annotate test-data/nhmmer.out @ 7:b28e8ed99424 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:11:12 +0000
parents b4fe2f703b4b
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 0
diff changeset
1 # nhmmer :: search a DNA model, alignment, or sequence against a DNA database
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
2 # HMMER 3.3.2 (Nov 2020); http://hmmer.org/
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
3 # Copyright (C) 2020 Howard Hughes Medical Institute.
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 0
diff changeset
4 # Freely distributed under the BSD open source license.
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
6 # query file: /tmp/tmpzdnl83p_/files/9/7/3/dataset_973ac44a-c86b-42ed-b8fe-f747795642c7.dat
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
7 # target sequence database: /tmp/tmpzdnl83p_/files/6/5/6/dataset_65678542-5e91-4d72-9409-b7213a529ca0.dat
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
8 # max ASCII text line length: unlimited
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
9 # SSV filter P threshold: <= 0.02
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
10 # Vit filter P threshold: <= 0.001
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
11 # Fwd filter P threshold: <= 1e-05
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
12 # input query is asserted as: DNA
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
13 # random number seed set to: 4
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
14 # number of worker threads: 0
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
16
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
17 Query: MADE1 [M=80]
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
18 Accession: DF0000629.2
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
19 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
20 Scores for complete hits:
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
21 E-value score bias Sequence start end Description
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
22 ------- ------ ----- -------- ----- ----- -----------
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
23 4e-11 41.3 7.5 humanchr1/239220001-239550000 302390 302466
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
24 1.9e-08 32.8 8.3 humanchr1/239220001-239550000 174456 174498
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
25 6.3e-08 31.0 6.7 humanchr1/239220001-239550000 302466 302389
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
26 4.9e-06 25.0 7.0 humanchr1/239220001-239550000 174493 174456
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
27 ------ inclusion threshold ------
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
28 2.2 6.9 7.2 humanchr1/239220001-239550000 304073 304103
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
29
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
30
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
31 Annotation for each hit (and alignments):
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
32 >> humanchr1/239220001-239550000
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
33 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
34 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
35 ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.88
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
36
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
37 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
38 score: 41.3 bits
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
39 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
40 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
41 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
42 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
43 89*******************************************966644554...34.4578**************997 PP
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
44
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
45 >> humanchr1/239220001-239550000
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
46 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
47 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
48 ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.91
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
49
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
50 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
51 score: 32.8 bits
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
54 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
56 589************************************9986 PP
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
57
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
58 >> humanchr1/239220001-239550000
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
59 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
60 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
61 ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 330000 0.80
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
62
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
63 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
64 score: 31.0 bits
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
65 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
66 MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
67 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
68 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
69 6899************97543.2...23333455566666666666799*****************************9985 PP
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
70
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
71 >> humanchr1/239220001-239550000
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
72 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
73 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
74 ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.94
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
75
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
76 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
77 score: 25.0 bits
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
78 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
79 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
80 taatg caaaaacc caattacttttgcac aacctaa
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
81 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
82 5899*******************************986 PP
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
83
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
84 >> humanchr1/239220001-239550000
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
85 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
86 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
87 ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 330000 0.85
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
88
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
89 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
90 score: 6.9 bits
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
91 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
92 MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
93 tt a tgg aaaaa ca tta ttttgca
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
94 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
95 456789************************8 PP
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
96
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
97
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
98
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
99 Internal pipeline statistics summary:
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
100 -------------------------------------
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 0
diff changeset
101 Query model(s): 1 (80 nodes)
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 0
diff changeset
102 Target sequences: 1 (660000 residues searched)
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
103 Residues passing SSV filter: 60770 (0.0921); expected (0.02)
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
104 Residues passing bias filter: 35792 (0.0542); expected (0.02)
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
105 Residues passing Vit filter: 1612 (0.00244); expected (0.001)
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
106 Residues passing Fwd filter: 1194 (0.00181); expected (1e-05)
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 0
diff changeset
107 Total number of hits: 5 (0.000405)
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
108 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
109 # Mc/sec: 2197.54
0
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
110 //
f239ab5f45f4 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
iuc
parents:
diff changeset
111 [ok]