Mercurial > repos > iuc > hmmer_nhmmscan
comparison test-data/MADE1.nhmmscan_out @ 3:f68b43be32d7 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author | iuc |
---|---|
date | Mon, 11 Jun 2018 15:51:28 -0400 |
parents | c3075b7fdbdd |
children | 2d406da5d34e |
comparison
equal
deleted
inserted
replaced
2:c3075b7fdbdd | 3:f68b43be32d7 |
---|---|
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database | 1 # nhmmscan :: search DNA sequence(s) against a DNA profile database |
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ | 2 # HMMER 3.2 (June 2018); http://hmmer.org/ |
3 # Copyright (C) 2015 Howard Hughes Medical Institute. | 3 # Copyright (C) 2018 Howard Hughes Medical Institute. |
4 # Freely distributed under the GNU General Public License (GPLv3). | 4 # Freely distributed under the BSD open source license. |
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
6 # query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat | 6 # query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_41.dat |
7 # target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat | 7 # target HMM database: localref.hmm |
8 # per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat | 8 # per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_43.dat |
9 # hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat | 9 # hits output in Dfam format: /tmp/tmpp4O0Ju/files/000/dataset_44.dat |
10 # max ASCII text line length: unlimited | 10 # max ASCII text line length: unlimited |
11 # Vit filter P threshold: <= 0.001 | 11 # Vit filter P threshold: <= 0.001 |
12 # Fwd filter P threshold: <= 1e-05 | 12 # Fwd filter P threshold: <= 1e-05 |
13 # random number seed set to: 4 | 13 # random number seed set to: 4 |
14 # number of worker threads: 1 | 14 # number of worker threads: 1 |
16 | 16 |
17 Query: humanchr1/239220001-239550000 [L=330000] | 17 Query: humanchr1/239220001-239550000 [L=330000] |
18 Scores for complete hit: | 18 Scores for complete hit: |
19 E-value score bias Model start end Description | 19 E-value score bias Model start end Description |
20 ------- ------ ----- -------- ----- ----- ----------- | 20 ------- ------ ----- -------- ----- ----- ----------- |
21 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 21 8.7e-11 39.2 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
22 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 22 6.4e-08 30.0 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
23 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 23 9.3e-08 29.5 6.1 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
24 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 24 6.3e-06 23.7 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
25 ------ inclusion threshold ------ | 25 ------ inclusion threshold ------ |
26 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 26 1.4 6.5 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
27 | 27 |
28 | 28 |
29 Annotation for each hit (and alignments): | 29 Annotation for each hit (and alignments): |
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
33 ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 | 33 ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 |
34 | 34 |
35 Alignment: | 35 Alignment: |
36 score: 38.6 bits | 36 score: 39.2 bits |
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 | 38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 |
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa | 39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa |
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 | 40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466 |
41 899******************************************955533.443..334.4689***********99986 PP | 41 899******************************************955533.443..33.44689************9986 PP |
42 | 42 |
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
46 ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 | 46 ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 |
47 | 47 |
48 Alignment: | 48 Alignment: |
49 score: 29.6 bits | 49 score: 30.0 bits |
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 | 51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 |
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt | 52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt |
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 | 53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 |
54 589************************************9975 PP | 54 589************************************9975 PP |
55 | 55 |
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
59 ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 | 59 ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 |
60 | 60 |
61 Alignment: | 61 Alignment: |
62 score: 28.9 bits | 62 score: 29.5 bits |
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 | 64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 |
65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc | 65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc |
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 | 66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 |
67 68999999999999998................5666777776222222222222222268****************************9998 PP | 67 68999999999999998................4666777765222222222222222268****************************9998 PP |
68 | 68 |
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
72 ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 | 72 ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 |
73 | 73 |
74 Alignment: | 74 Alignment: |
75 score: 23.3 bits | 75 score: 23.7 bits |
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 | 77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 |
78 taatg caaaaacc caattacttttgcac aacctaa | 78 taatg caaaaacc caattacttttgcac aacctaa |
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 | 79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 |
80 689********************************985 PP | 80 689********************************986 PP |
81 | 81 |
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | 82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | 83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | 84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
85 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 | 85 ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 |
86 | 86 |
87 Alignment: | 87 Alignment: |
88 score: 6.3 bits | 88 score: 6.5 bits |
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | 89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 | 90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 |
91 tt a tgg aaaaa ca tta ttttgca | 91 tt a tgg aaaaa ca tta ttttgca |
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 | 92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 |
93 455779************************86 PP | 93 455779************************86 PP |
96 | 96 |
97 Internal pipeline statistics summary: | 97 Internal pipeline statistics summary: |
98 ------------------------------------- | 98 ------------------------------------- |
99 Query sequence(s): 1 (660000 residues searched) | 99 Query sequence(s): 1 (660000 residues searched) |
100 Target model(s): 1 (80 nodes) | 100 Target model(s): 1 (80 nodes) |
101 Residues passing SSV filter: 61794 (0.0936); expected (0.02) | 101 Residues passing SSV filter: 63737 (0.0966); expected (0.02) |
102 Residues passing bias filter: 46199 (0.07); expected (0.02) | 102 Residues passing bias filter: 44695 (0.0677); expected (0.02) |
103 Residues passing Vit filter: 2752 (0.00417); expected (0.001) | 103 Residues passing Vit filter: 2309 (0.0035); expected (0.001) |
104 Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) | 104 Residues passing Fwd filter: 2041 (0.00309); expected (1e-05) |
105 Total number of hits: 5 (0.000405) | 105 Total number of hits: 5 (0.000405) |
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 | 106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 |
107 # Mc/sec: 2640.00 | 107 # Mc/sec: 2407.09 |
108 // | 108 // |
109 [ok] | 109 [ok] |