diff test-data/MADE1.out @ 5:c1de05e20868 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
author iuc
date Tue, 16 Jun 2020 05:34:01 -0400
parents 74fc6d7d40f1
children 8a791afd99fb
line wrap: on
line diff
--- a/test-data/MADE1.out	Mon Jun 11 15:50:40 2018 -0400
+++ b/test-data/MADE1.out	Tue Jun 16 05:34:01 2020 -0400
@@ -1,13 +1,13 @@
 # hmmscan :: search sequence(s) against a profile database
-# HMMER 3.2 (June 2018); http://hmmer.org/
-# Copyright (C) 2018 Howard Hughes Medical Institute.
+# HMMER 3.3 (Nov 2019); http://hmmer.org/
+# Copyright (C) 2019 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpp4O0Ju/files/000/dataset_20.dat
+# query sequence file:             /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
 # target HMM database:             localref.hmm
-# per-seq hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_22.dat
-# per-dom hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_23.dat
-# pfam-style tabular hit output:   /tmp/tmpp4O0Ju/files/000/dataset_24.dat
+# per-seq hits tabular output:     /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat
+# per-dom hits tabular output:     /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat
+# pfam-style tabular hit output:   /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
@@ -20,54 +20,46 @@
    --- full sequence ---   --- best 1 domain ---    -#dom-
     E-value  score  bias    E-value  score  bias    exp  N  Model    Description
     ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
-    5.7e-18   51.8  27.9      2e-12   34.1   0.7    9.6  5  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    9.3e-18   51.2  26.3    1.3e-12   34.8   0.7    8.6  4  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
 
 
 Domain annotation for each model (and alignments):
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
    #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
  ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
-   1 ?   -4.5   0.0         1         1      30      54 ..   80044   80068 ..   80033   80072 .. 0.81
-   2 ?   -6.6   3.3         1         1      13      71 ..  154012  154072 ..  154011  154076 .. 0.75
-   3 !   27.4   0.7   2.4e-10   2.4e-10       1      43 [.  174456  174498 ..  174456  174577 .. 0.66
-   4 !   34.1   0.7     2e-12     2e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.86
-   5 ?    2.8   0.7     0.011     0.011      27      75 ..  304060  304107 ..  304022  304109 .. 0.62
+   1 !   27.4   0.6   2.4e-10   2.4e-10       1      43 [.  174456  174498 ..  174456  174520 .. 0.93
+   2 ?   -8.4   5.8         1         1      12      79 ..  197274  197341 ..  197272  197342 .. 0.86
+   3 !   34.8   0.7   1.3e-12   1.3e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.87
+   4 ?    1.4   0.4     0.033     0.033      27      74 ..  304060  304106 ..  304029  304108 .. 0.71
 
   Alignments for each domain:
-  == domain 1  score: -4.5 bits;  conditional E-value: 1
-                                      xxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1    30 ttgccattacttttaatggcaaaaa 54   
-                                      t g catt  ttt aatggcaaa a
-  humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
-                                      457899***************9865 PP
-
-  == domain 2  score: -6.6 bits;  conditional E-value: 1
-                                       xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71    
-                                       aaaagta tt +   ttttgc att      a  tttaa  gcaaa a +    tta  tttgca
-  humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
-                                       78999999999999999999999984444444457777777899988765....67777778776 PP
-
-  == domain 3  score: 27.4 bits;  conditional E-value: 2.4e-10
+  == domain 1  score: 27.4 bits;  conditional E-value: 2.4e-10
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
                                        ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
   humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
-                                       79**************************************996 PP
+                                       79**************************************997 PP
+
+  == domain 2  score: -8.4 bits;  conditional E-value: 1
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79    
+                                       caa  gtaatt +  tttt  c att   ttt  t  c aaa  c c  tta tt t  ac  a cta
+  humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341
+                                       567789*******************999999999999*****99999999999988877777776666 PP
 
-  == domain 4  score: 34.1 bits;  conditional E-value: 2e-12
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80    
-                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    aaaa  g  a t ctttt caccaa ctaa
-  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466
-                                       56899******************************************962223333..3.45578**************997 PP
+  == domain 3  score: 34.8 bits;  conditional E-value: 1.3e-12
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80    
+                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a     a t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
+                                       6799*****************************************99953333333345578**************997 PP
 
-  == domain 5  score: 2.8 bits;  conditional E-value: 0.011
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75    
-                                       tttt g c  ta  tt a tgg aaaaa ++ca tta ttttgca  aa
-  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
-                                       222223222222.3556779************************98765 PP
+  == domain 4  score: 1.4 bits;  conditional E-value: 0.033
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74    
+                                       tttt g c  ta  tt a tgg aaaaa + ca tta ttttgca  a
+  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106
+                                       334444443333.356788*************************9766 PP
 
 
 
@@ -81,7 +73,7 @@
 Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  1  [actual number of targets]
 Domain search space  (domZ):               1  [number of targets reported over threshold]
-# CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14
-# Mc/sec: 177.58
+# CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22
+# Mc/sec: 117.29
 //
 [ok]