydies2m/files/b/d/d/dataset_bdd87d82-1ce1-4051-8d5f-f7251bf7fd18.dat --dfamtblout /tmp/tmpqydies2m/files/d/8/e/dataset_d8ee0d50-d171-4e8a-9c7d-1cbd4394296f.dat --aliscoresout /tmp/tmpqydies2m/files/5/1/3/dataset_5139892f-c507-40c4-b43d-f73023c634f4.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpqydies2m/files/c/4/e/dataset_c4e67f40-cb86-438e-8bc0-6020ada9fc86.dat /tmp/tmpqydies2m/files/a/1/b/dataset_a1b4364c-0e9a-4709-b4ef-ab7e5661d9e9.dat 
-# Current dir:     /tmp/tmpqydies2m/job_working_directory/000/17/working
-# Date:            Thu May 14 18:54:51 2020
+# Query file:      /tmp/tmpzdnl83p_/files/8/6/7/dataset_867699d1-2c6c-4367-8540-aa72655041fb.dat
+# Target file:     /tmp/tmpzdnl83p_/files/1/a/1/dataset_1a1fb3d8-05ff-474e-b627-c162ff1aa7a5.dat
+# Option settings: nhmmer --tblout /tmp/tmpzdnl83p_/files/0/a/c/dataset_0ac8367e-7ecc-41a5-a995-09d458438754.dat --dfamtblout /tmp/tmpzdnl83p_/files/d/6/0/dataset_d60239d4-a95a-45fb-9b76-7ccedc277d9e.dat --aliscoresout /tmp/tmpzdnl83p_/files/f/6/e/dataset_f6e4f662-4b72-4e7a-9f18-de39b61bce27.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/8/6/7/dataset_867699d1-2c6c-4367-8540-aa72655041fb.dat /tmp/tmpzdnl83p_/files/1/a/1/dataset_1a1fb3d8-05ff-474e-b627-c162ff1aa7a5.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/36/working
+# Date:            Fri Jul 16 10:34:18 2021
 # [ok]
--- a/test-data/phmmer.domtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/phmmer.domtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -92,11 +92,11 @@
 sp|P02024|HBB_GORGO  -            147 HBB2_TRICR           -            145   2.7e-46  144.3   0.0   1   1   1.5e-46     3e-46  144.1   0.0     1   145     2   146     2   146 0.98 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2
 # Program:         phmmer
-# Version:         3.2 (June 2018)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpp4O0Ju/files/000/dataset_45.dat
-# Target file:     /tmp/tmpp4O0Ju/files/000/dataset_46.dat
-# Option settings: phmmer --tblout /tmp/tmpp4O0Ju/files/000/dataset_48.dat --domtblout /tmp/tmpp4O0Ju/files/000/dataset_49.dat --pfamtblout /tmp/tmpp4O0Ju/files/000/dataset_50.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpp4O0Ju/files/000/dataset_45.dat /tmp/tmpp4O0Ju/files/000/dataset_46.dat 
-# Current dir:     /tmp/tmpp4O0Ju/job_working_directory/000/36/working
-# Date:            Fri Jun  8 12:19:38 2018
+# Query file:      /tmp/tmpzdnl83p_/files/6/e/b/dataset_6ebbde12-ebc2-45e1-bca1-5b28034097f2.dat
+# Target file:     /tmp/tmpzdnl83p_/files/f/5/8/dataset_f5890da8-ad9f-4fc0-908d-0b9dc0c44e28.dat
+# Option settings: phmmer --tblout /tmp/tmpzdnl83p_/files/0/d/1/dataset_0d12c973-afff-4faa-9147-e31051f4f5ca.dat --domtblout /tmp/tmpzdnl83p_/files/d/b/2/dataset_db25fae1-b539-436c-860b-dae65bd95d8a.dat --pfamtblout /tmp/tmpzdnl83p_/files/c/1/0/dataset_c100c9b8-9cdb-4b7f-ac1b-0a7658854933.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/6/e/b/dataset_6ebbde12-ebc2-45e1-bca1-5b28034097f2.dat /tmp/tmpzdnl83p_/files/f/5/8/dataset_f5890da8-ad9f-4fc0-908d-0b9dc0c44e28.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/45/working
+# Date:            Fri Jul 16 10:35:18 2021
 # [ok]
--- a/test-data/phmmer.out	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/phmmer.out	Wed Jul 21 14:16:41 2021 +0000
@@ -1,18 +1,15 @@
 # phmmer :: search a protein sequence against a protein database
-# HMMER 3.2 (June 2018);
-# Copyright (C) 2018 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020);
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpp4O0Ju/files/000/dataset_45.dat
-# target sequence database:        /tmp/tmpp4O0Ju/files/000/dataset_46.dat
-# per-seq hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_48.dat
-# per-dom hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_49.dat
-# pfam-style tabular hit output:   /tmp/tmpp4O0Ju/files/000/dataset_50.dat
+# query sequence file:             /tmp/tmpzdnl83p_/files/f/3/7/dataset_f37673ce-2825-4214-827f-9fd8798aa730.dat
+# target sequence database:        /tmp/tmpzdnl83p_/files/4/8/e/dataset_48ee2b1d-0f10-4a66-bc8d-a3f4938d2e4a.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
 Query:       MYG_ESCGI  [L=153]
@@ -62,7 +59,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.67
+# Mc/sec: 2.88
 Query:       MYG_HORSE  [L=153]
 Scores for complete sequences (score includes all domains):
@@ -111,7 +108,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.81
+# Mc/sec: 3.02
 Query:       MYG_PROGU  [L=153]
