Mercurial > repos > iuc > hmmer_nhmmer
view test-data/nhmmer.out @ 4:be0cc39776f9 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
| author | iuc |
|---|---|
| date | Mon, 11 Jun 2018 15:52:05 -0400 |
| parents | f239ab5f45f4 |
| children | b4fe2f703b4b |
line wrap: on
line source
# nhmmer :: search a DNA model, alignment, or sequence against a DNA database # HMMER 3.2 (June 2018); http://hmmer.org/ # Copyright (C) 2018 Howard Hughes Medical Institute. # Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - # query file: /tmp/tmpp4O0Ju/files/000/dataset_36.dat # target sequence database: /tmp/tmpp4O0Ju/files/000/dataset_37.dat # hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_39.dat # hits output in Dfam format: None # max ASCII text line length: unlimited # SSV filter P threshold: <= 0.02 # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # input query is asserted as: DNA # random number seed set to: 4 # number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: MADE1 [M=80] Accession: DF0000629.2 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- 8.7e-11 39.2 7.4 humanchr1/239220001-239550000 302390 302466 6.4e-08 30.0 8.3 humanchr1/239220001-239550000 174456 174498 9.3e-08 29.5 6.1 humanchr1/239220001-239550000 302466 302390 6.3e-06 23.7 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ 1.4 6.5 7.0 humanchr1/239220001-239550000 304073 304104 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 Alignment: score: 39.2 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466 899******************************************955533.443..33.44689************9986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 Alignment: score: 30.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 589************************************9975 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 Alignment: score: 29.5 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 68999999999999998................4666777765222222222222222268****************************9998 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 Alignment: score: 23.7 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 689********************************986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 Alignment: score: 6.5 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 tt a tgg aaaaa ca tta ttttgca humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 455779************************86 PP Internal pipeline statistics summary: ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) Residues passing SSV filter: 63737 (0.0966); expected (0.02) Residues passing bias filter: 44695 (0.0677); expected (0.02) Residues passing Vit filter: 2309 (0.0035); expected (0.001) Residues passing Fwd filter: 2041 (0.00309); expected (1e-05) Total number of hits: 5 (0.000405) # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 # Mc/sec: 1854.66 // [ok]