 Scores for complete sequences (score includes all domains):
@@ -159,8 +156,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.81
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.01
 Query:       MYG_SAISC  [L=153]
 Scores for complete sequences (score includes all domains):
@@ -208,8 +205,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.78
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 3.04
 Query:       MYG_LYCPI  [L=153]
 Scores for complete sequences (score includes all domains):
@@ -257,8 +254,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.74
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.06
 Query:       MYG_MOUSE  [L=153]
 Scores for complete sequences (score includes all domains):
@@ -306,8 +303,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.78
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 3.08
 Query:       MYG_MUSAN  [L=148]
 Scores for complete sequences (score includes all domains):
@@ -355,8 +352,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.88
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.08
 Query:       HBA_AILME  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -404,8 +401,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.80
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 3.00
 Query:       HBA_PROLO  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -453,8 +450,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.73
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.00
 Query:       HBA_PAGLA  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -503,7 +500,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.33
+# Mc/sec: 3.03
 Query:       HBA_MACFA  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -552,7 +549,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.65
+# Mc/sec: 3.00
 Query:       HBA_MACSI  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -600,8 +597,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.73
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.03
 Query:       HBA_PONPY  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -650,7 +647,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.67
+# Mc/sec: 2.97
 Query:       HBA2_GALCR  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -699,7 +696,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.68
+# Mc/sec: 3.01
 Query:       HBA_MESAU  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -748,7 +745,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.41
+# Mc/sec: 3.00
 Query:       HBA2_BOSMU  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -796,8 +793,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.64
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.02
 Query:       HBA_ERIEU  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -846,7 +843,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.76
+# Mc/sec: 2.92
 Query:       HBA_FRAPO  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -895,7 +892,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.70
+# Mc/sec: 2.60
 Query:       HBA_PHACO  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -944,7 +941,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.56
+# Mc/sec: 2.51
 Query:       HBA_TRIOC  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -993,7 +990,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.35
+# Mc/sec: 2.58
 Query:       HBA_ANSSE  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -1041,8 +1038,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.52
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.51
 Query:       HBA_COLLI  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -1091,7 +1088,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.79
+# Mc/sec: 2.44
 Query:       HBAD_CHLME  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -1139,8 +1136,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.87
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.83
 Query:       HBAD_PASMO  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -1188,8 +1185,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 2.10
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.91
 Query:       HBAZ_HORSE  [L=141]
 Scores for complete sequences (score includes all domains):
@@ -1238,7 +1235,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.21
+# Mc/sec: 2.95
 Query:       HBA4_SALIR  [L=142]
 Scores for complete sequences (score includes all domains):
@@ -1287,7 +1284,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.72
+# Mc/sec: 2.98
 Query:       HBB_ORNAN  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1336,7 +1333,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.63
+# Mc/sec: 2.92
 Query:       HBB_TACAC  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1384,8 +1381,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.82
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 3.01
 Query:       HBE_PONPY  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1433,8 +1430,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.02
-# Mc/sec: 1.68
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 3.03
 Query:       HBB_SPECI  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1482,8 +1479,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 2.16
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.97
 Query:       HBB_SPETO  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1532,7 +1529,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.50
+# Mc/sec: 2.97
 Query:       HBB_EQUHE  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1580,8 +1577,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 2.16
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.98
 Query:       HBB_SUNMU  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1629,8 +1626,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 2.00
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.91
 Query:       HBB_CALAR  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1678,8 +1675,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.01s 00:00:00.03 Elapsed: 00:00:00.02
-# Mc/sec: 1.87
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.78
 Query:       HBB_MANSP  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1727,8 +1724,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.86
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.75
 Query:       HBB_URSMA  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1776,8 +1773,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.65
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.74
 Query:       HBB_RABIT  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1825,8 +1822,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.57
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.56
 Query:       HBB_TUPGL  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1875,7 +1872,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.80
+# Mc/sec: 2.49
 Query:       HBB_TRIIN  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1923,8 +1920,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
-# Mc/sec: 2.80
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.55
 Query:       HBB_COLLI  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -1973,7 +1970,7 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
-# Mc/sec: 2.22
+# Mc/sec: 2.43
 Query:       HBB_LARRI  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -2021,8 +2018,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.82
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.45
 Query:       HBB1_VAREX  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -2070,8 +2067,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.75
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.70
 Query:       HBB2_XENTR  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -2119,8 +2116,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.02
-# Mc/sec: 1.82
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.72
 Query:       HBBL_RANCA  [L=146]
 Scores for complete sequences (score includes all domains):
@@ -2168,8 +2165,8 @@
 Passed Fwd filter:                         2  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.80
+# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.01
+# Mc/sec: 2.69
 Query:       HBB2_TRICR  [L=145]
 Scores for complete sequences (score includes all domains):
@@ -2204,7 +2201,7 @@
 Passed Fwd filter:                         1  (0.5); expected 0.0 (1e-05)
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               1  [number of targets reported over threshold]
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1.87
+# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
+# Mc/sec: 2.57
--- a/test-data/phmmer.pfamtblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/phmmer.pfamtblout	Wed Jul 21 14:16:41 2021 +0000
@@ -673,11 +673,11 @@
 sp|P02024|HBB_GORGO    144.1     3e-46     1   0.0      2    146      2    146      1    145     Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2
 # Program:         phmmer
-# Version:         3.2 (June 2018)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpp4O0Ju/files/000/dataset_45.dat
-# Target file:     /tmp/tmpp4O0Ju/files/000/dataset_46.dat
-# Option settings: phmmer --tblout /tmp/tmpp4O0Ju/files/000/dataset_48.dat --domtblout /tmp/tmpp4O0Ju/files/000/dataset_49.dat --pfamtblout /tmp/tmpp4O0Ju/files/000/dataset_50.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpp4O0Ju/files/000/dataset_45.dat /tmp/tmpp4O0Ju/files/000/dataset_46.dat 
-# Current dir:     /tmp/tmpp4O0Ju/job_working_directory/000/36/working
-# Date:            Fri Jun  8 12:19:38 2018
+# Query file:      /tmp/tmpzdnl83p_/files/6/e/b/dataset_6ebbde12-ebc2-45e1-bca1-5b28034097f2.dat
+# Target file:     /tmp/tmpzdnl83p_/files/f/5/8/dataset_f5890da8-ad9f-4fc0-908d-0b9dc0c44e28.dat
+# Option settings: phmmer --tblout /tmp/tmpzdnl83p_/files/0/d/1/dataset_0d12c973-afff-4faa-9147-e31051f4f5ca.dat --domtblout /tmp/tmpzdnl83p_/files/d/b/2/dataset_db25fae1-b539-436c-860b-dae65bd95d8a.dat --pfamtblout /tmp/tmpzdnl83p_/files/c/1/0/dataset_c100c9b8-9cdb-4b7f-ac1b-0a7658854933.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/6/e/b/dataset_6ebbde12-ebc2-45e1-bca1-5b28034097f2.dat /tmp/tmpzdnl83p_/files/f/5/8/dataset_f5890da8-ad9f-4fc0-908d-0b9dc0c44e28.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/45/working
+# Date:            Fri Jul 16 10:35:18 2021
 # [ok]
--- a/test-data/phmmer.tblout	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/phmmer.tblout	Wed Jul 21 14:16:41 2021 +0000
@@ -92,11 +92,11 @@
 sp|P02024|HBB_GORGO  -          HBB2_TRICR           -            2.7e-46  144.3   0.0     3e-46  144.1   0.0   1.0   1   0   0   1   1   1   1 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2
 # Program:         phmmer
-# Version:         3.2 (June 2018)
+# Version:         3.3.2 (Nov 2020)
 # Pipeline mode:   SEARCH
-# Query file:      /tmp/tmpp4O0Ju/files/000/dataset_45.dat
-# Target file:     /tmp/tmpp4O0Ju/files/000/dataset_46.dat
-# Option settings: phmmer --tblout /tmp/tmpp4O0Ju/files/000/dataset_48.dat --domtblout /tmp/tmpp4O0Ju/files/000/dataset_49.dat --pfamtblout /tmp/tmpp4O0Ju/files/000/dataset_50.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpp4O0Ju/files/000/dataset_45.dat /tmp/tmpp4O0Ju/files/000/dataset_46.dat 
-# Current dir:     /tmp/tmpp4O0Ju/job_working_directory/000/36/working
-# Date:            Fri Jun  8 12:19:38 2018
+# Query file:      /tmp/tmpzdnl83p_/files/6/e/b/dataset_6ebbde12-ebc2-45e1-bca1-5b28034097f2.dat
+# Target file:     /tmp/tmpzdnl83p_/files/f/5/8/dataset_f5890da8-ad9f-4fc0-908d-0b9dc0c44e28.dat
+# Option settings: phmmer --tblout /tmp/tmpzdnl83p_/files/0/d/1/dataset_0d12c973-afff-4faa-9147-e31051f4f5ca.dat --domtblout /tmp/tmpzdnl83p_/files/d/b/2/dataset_db25fae1-b539-436c-860b-dae65bd95d8a.dat --pfamtblout /tmp/tmpzdnl83p_/files/c/1/0/dataset_c100c9b8-9cdb-4b7f-ac1b-0a7658854933.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 0 /tmp/tmpzdnl83p_/files/6/e/b/dataset_6ebbde12-ebc2-45e1-bca1-5b28034097f2.dat /tmp/tmpzdnl83p_/files/f/5/8/dataset_f5890da8-ad9f-4fc0-908d-0b9dc0c44e28.dat 
+# Current dir:     /tmp/tmpzdnl83p_/job_working_directory/000/45/working
+# Date:            Fri Jul 16 10:35:18 2021
 # [ok]
--- a/test-data/uniprot_globins_match.out	Thu Jan 14 15:38:47 2021 +0000
+++ b/test-data/uniprot_globins_match.out	Wed Jul 21 14:16:41 2021 +0000
@@ -1,15 +1,15 @@
 # hmmsearch :: search profile(s) against a sequence database
-# HMMER 3.3 (Nov 2019);
-# Copyright (C) 2019 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020);
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query HMM file:                  /tmp/tmpqydies2m/files/1/e/c/dataset_1eca2f81-02d4-4cd0-9081-3ea0f7eb36d7.dat
-# target sequence database:        /tmp/tmpqydies2m/files/a/4/d/dataset_a4d3f992-2c56-4231-9590-fe0ab1f6413b.dat
+# query HMM file:                  /tmp/tmpzdnl83p_/files/f/6/6/dataset_f66fafa4-758d-4ace-89be-ff71fce4f56c.dat
+# target sequence database:        /tmp/tmpzdnl83p_/files/0/d/9/dataset_0d912a57-511c-4a51-a642-30fdf00f581c.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
 Query:       dataset_a435d3bd-3e95-4c54-859f-736e9bc413b2  [M=149]
@@ -59,6 +59,6 @@
 Initial search space (Z):                  2  [actual number of targets]
 Domain search space  (domZ):               2  [number of targets reported over threshold]
 # CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00
-# Mc/sec: 18.86
+# Mc/sec: 34.40